Cytokines stimulate granulopoiesis through signaling via receptors whose expression is controlled by lineage-specific transcription factors. Previously, we demonstrated that granulocyte
colony-stimulating factor (G-CSF) receptor mRNA was undetectable and granulocyte maturation blocked in CCAAT enhancer binding protein
(C/EBP
)-deficient mice. This phenotype is distinct from that of G-CSF receptor
/
mice, suggesting that other genes are likely to
be adversely affected by loss of C/EBP
. Here we demonstrate loss of interleukin 6 (IL-6) receptor and IL-6-responsive colony-forming units (CFU-IL6) in C/EBP
/
mice. The observed failure of granulopoiesis could be rescued by the addition of soluble IL-6 receptor and
IL-6 or by retroviral transduction of G-CSF receptors, demonstrating that loss of both of these
receptors contributes to the absolute block in granulocyte maturation observed in C/EBP
-deficient hematopoietic cells. The results of these and other studies suggest that additional C/EBP
target genes, possibly other cytokine receptors, are also important for the block in granulocyte
differentiation observed in vivo in C/EBP
-deficient mice.
Key words:
 |
Introduction |
Multipotential hematopoietic stem cells differentiate
into all of the different lineages of blood cells. The
processes of distinct lineage differentiation is regulated by
distinct transcription factors such as GATA-1 for erythroid
cells, PU.1 for myeloid and B cells, and CCAAT enhancer
binding protein
(C/EBP
)1 for granulocytes (1, 2). The
molecular basis for how these factors regulate hematopoietic stem cell differentiation is still not clear. Interestingly,
all of these factors can positively regulate the expression
of lineage-specific growth factor receptors. For example,
GATA-1 activates the erythropoietin receptor promoter (3), PU.1 is critical for M-CSF receptor promoter activity (4), and C/EBP
is an important regulator of G-CSF receptor promoter function (5). Therefore, one possible
mechanism of transcription factor regulation of lineage differentiation is through activation of cell type-specific cytokine receptors.
C/EBP
is a member of the C/EBP transcription factor
family (6). Other members of this family include C/EBP
,
or NF-IL6, which is critical for macrophage activation (7,
8), and C/EBP
, which regulates granulocyte maturation at
a very terminal stage (9). C/EBP
has been shown to regulate a number of hepatocyte and adipocyte genes (10, 11).
Targeted deletion of the C/EBP
gene in mice disrupts
normal glucose metabolism, and homozygous newborn animals die from hypoglycemia within 8 h of birth (12, 13).
In the hematopoietic system, C/EBP
is expressed specifically in both human and murine myeloid cells (14). It upregulates several myeloid gene promoters, such as G-CSF
receptor (5), myeloperoxidase (15, 15a), and neutrophil
elastase (15a, 16). Recent studies have demonstrated that
C/EBP
expression is selectively maintained during granulocytic differentiation, but is markedly downregulated with
monocytic differentiation (17).
Previously, we reported that granulocyte maturation was
completely blocked in C/EBP
-deficient mice, but T cell,
B cell, and macrophage subsets were normal. Expression of
G-CSF receptor mRNA was profoundly and selectively reduced, whereas levels of M-CSF receptor, GM-CSF receptor
, and IL-3 receptor
mRNA were all comparable to
wild-type (18). No defects were observed in C/EBP
+/
mice. However, mice with a targeted disruption of the
G-CSF receptor only have a quantitative defect in granulopoiesis; mature granulocyte are still detected at a level
12% of wild-type (19). These results suggest that in addition to G-CSF receptor, other genes were likely to be affected by loss of the C/EBP
gene.
Multiple cytokines are involved in the regulation of
granulopoiesis, including G-CSF, GM-CSF, IL-3, and IL-6
(20, 21). Mice that have been treated with IL-6 have an increased number of peripheral neutrophils (22). Double
transgenic mice which coexpress human IL-6 and soluble
IL-6 receptor demonstrate dramatic increases of white blood
cells consisting mainly of neutrophilic granulocytes compared with wild-type, single transgenic mice (23). Coadministration of recombinant human IL-6 and G-CSF to irradiation-induced myelosuppressed mice caused a synergistic
increase in the GM-CSF-responsive CFU (CFU-GM) in
peripheral blood and bone marrow (24). Loss of IL-6 in
G-CSF receptor-deficient mice leads to a significant further reduction in the number of mature neutrophils in peripheral blood and bone marrow (25). All of these data indicate that IL-6 also regulates granulopoiesis, and that IL-6
and G-CSF may have a synergistic effect on myelopoiesis.
The biological effects of IL-6 are known to be mediated
through their unique cell surface receptors (21). IL-6 receptors are expressed in many cell types, including plasmacytoma cells, macrophages, T cells, B cells, and pre-B cells
(26). During embryogenesis, it is expressed constitutively at
readily detectable levels that do not change significantly
during in vitro embryoid body development and blastocyst
development (27). In the hematopoietic system, the expression of IL-6 receptor rapidly decreases to undetectable levels during erythroid differentiation, and slowly decreases during granulocyte differentiation (28). IL-6 has been
shown to bind to the IL-6 receptor with low affinity (29).
However, the presence of gp130, a signal transducer not
only for IL-6 but also for leukocyte inhibition factor (LIF),
Oncostatin M, IL-11, and ciliary neurotrophic factor, together with IL-6 will result in high-affinity IL-6 binding
and subsequent signal transduction (30). The cytoplasmic
domain of the IL-6 receptor is apparently not required for
high-affinity IL-6 binding and signal transduction, since the
soluble form of the IL-6 receptor, when complexed to IL-6,
can also trigger high-affinity IL-6 binding and signaling on
target cells lacking IL-6 receptor but expressing gp130 (31). Interestingly, G-CSF receptor and gp130 share significant
similarity within their cytoplasmic domains (21, 30).
Here, we demonstrate that the IL-6 receptor is markedly
downregulated in C/EBP
/
mice, whereas the expression level of gp130 in C/EBP
/
mice is comparable
with the level in wild-type mice. C/EBP
/
progenitors
do not respond to IL-6 alone in vitro, but a small number
of precursors can differentiate to metamyelocytic granulocytes by the addition of soluble IL-6 receptor to the culture. Addition of G-CSF together with soluble IL-6 receptor and IL-6 induces formation of mature segmented
granulocytes. C/EBP
/
fetal liver hematopoietic cells
also can be rescued in vitro by transduction of G-CSF receptors into the cells by using retroviral infection. These
studies demonstrate that the IL-6 receptor is a second major target gene for C/EBP
. Restoration of expression of
either receptor can restore granulopoiesis in vitro, demonstrating that they are important functional targets for C/
EBP
.
 |
Materials and Methods |
Hematological Analysis.
Human recombinant IL-6 (500 ng/
ml), soluble IL-6 receptor (100 ng/ml), and G-CSF (1,000 U/
ml), which are all active on murine cells, and murine recombinant IL-3 (300 U/ml) and GM-CSF (10 ng/ml) were used in the
CFU assays. Methylcellulose culture of single cell suspensions of
fetal liver cells was performed in IMDM medium containing
0.8% methylcellulose and either 30% heat-inactivated fetal bovine
serum for IL-6 and G-CSF CFU assays, or 20% heat-inactivated serum for the GM-CSF and IL-3 CFU assays. 10% Chinese hamster ovary cell-conditioned medium from cells stably transfected
with a stem cell factor (SCF) expression vector was used as a
source of SCF, and 10% WEHI-3-conditioned medium was used
as a source of IL-3 for liquid cultures. Colonies were counted at
days 7-9. Two to four colonies were pooled and cytocentrifuged
onto glass slides daily after day 7. The slides were stained with
Wright-Giemsa (Diff-Quik; Baxter Healthcare Corp., Deerfield,
IL) according to the manufacturer's protocol.
Northern Blot Analysis.
Total RNA was isolated from mouse
fetal liver, adult bone marrow, spleen, thymus, and peritoneal
cells 48 h after thioglycollate stimulation, at which time 90% of the
cells are macrophages. Total RNA was purified by guanidine isothiocyanate extraction and cesium chloride gradient. Poly A+ RNA
was purified by oligo-(dT) chromatography. Northern blot analysis was performed as described previously (32). The probe used
was a 1.6-kb SacI fragment of murine IL-6 receptor cDNA (26).
Quantitative PCR.
Quantitative PCR analysis to determine
receptor mRNA levels was performed as described previously
(33). In brief, total RNA was purified from day 19 C/EBP
wild-type or
/
fetal liver. In vitro transcription of plasmid
pSPCR1 mRNA was used as a standard. The standard mRNA
concentration was measured by UV absorption after purification
by oligo-(dT) chromatography. The length of the IL-6 receptor
RNA molecules obtained from transcription of pSPCR1 as the
template was 520 bp, and 1 µg of RNA equals 1.76 × 1012 molecules. First-strand cDNA from fetal liver RNA was synthesized by reverse transcription (RT) according to the manufacturer's protocol (Boehringer Mannheim Corp., Indianapolis, IN). The
reaction contained 2 µg of total cellular RNA and decreasing
amounts of standard RNA starting at 108 molecules. 1 µl of RT
product was used for PCR. The annealing temperature for
G-CSF receptor was 52°C; for the IL-6 receptor, 52°C; and for
gp130, 54°C. The oligonucleotides used were as follows: for
the IL-6 receptor, 5'-primer, ACCACGAGGATCAGTACGAA,
and 3'-primer, TGTTGTCATAAGGGCTCTGT; for gp130,
5'-primer, TTGAAGTCTGGGTGGAAGCA, and 3'-primer,
GGTGGTCTGGATGGTCTGTC; for the G-CSF receptor,
5'-primer, TCCGTCACCCTAAACATCTC, and 3'-primer,
TGGAAGGTTTCCTCTGTCAT. PCR amplification was continued for 30 cycles. 5 µl of each PCR product was electrophoresed in 5% polyacrylamide gels in 1× TBE buffer. Quantitation of autoradiography of dried gels was performed using a
PhosphorImager and ImageQuant densitometry software (Molecular Dynamics, Sunnyvale, CA).
Flow Cytometry (FACS®).
Human recombinant G-CSF and
IL-6 were biotinylated by using NHS-LC-biotin (Pierce Chemical Co., Rockford, IL) following the manufacturer's procedure.
Single cell suspensions of fetal liver and spleen cells were washed
twice with PBS and then incubated at 4°C for 1 h with biotinylated G-CSF (25 ng/106 cells) or IL-6 (25 ng/106 cells). After
washing twice with PBS, the cells were incubated with PE-conjugated streptavidin. Cells were analyzed on a FACScan® flow
cytometer (Becton Dickinson, San Jose, CA). G-CSF and IL-6 (without biotinylation) were used as controls.
Retrovirus Infection of G-CSF Receptor-expressing Retroviruses.
For retroviral transduction experiments, the murine G-CSF receptor cDNA (the EcoRI/XhoI fragment) was inserted into the
MND-X-SN retroviral plasmid (34). This construct was stably
transfected into the GP+E86 packaging cell line (35). Cells were
maintained in HXM (10% fetal bovine serum, 15 µg/ml of hypoxanthine, 250 µg/ml xanthine, 25 µg/ml mycophenolic acid)
and 0.8 mg/ml G418. The titer of the retrovirus from this producer line was 5 × 105 PFU/ml. For infection of fetal liver, producer cells were plated the day before cocultivation. The following day, when the cells were 80-90% confluent, they were
irradiated with a single dose of 3,000 rad from a 137Cs source. Single cell suspensions from C/EBP
wild-type, +/
, or
/
fetal
livers were washed with PBS. After lysis of red blood cells with
ACK (0.15 M MH4Cl, 1.0 mM KHCO3, 0.1 mM Na2EDTA,
pH 7.3), the cells were resuspended in IMDM medium containing 10% SCF (Chinese hamster ovary cell conditioned-medium)
and 8 µg/ml polybrene. The cells were divided into two cultures,
one with retrovirus producer cells, one without. 20 h later, cells
were harvested and plated in methylcellulose.
 |
Results |
C/EBP
/
Murine Myeloid Progenitors Do Not Respond
to IL-6.
Because of the differences in phenotype between
C/EBP
/
and G-CSF receptor
/
mice, we suspected
that other cytokine signaling pathways in addition to
G-CSF may be adversely affected in C/EBP
/
mice.
Therefore, to investigate the response of C/EBP
-deficient cells to various cytokines, methylcellulose CFU assays
were performed using liver hematopoietic cells. As shown
in Table 1, the total colony numbers from
/
mice are
quantitatively equal to those from wild-type mice in the
presence of GM-CSF and IL-3. We also observed mature
granulocytes in colonies derived from C/EBP
/
mice in
the presence of IL-3 or GM-CSF, as shown in Fig. 1. The percentage of segmented neutrophils in IL-3-responsive
CFU (CFU-IL3) and CFU-GM-CSF derived from C/
EBP
/
fetal liver is much lower than those from wild-type mice. In contrast, the percentage of myeloblasts in C/
EBP
/
mice is much higher than in wild-type mice in
CFU assays performed in the presence of IL-3 and GM-CSF, as shown in Table 2. In cultures of C/EBP
wild-type hematopoietic progenitors, IL-6-stimulated colonies
contained immature and mature granulocytic cells and mature macrophages. However, C/EBP
-deficient cells did
not respond to IL-6 (Table 1). These results indicate that
C/EBP
/
mice have myeloid precursors that responded
to IL-3 and GM-CSF in vitro, but that there is no such
population that responded to IL-6.

View larger version (90K):
[in this window]
[in a new window]
|
Fig. 1.
GM-CSF and IL-3 can stimulate C/EBP / fetal liver cells to differentiate to mature granulocytes. (A-D) Representative views of cells
from colonies obtained in CFU assays (Table 1) from C/EBP +/ (A and C) and / (B and D) fetal liver in the presence of GM-CSF or IL-3 after 7 d
in methylcellulose culture. Two to three colonies from each plate were pooled, cytocentrifuged onto slides, and stained with Wright-Giemsa. (E and F)
The same cells were grown in liquid culture in the presence of IL-3 and SCF for 5 d. E shows cells derived from +/ mice, and F from / mice.
Identical results were obtained after culture with GM-CSF. We were also not able to distinguish differences between cells obtained from wild-type and
heterozygous animals in any of the experiments in this study.
|
|
Mutation of C/EBP
Results in Drastically Decreased Expression of IL-6 Receptor and G-CSF Receptor mRNA.
To examine whether IL-6 receptor expression is defective in
C/EBP
/
mice, we first performed Northern blot analysis. As shown in Fig. 2 A, IL-6 receptor mRNA was
detected from the liver of day 19 C/EBP
+/
embryos.
The signal is weaker than that detected in RNA from adult
bone marrow, peritoneal cells after thioglycollate stimulation, spleen, and liver (data not shown). We did not detect any hybridization from total RNA from the liver of
day 19 C/EBP
/
embryos (Fig. 2 A, lane 2). However,
we could detect IL-6 receptor using poly A+ mRNA from
the liver of
/
day 19 embryos (Fig. 2 A, lane 4). To
quantitate the expression level of IL-6 receptor mRNA,
we performed quantitative PCR using RNA from livers of
C/EBP
/
and wild-type mice. The results of the quantitative PCR are shown in Fig. 2 B. The number of IL-6 receptor molecules per microgram of total liver RNA from
wild-type mice was very similar to that published previously (33). The number of IL-6 receptor mRNA molecules was dramatically reduced in
/
mice, 170-fold
lower than in wild-type animals. The number of gp130
molecules from
/
mice was comparable to the number
found in wild-type mice, and the number of G-CSF receptor molecules from
/
livers was 17-fold lower than in
wild-type livers (data not shown). These results further
support the notion that C/EBP
regulates G-CSF receptor
not only in vitro (5), but also in vivo. Our results also suggest that C/EBP
directly or indirectly regulates IL-6 receptor but not gp130 mRNA expression in vivo.

View larger version (20K):
[in this window]
[in a new window]

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 2.
IL-6 receptor
mRNA is markedly decreased in
C/EBP / mice. (A) Northern
blot analysis of IL-6 receptor
mRNA. 15 µg of total RNA
from C/EBP +/ day 19 fetal
liver (lane 1) and C/EBP /
day 19 fetal liver (lane 2), and 2 µg of poly A+ RNA from C/
EBP +/ day 19 fetal liver (lane
3) and / day 19 fetal liver
(lane 4) were electrophoresed in 1% agarose/formaldehyde gels, transferred to nylon membranes, and hybridized to a murine IL-6 receptor cDNA (reference 26). The position of the IL-6 receptor mRNAs (left) and the 28S and 18S RNAs (right) are shown. Below the total RNA blot (left) are shown the
results of hybridization of an 18S ribosomal RNA oligonucleotide to the blot (5'-TCGGGCCTGCTTTGAACA-3' [reference 51]), and below the poly
A+ blot (right) are shown the results of hybridization of a GAPDH probe (reference 52). (B) Quantitative RT-PCR analysis of IL-6 receptor mRNA.
Above the autoradiograph are indicated the numbers of molecules of competitor RNA. The first five lanes are sample RNAs (2 µg/lane) from C/EBP
wild-type fetal liver, and the last five lanes are from C/EBP / fetal liver RNA. The locations of the standard and IL-6 receptor-amplified PCR products are indicated (left).
|
|
Hematopoietic Cells in C/EBP
Mutant Mice Have Undetectable IL-6 Receptor and G-CSF Receptor Protein Levels.
Our quantitative PCR results demonstrated very low levels
of G-CSF receptor and IL-6 receptor mRNA, and showed
that progenitor cells from C/EBP
/
mice did not respond to G-CSF and IL-6 in vitro or in vivo (18). To determine the protein levels of IL-6 receptor and G-CSF receptor expression, hematopoietic cells from the liver of C/
EBP
wild-type and
/
mice were labeled separately
with biotinylated G-CSF and IL-6 followed by PE-conjugated streptavidin. After staining, the cells were analyzed
by FACS®. As shown in Fig. 3, A, C, and E, G-CSF receptor-positive and IL-6 receptor-positive cell populations are
easily detected in C/EBP
+/
fetal liver and spleen, but
there are no such populations detected in
/
mice (Fig.
3, B, D, and F). Therefore, the expression of G-CSF receptor and IL-6 receptor on the surface of C/EBP
/
cells is undetectable. The number of G-CSF receptors on
mature granulocytes is much higher than on immature myeloid cells (36), and C/EBP
/
animals do not make mature granulocytes. One possible explanation for the low
level of G-CSF receptors detected in C/EBP
/
mice is
the absence of mature granulocytes in the liver and spleen. Therefore, hematopoietic cells from C/EBP
heterozygous and
/
fetal liver were cultured in suspension in
the presence of SCF and IL-3 to stimulate both heterozygous and
/
cells towards mature granulocytic differentiation. As shown below, SCF alone does not promote
granulocyte differentiation or development, but was added
to the cultures to promote viability in the absence of other
growth factors. After 5 d in culture with IL-3, the cells were cytocentrifuged onto slides and subsequently stained
with Wright-Giemsa. Mature granulocytes appeared in
both heterozygous and
/
cultures, but the percentage
of mature granulocytes in heterozygous cultures was higher
than that observed in the
/
cultures, similar to what
was observed in the CFU assays (Fig. 1, E and F). The cells
were harvested and then stained with biotinylated G-CSF
and IL-6. As shown in Fig. 3, G-J, we still failed to observe G-CSF receptor and IL-6 receptor-positive cells from
/
compared with wild-type mice, even after culture in IL-3
induced morphologic maturation in which ~30% of the
cells were metamyelocytes or segmented granulocytes.
These results indicated that although mature segmented granulocytes are not present in vivo in C/EBP
mice,
stimulation of C/EBP
/
hematopoietic cells with cytokines like GM-CSF and IL-3 can induce the formation of
cells which have the morphologic appearance of mature
cells yet still do not express G-CSF receptor and IL-6 receptor. Therefore, the absence of G-CSF receptor and IL-6
receptor is not simply a result of absence of mature cells,
and the G-CSF receptor and IL-6 receptor are truly regulated, either directly or indirectly, by C/EBP
in vivo.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 3.
Flow cytometry analysis with biotinylated IL-6 and G-CSF.
Cells from C/EBP +/ (A and C)
or C/EBP / (B and D) day 17 fetal liver or from +/ (E) or /
(F) day 17 fetal spleen were stained
with biotinylated G-CSF (A and B)
or biotinylated IL-6 (C-F). Cells
from C/EBP +/ (G and I) or C/
EBP / (H and J) were cultured
in IL-3 and SCF for 5 d and then
stained with biotinylated G-CSF (G
and H) or biotinylated IL-6 (I and
J). b, The FACS® profiles using biotinylated factor (G-CSF or IL-6);
bar, the profiles using unbiotinylated factor, which serves as a control. In the bottom row, the profiles
using biotinylated and unbiotinylated factor are superimposable.
y-axis, Number of events (10,000 events counted in each panel); x-axis,
log10 fluorescence.
|
|
IL-6 and Soluble IL-6 Receptor Together Can Rescue C/
EBP
Granulopoiesis In Vitro.
These results suggest that
lack of IL-6 and G-CSF signaling due to loss of both IL-6
and G-CSF receptors contributes to the block of granulocyte maturation in C/EBP
/
mice. This phenotype
could potentially be rescued by restoration of the receptors
on the surface of the cells. The cytoplasmic domain of the
IL-6 receptor is not required for IL-6 binding and signal
transduction, as IL-6 can bind to soluble IL-6 receptor and
this complex can trigger gp130 to transduce a signal on
cells that lack the IL-6 receptor (31). Therefore, fetal liver
suspension cells from both wild-type and
/
day 14 to
day 16 embryos were used in CFU assays in the presence of
IL-6 plus soluble IL-6 receptor, and IL-6 plus soluble IL-6
receptor plus G-CSF, respectively (Table 1). There were
significant numbers of colonies generated from wild-type
mice in the presence of IL-6 plus soluble IL-6 receptors which were morphologically CFU-GM. When G-CSF
was also added, both the colony number and the percentage of mature granulocytes increased as well (Tables 1 and
2; Fig. 4, A and C). Compared with those from wild-type animals, the colony numbers from C/EBP
/
cells
in the presence of IL-6 and soluble IL-6 receptor were lower, but a small number of metamyelocytes and segmented neutrophils appeared from the colonies after day 6 as shown in Fig. 4 B. Most of cells in the
/
colony
were immature cells. Interestingly, increases in colony
numbers and percentage of more mature segmented granulocytes were observed in C/EBP
/
mice after the addition of G-CSF to the IL-6 plus soluble IL-6 receptor culture as shown in Fig. 4 D. These results indicated that IL-6
plus soluble IL-6 receptor can partially rescue the C/EBP
phenotype in vitro but does not efficiently induce terminal maturation of granulocytes.

View larger version (99K):
[in this window]
[in a new window]
|
Fig. 4.
Mature granulocytes
are observed after rescue by soluble IL-6 receptor and G-CSF receptor retrovirus. (A, C, and E)
Cells from C/EBP +/ fetal
liver. (B, D, and F) Cells from
C/EBP / fetal liver. A and B
show cells from CFU assays with
IL-6 and soluble IL-6 receptor in
the medium; C and D, CFU
with IL-6, soluble IL-6 receptor,
and G-CSF in the medium. E
and F show CFU after infection
of fetal liver cells with the
G-CSF receptor retrovirus described in the legend to Fig. 5
followed by culture in methylcellulose in the presence of G-CSF
only.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5.
Transduction of G-CSF receptor using retroviral infection of C/EBP /
fetal liver cells. The histograms represent
analysis of surface expression of G-CSF receptors on cells from C/EBP heterozygous
(A and B) and C/EBP / (C and D) without (A and C) or after (B and D) infection
with a murine G-CSF receptor expressing
retrovirus, followed by culture in the presence of SCF only for 5 d, then FACS® analysis after staining with biotinylated G-CSF.
b and bar, Profiles obtained with biotinylated and unbiotinylated G-CSF, respectively. y-axis, Number of events (10,000 events counted in each panel); x-axis, log10
fluorescence. RV, Retrovirus.
|
|
Restoration of G-CSF Receptor Expression Can Restore the
Production of Mature Granulocytes In Vitro.
Granulocyte maturation was completely blocked in C/EBP
/
mice in
vivo. This phenotype can only be partially rescued by IL-6 signaling in vitro. Since G-CSF receptors were undetectable in C/EBP
/
mice, rescue experiments were performed by transduction of G-CSF receptors into the cells
using retrovirus infection. Day 15 fetal liver hematopoietic
cells from C/EBP
/
and heterozygous mice were cultured with or without murine G-CSF receptor retrovirus
producer cells in the presence of SCF (added to promote
cell viability) and polybrene. After 20-22 h, cells were harvested and were plated in methylcellulose in the presence of G-CSF (Table 1). In addition, cells were maintained in
the same culture conditions without polybrene for an additional 4 d and stained with biotinylated G-CSF to demonstrate induction of high levels of G-CSF receptor by the
retrovirus (Fig. 5). Colony numbers from C/EBP
heterozygous mice were not significantly different with or
without G-CSF receptor retrovirus infection. No colonies were observed in cultures from C/EBP
/
mice without
retrovirus infection, or with retrovirus infection but cultured in the absence of added G-CSF. Infected cells from C/EBP
heterozygous mice also yielded no colonies when
cultured without G-CSF. Colonies were observed from
G-CSF receptor retrovirus-infected C/EBP
/
cells in
the presence of G-CSF, but less than the number from C/
EBP
heterozygous hematopoietic cells after retrovirus infection (Table 1). Mature granulocytes could be detected in
the
/
colonies (Fig. 4 F). Interestingly, when infected
cells were plated in medium in the presence of IL-6 and
soluble IL-6 receptor in addition to G-CSF, the colony
numbers were only slightly increased, but the percentage of
mature granulocytes from C/EBP
/
cells was increased
to almost the same level as that from C/EBP
heterozygous mice (Tables 1 and 2). Therefore, restoration of both
IL-6 receptor and G-CSF receptor levels restored granulocyte production in vitro.
 |
Discussion |
Previously, we had reported that granulocyte differentiation and maturation were selectively blocked, and the expression of G-CSF receptor mRNA could not be detected
by Northern blot analysis in cells from mice with a targeted
disruption of the C/EBP
gene. However, mice with a
targeted disruption of either G-CSF (37) or G-CSF receptor (19) show a decrease only in the number of peripheral
blood neutrophils but are not blocked in maturation. Therefore, other mechanisms in addition to G-CSF are involved for induction of granulopoiesis. In this paper, we
show that hematopoietic cells from C/EBP
/
fetal liver
can form CFU-GM in the presence of IL-3 or GM-CSF in
vitro. However, the percentage of mature granulocytes is
lower in
/
than in wild-type cells. These results indicate that immature myeloid progenitors are present in C/
EBP
/
mice, and those progenitors respond to GM-CSF
and IL-3. Interestingly, these cells do not mature in response to retinoic acid, a potent inducer of granulocytic
differentiation (38), given both in vivo and in vitro (data
not shown). These immature cells also do not respond to
IL-6 and G-CSF in vitro. There are several possible explanations for why GM-CSF and IL-3 could stimulate myeloid precursors to differentiate into mature granulocytes in
vitro, but granulocytes are not observed in vivo. First,
GM-CSF and IL-3 are not normally produced in the bone
marrow, but by activated T cells and mast cells (39). Fetal
T cells and mast cells are not normally activated by pathogens because of the protection of the placental barrier. Consistent with this hypothesis, neither GM-CSF nor IL-3
could be detected in adult bone marrow, during embryonic
stem cell differentiation by RT-PCR or during in vitro
culture of embryonic blastocysts (40, 41). These studies
suggest that the fetus does not produce its own IL-3 and
GM-CSF. To investigate whether IL-3 could rescue granulopoiesis in vivo, we administered IL-3 into a C/EBP
+/
pregnant female that had mated with a C/EBP
+/
male.
Day 19 embryos were analyzed, but no mature granulocytes could be detected in C/EBP
/
peripheral blood or
fetal liver. However, since no changes were detected in
C/EBP
wild-type fetuses as well, it is possible that IL-3
and GM-CSF may, like erythropoietin (42) but not G-CSF (43), be unable to cross the placental barrier. Mice deficient in the entire IL-3/GM-CSF/IL-5 signaling pathway revealed normal numbers of total peripheral leukocyte counts
and differential counts except for eosinophils (44). These
results suggest that GM-CSF and IL-3 are not necessary for
routine production of mature neutrophils. These two factors may play a major role in expansion of hematopoietic
cells in emergency situations (39). IL-3 and GM-CSF share
a common
chain receptor which signals by inducing protein phosphorylation of similar proteins (45); the two cytokines can also compete with each other in binding to
their high-affinity receptors (46). All of these studies suggest that there may be a cell population in mice that expresses both GM-CSF and IL-3 receptors on the cell surface. This population apparently exists in the C/EBP
/
mice, but because there is no GM-CSF and IL-3 in the fetus, this population might not differentiate in vivo but
could nevertheless differentiate in vitro after stimulation
with IL-3 and GM-CSF.
The absence of G-CSF signaling alone could not explain
the phenotype of C/EBP
-deficient mice, and IL-6 is another important growth factor for myeloid cell proliferation and differentiation (20). Our previous studies suggested that G-CSF receptor and IL-6 receptor stimulated
the same myeloid progenitors (19). Therefore, in addition
to the G-CSF receptor, the IL-6 receptor could be a candidate target for the C/EBP
transcription factor, and indeed, the number of CFU-IL6 is drastically reduced in
C/EBP
/
mice. The phenotype of mice deficient in
the IL-6 signal transducer gp130 is distinct from that of
C/EBP
/
mice (47), so we focused our studies on the
expression of the IL-6 receptor. Like G-CSF receptor, IL-6
receptor could not be detected by Northern blot analysis of
total fetal liver RNA from C/EBP
/
mice. By quantitative RT-PCR, IL-6 receptor could be detected, but IL-6
receptor mRNA in C/EBP
/
mice is 170-fold lower
than in wild-type mice. As expected, the expression of
gp130 is normal in C/EBP
/
compared with wild-type
mice. Staining of hematopoietic cells from C/EBP
wild-type and
/
fetal liver with biotinylated G-CSF and IL-6
demonstrated no surface G-CSF receptor and IL-6 receptor-positive cell populations in C/EBP
/
mice. When
C/EBP
/
cells were induced to differentiate to mature
granulocytes with IL-3 and SCF or GM-CSF and SCF, the
morphologically mature cells are still IL-6 and G-CSF receptor-negative. These findings demonstrate that C/EBP
is a major regulator for both IL-6 receptor and G-CSF receptor in vivo, and mature cells from IL-3 and GM-CSF
stimulation in vitro do not express IL-6 and G-CSF receptors. The proliferation and survival of these cells depend on
IL-3 and GM-CSF but not IL-6 and G-CSF. Mice with a
disruption of the IL-6 gene fail to efficiently control infection with vaccinia virus and Listeria monocytogenes, a facultative intracellular bacterium, and in these animals the inflammatory acute-phase response after tissue damage or
infection is severely compromised (48). Consistent with
this report and our current findings is the additional observation that the acute-phase response is completely lacking
in these same C/EBP
/
mice (Burgess-Beusse, B.L., and
G.J. Darlington, manuscript in preparation), perhaps due in
part to the loss of IL-6 receptor expression.
Because hematopoietic cells from C/EBP
/
mice lack
normal numbers of IL-6 receptors, no colonies were observed in CFU assays from C/EBP
/
cells when stimulated with IL-6 only. IL-6 can bind to the soluble form of
the IL-6 receptor, and can trigger gp130 signaling on target
cells lacking the IL-6 receptor but expressing gp130. When soluble IL-6 receptor and IL-6 were added to C/EBP
/
cells, CFU-IL6 were observed at a level 30% that of wild-type cells. Interestingly, the addition of G-CSF to the cultures with IL-6 and soluble IL-6 receptor resulted in increased numbers of colonies and percentage of mature
granulocytes in the colonies. Previously, it has been reported
that IL-6 stimulates stem cells in their ability to respond to
IL-3, and when IL-6 is combined with other recombinant
hematopoietic factors, including G-CSF, it can augment
responses to these factors or even modify them (49). The
results presented here suggest that G-CSF signaling may be
one of the growth factor pathways whose function can be augmented by IL-6.
The block of granulocytic differentiation in C/EBP
/
mice can only be partially rescued in vitro by restoration of
IL-6 receptor. Therefore, we infected fetal liver cells from
C/EBP
wild-type and
/
mice with a retrovirus expressing the wild-type G-CSF receptor. When the cells
were placed in culture without added growth factors, no
colonies were detected after retrovirus infection from both
wild-type and
/
mice. When infected cells from the C/
EBP
/
mice were cultured in the presence of G-CSF,
cells from
/
liver generated half the number of colonies
compared with wild-type liver, and these colonies contained mature granulocytes in addition to macrophages and
immature myeloid cells. With the addition of IL-6 and soluble IL-6 receptor to the same cultures, the colony number
was still lower than in wild-type. Furthermore, our recent studies have shown that the IL-6 and G-CSF receptor double knockout phenotype is similar to that of the G-CSF receptor alone and, unlike the C/EBP
/
mouse, still
makes mature granulocytes. These results suggest that in
addition to the IL-6 and G-CSF receptor, some other genes are affected in the C/EBP
/
mice (15a). Since the G-CSF
receptor and gp130 have a similar intracellular domain and
activate similar signaling pathways, our combined data suggest that there is a G-CSF and IL-6 receptor-positive cell
population in mice. The generation of mature granulocytes from this population of cells is blocked due to the lack of
IL-6 and G-CSF responsiveness, but another population
can respond, at least in vitro, to IL-3 and GM-CSF.
Whether such a population exists in vivo can potentially be
addressed once mice with selective restoration of C/EBP
expression in liver and not blood, and with longer viability,
are produced.
In summary, we demonstrate that C/EBP
may directly
or indirectly regulate the IL-6 receptor. In the absence of
C/EBP
, we observed a marked decrease in IL-6 and
G-CSF receptor expression. Neither IL-6 nor G-CSF signaling is required for myeloid cell lineage commitment, but
they are likely to play an important role in proliferation
and/or viability of myeloid precursors. Our results raise the
very interesting possibility (Fig. 6 A) that two distinct populations of granulocyte-macrophage progenitors are present in the murine hematopoietic system, one G-CSF and IL-6
dependent and the other IL-3 and GM-CSF dependent.
Alternatively, granulocyte development occurs in several
stages, beginning with an IL-3 and GM-CSF-responsive
precursor, which itself can further differentiate to become
responsive to G-CSF and IL-6 (Fig. 6 B). This latter model
is more consistent with the hierarchical expression of CSF receptors (50). Our data tend to support the first model
(Fig. 6 A). At least in vitro, loss of C/EBP
mainly affects
the G-CSF/IL-6-dependent precursor, and stimulation of
either IL-3 or GM-CSF can induce granulocyte formation.
If such a model is correct, it remains to be determined why
this latter pathway is incapable of inducing formation of
mature granulocytes in C/EBP
knockout animals.

View larger version (12K):
[in this window]
[in a new window]

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 6.
Two models of granulocytic development. (A) A pluripotential stem cell differentiates into an immature multipotent myeloid progenitor, perhaps under the influence of transcription factors such as PU.1
(reference 2). This cell can then further differentiate to a mature granulocyte, either via a CFU-G/CFU-IL6 precursor which is dependent upon
C/EBP function, or via a CFU-IL3/CFU-GM precursor which is C/
EBP independent. (B) The multipotent progenitor differentiates into an
early granulocytic precursor that can respond to IL-3 and/or GM-CSF,
which itself is induced to differentiate further under the influence of C/
EBP to a precursor that responds to G-CSF and/or IL-6.
|
|
Address correspondence to Daniel G. Tenen, Harvard Institutes of Medicine, Rm. 954, 77 Ave. Louis Pasteur, Boston, MA 02115. Phone: 617-667-5561; Fax: 617-667-3299; E-mail: dtenen{at}bidmc.harvard.edu
Received for publication 6 May 1998 and in revised form 29 June 1998.
We would like to thank Tetsuya Taga for his generous gift of IL-6, soluble IL-6 receptor, and the IL-6 receptor cDNA; Connie Eaves for providing murine IL-3; Jose-Carlos Gutierrez-Ramos for the pSPCR1
plasmid used for quantitative PCR analysis of IL-6 receptor and G-CSF receptor expression; and Bruce Torbett, Hanna Radomska, and Hui-min Chen for helpful discussions and comments.
This work was supported by grants from the National Institutes of Health (HL-56745 and CA-72009) to
D.G. Tenen.
| 1.
|
Shivdasani, R.A., and
S.H. Orkin.
1996.
The transcriptional
control of hematopoiesis.
Blood.
87:
4025-4039
[Free Full Text].
|
| 2.
|
Tenen, D.G.,
R. Hromas,
J.D. Licht, and
D.-E. Zhang.
1997.
Transcription factors, normal myeloid development,
and leukemia.
Blood.
90:
489-519
[Free Full Text].
|
| 3.
|
Zon, L.I.,
H. Youssoufian,
C. Mather,
H.F. Lodish, and
S.H. Orkin.
1991.
Activation of the erythropoietin receptor promoter by transcription factor GATA-1.
Proc. Natl. Acad. Sci.
USA.
88:
10638-10641
[Abstract/Free Full Text].
|
| 4.
|
Zhang, D.-E.,
C.J. Hetherington,
H.M. Chen, and
D.G. Tenen.
1994.
The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor.
Mol. Cell. Biol.
14:
373-381
[Abstract/Free Full Text].
|
| 5.
|
Smith, L.T.,
S. Hohaus,
D.A. Gonzalez,
S.E. Dziennis, and
D.G. Tenen.
1996.
PU.1 (Spi-1) and C/EBP regulate the
granulocyte colony-stimulating factor receptor promoter in
myeloid cells.
Blood.
88:
1234-1247
[Abstract/Free Full Text].
|
| 6.
|
Cao, Z.,
R.M. Umek, and
S.L. McKnight.
1991.
Regulated
expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells.
Genes Dev.
5:
1538-1552
[Abstract/Free Full Text].
|
| 7.
|
Screpanti, I.,
L. Romani,
P. Musiani,
A. Modesti,
E. Fattori,
D. Lazzaro,
C. Sellitto,
S. Scarpa,
D. Bellavia,
G. Lattanzio, et al
.
1995.
Lymphoproliferative disorder and imbalanced
T-helper response in C/EBP -deficient mice.
EMBO (Eur.
Mol. Biol. Organ.) J.
14:
1932-1941
[Medline].
|
| 8.
|
Tanaka, T.,
S. Akira,
K. Yoshida,
M. Umemoto,
Y. Yoneda,
N. Shirafuji,
H. Fujiwara,
S. Suematsu,
N. Yoshida, and
T. Kishimoto.
1995.
Targeted disruption of the NF-IL6 gene
discloses its essential role in bacteria killing and tumor cytotoxicity by macrophages.
Cell.
80:
353-361
[Medline].
|
| 9.
|
Yamanaka, R.,
C. Barlow,
J. Lekstrom-Himes,
L.H. Castilia,
P.P. Liu,
M. Eckhaus,
T. Decker,
A. Wynshaw-Boris, and
K.G. Xanthopoulos.
1997.
Impaired granulopoiesis, myelodysplasia and early lethality in CCAAT/enhancer binding
protein -deficient mice.
Proc. Natl. Acad. Sci. USA.
94:
13187-13192
[Abstract/Free Full Text].
|
| 10.
|
Christy, R.J.,
V.W. Yang,
J.M. Ntambi,
D.E. Geiman,
W.H. Landschulz,
A.D. Friedman,
Y. Nakabeppu,
T.J. Kelly, and
M.D. Lane.
1989.
Differentiation-induced gene expression in
3T3-L1 preadipocytes: CCAAT/enhancer binding protein
interacts with and activates the promoters of two adipocyte-specific genes.
Genes Dev.
3:
1323-1335
[Abstract/Free Full Text].
|
| 11.
|
Friedman, A.D.,
W.H. Landschulz, and
S.L. McKnight.
1989.
CCAAT/enhancer binding protein activates the promoter of the serum albumin gene in cultured hepatoma cells.
Genes Dev.
3:
1314-1322
[Abstract/Free Full Text].
|
| 12.
|
Wang, N.D.,
M.J. Finegold,
A. Bradley,
C.N. Ou,
S.V. Abdelsayed,
M.D. Wilde,
L.R. Taylor,
D.R. Wilson, and
G.J. Darlington.
1995.
Impaired energy homeostasis in C/EBP
knockout mice.
Science.
269:
1108-1112
[Abstract/Free Full Text].
|
| 13.
|
Flodby, P.,
C. Barlow,
H. Kylefjord,
L. Ahrlund-Richter, and
K.G. Xanthopoulos.
1996.
Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/
enhancer binding protein .
J. Biol. Chem.
271:
24753-24760
[Abstract/Free Full Text].
|
| 14.
|
Scott, L.M.,
C.I. Civin,
P. Rorth, and
A.D. Friedman.
1992.
A novel temporal expression pattern of three C/EBP family
members in differentiating myelomonocytic cells.
Blood.
80:
1725-1735
[Abstract/Free Full Text].
|
| 15.
|
Ford, A.M.,
C.A. Bennett,
L.E. Healy,
M. Towatari,
M.F. Greaves, and
T. Enver.
1996.
Regulation of the myeloperoxidase enhancer binding proteins PU.1, C-EBP , , and during granulocytic-lineage specification.
Proc. Natl. Acad.
Sci. USA.
93:
10838-10843
[Abstract/Free Full Text].
|
| 15a.
|
Iwama, A.,
P. Zhang,
G.J. Darlington,
R.A. Maki, and
D.G. Tenen.
1998.
Use of RDA analysis of knockout mice to identify myeloid genes regulated in vivo by PU.1 and C/EBP .
Nucleic Acids Res.
26:
3034-3043
[Abstract/Free Full Text].
|
| 16.
|
Oelgeschlager, M.,
I. Nuchprayoon,
B. Luscher, and
A.D. Friedman.
1996.
C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter.
Mol. Cell. Biol.
16:
4717-4725
[Abstract].
|
| 17.
|
Radomska, H.S.,
C.S. Huettner,
P. Zhang,
T. Cheng,
D.T. Scadden, and
D.G. Tenen.
1998.
CCAAT/Enhancer binding
protein is a regulatory switch sufficient for induction of
granulocytic development from bipotential myeloid progenitors.
Mol. Cell. Biol.
18:
4301-4314
[Abstract/Free Full Text].
|
| 18.
|
Zhang, D.-E.,
P. Zhang,
N.D. Wang,
C.J. Hetherington,
G.J. Darlington, and
D.G. Tenen.
1997.
Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein -deficient
mice.
Proc. Natl. Acad. Sci. USA.
94:
569-574
[Abstract/Free Full Text].
|
| 19.
|
Liu, F.,
H.Y. Wu,
R.L. Wesselschmidt,
T. Kornaga, and
D.C. Link.
1996.
Impaired production and increased apoptosis of neutrophils in granulocyte colony-stimulating factor receptor-deficient mice.
Immunity.
5:
491-501
[Medline].
|
| 20.
|
Metcalf, D..
1991.
Control of granulocytes and macrophages:
molecular, cellular, and clinical aspects.
Science.
254:
529-533
[Abstract/Free Full Text].
|
| 21.
|
Kishimoto, T.,
S. Akira,
M. Narazaki, and
T. Taga.
1995.
Interleukin-6 family of cytokines and gp130.
Blood.
86:
1243-1254
[Free Full Text].
|
| 22.
|
Pojda, Z., and
A. Tsuboi.
1990.
In vivo effects of human recombinant interleukin 6 on hemopoietic stem and progenitor
cells and circulating blood cells in normal mice.
Exp. Hematol.
18:
1034-1037
[Medline].
|
| 23.
|
Peters, M.,
P. Schirmacher,
J. Goldschmitt,
M. Odenthal,
C. Peschel,
E. Fattori,
G. Ciliberto,
H.P. Dienes,
K.H. Meyer
zum Buschenfelde, and
S. Rose-John.
1997.
Extramedullary
expansion of hematopoietic progenitor cells in interleukin
(IL)-6-sIL-6R double transgenic mice.
J. Exp. Med.
185:
755-766
[Abstract/Free Full Text].
|
| 24.
|
Suzuki, H.,
A. Okano,
C. Ejima,
A. Konishi,
Y. Akiyama,
K. Ozawa, and
S. Asano.
1996.
Interleukin-6 and granulocyte
colony-stimulating factor synergistically increase peripheral
blood progenitor cells in myelosuppressive mice.
Jpn. J. Cancer Res.
87:
938-944
[Medline].
|
| 25.
|
Liu, F.,
J. Poursine-Laurent,
H.Y. Wu, and
D.C. Link.
1997.
Interleukin-6 and the granulocyte colony-stimulating factor
receptor are major independent regulators of granulopoiesis
in vivo but are not required for lineage commitment or terminal differentiation.
Blood.
90:
2583-2590
[Abstract/Free Full Text].
|
| 26.
|
Sugita, T.,
T. Totsuka,
M. Saito,
K. Yamasaki,
T. Taga,
T. Hirano, and
T. Kishimoto.
1990.
Functional murine interleukin 6 receptor with the intracisternal A particle gene product at its cytoplasmic domain. Its possible role in plasmacytomagenesis.
J. Exp. Med.
171:
2001-2009
[Abstract/Free Full Text].
|
| 27.
|
McClanahan, T.,
S. Dalrymple,
M. Barkett, and
F. Lee.
1993.
Hematopoietic growth factor receptor genes as markers
of lineage commitment during in vitro development of hematopoietic cells.
Blood.
81:
2903-2915
[Abstract/Free Full Text].
|
| 28.
|
Testa, U.,
C. Fossati,
P. Samoggia,
R. Masciulli,
G. Mariani,
H.J. Hassan,
N.M. Sposi,
R. Guerriero,
V. Rosato,
M. Gabbianelli, et al
.
1996.
Expression of growth factor receptors in
unilineage differentiation culture of purified hematopoietic
progenitors.
Blood.
88:
3391-3406
[Abstract/Free Full Text].
|
| 29.
|
Yamasaki, K.,
T. Taga,
Y. Hirata,
H. Yawata,
Y. Kawanishi,
B. Seed,
T. Taniguchi,
T. Hirano, and
T. Kishimoto.
1988.
Cloning and expression of the human interleukin-6 (BSF-2/
IFN beta 2) receptor.
Science.
241:
825-828
[Abstract/Free Full Text].
|
| 30.
|
Taga, T.,
M. Hibi,
Y. Hirata,
K. Yamasaki,
K. Yasukawa,
T. Matsuda,
T. Hirano, and
T. Kishimoto.
1989.
Interleukin-6
triggers the association of its receptor with a possible signal
transducer, gp130.
Cell.
58:
573-581
[Medline].
|
| 31.
|
Hibi, M.,
M. Murakami,
M. Saito,
T. Hirano,
T. Taga, and
T. Kishimoto.
1990.
Molecular cloning and expression of an
IL-6 signal transducer, gp130.
Cell.
63:
1149-1157
[Medline].
|
| 32.
|
Chen, H.M.,
P. Zhang,
M.T. Voso,
S. Hohaus,
D.A. Gonzalez,
C.K. Glass,
D.-E. Zhang, and
D.G. Tenen.
1995.
Neutrophils and monocytes express high levels of PU.1 (Spi-1)
but not Spi-B.
Blood.
85:
2918-2928
[Abstract/Free Full Text].
|
| 33.
|
Jia, G.Q., and
J.C. Gutierrez-Ramos.
1995.
Analysis of interleukin receptor gene expression in mouse fetal liver by quantitative polymerase chain reaction.
Eur. J. Immunol.
25:
2096-2100
[Medline].
|
| 34.
|
Challita, P.M.,
D. Skelton,
A. el-Khoueiry,
X.J. Yu,
K. Weinberg, and
D.B. Kohn.
1995.
Multiple modifications in
cis elements of the long terminal repeat of retroviral vectors
lead to increased expression and decreased DNA methylation
in embryonic carcinoma cells.
J. Virol.
69:
748-755
[Abstract].
|
| 35.
|
Markowitz, D.,
S. Goff, and
A. Bank.
1988.
A safe packaging
line for gene transfer: separating viral genes on two different
plasmids.
J. Virol.
62:
1120-1124
[Abstract/Free Full Text].
|
| 36.
|
Nicola, N.A., and
D. Metcalf.
1985.
Binding of 125I-labeled
granulocyte colony-stimulating factor to normal murine hemopoietic cells.
J. Cell. Physiol.
124:
313-321
[Medline].
|
| 37.
|
Lieschke, G.J.,
D. Grail,
G. Hodgson,
D. Metcalf,
E. Stanley,
C. Cheers,
K.J. Fowler,
S. Basu,
Y.F. Zhan, and
A.R. Dunn.
1994.
Mice lacking granulocyte colony-stimulating factor
have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, and impaired neutrophil mobilization.
Blood.
84:
1737-1746
[Abstract/Free Full Text].
|
| 38.
|
Grignani, F.,
M. Fagioli,
M. Alcalay,
L. Longo,
P.P. Pandolfi,
E. Donti,
A. Biondi,
F. LoCoco, and
P.G. Pelicci.
1994.
Acute promyelocytic leukemia: from genetics to treatment.
Blood.
83:
10-25
[Free Full Text].
|
| 39.
|
Arai, K.I.,
F. Lee,
A. Miyajima,
S. Miyatake,
N. Arai, and
T. Yokota.
1990.
Cytokines: coordinators of immune and inflammatory responses.
Annu. Rev. Biochem.
59:
783-836
[Medline].
|
| 40.
|
Keller, G.,
M. Kennedy,
T. Papayannopoulou, and
M.V. Wiles.
1993.
Hematopoietic commitment during embryonic
stem cell differentiation in culture.
Mol. Cell. Biol.
13:
473-486
[Abstract/Free Full Text].
|
| 41.
|
Schmitt, R.M.,
E. Bruyns, and
H.R. Snodgrass.
1991.
Hematopoietic development of embryonic stem cells in vitro:
cytokine and receptor gene expression.
Genes Dev.
5:
728-740
[Abstract/Free Full Text].
|
| 42.
|
Wu, H.,
X. Liu,
R. Jaenisch, and
H.F. Lodish.
1995.
Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor.
Cell.
83:
59-67
[Medline].
|
| 43.
|
Medlock, E.S.,
D.L. Kaplan,
M. Cecchini,
T.R. Ulich,
J. del
Castillo, and
J. Andresen.
1993.
Granulocyte colony-stimulating factor crosses the placenta and stimulates fetal rat granulopoiesis.
Blood.
81:
916-922
[Abstract/Free Full Text].
|
| 44.
|
Nishinakamura, R.,
N. Nakayama,
Y. Hirabayashi,
T. Inoue,
D. Aud,
T. McNeil,
S. Azuma,
S. Yoshida,
Y. Toyoda,
K. Arai, et al
.
1995.
Mice deficient for the IL-3/GM-CSF/IL-5
beta c receptor exhibit lung pathology and impaired immune
response, while beta IL3 receptor-deficient mice are normal.
Immunity.
2:
211-222
[Medline].
|
| 45.
|
Kanakura, Y.,
B. Druker,
S.A. Cannistra,
Y. Furukawa,
Y. Torimoto, and
J.D. Griffin.
1990.
Signal transduction of the
human granulocyte-macrophage colony-stimulating factor
and interleukin-3 receptors involves tyrosine phosphorylation
of a common set of cytoplasmic proteins.
Blood.
76:
706-715
[Abstract/Free Full Text].
|
| 46.
|
Lopez, A.F.,
M.A. Vadas,
J.M. Woodcock,
S.E. Milton,
A. Lewis,
M.J. Elliott,
D. Gillis,
R. Ireland,
E. Olwell, and
L.S. Park.
1991.
Interleukin-5, interleukin-3, and granulocyte-macrophage colony-stimulating factor cross-compete for
binding to cell surface receptors on human eosinophils.
J.
Biol. Chem.
266:
24741-24747
[Abstract/Free Full Text].
|
| 47.
|
Yoshida, K.,
T. Taga,
M. Saito,
S. Suematsu,
A. Kumanogoh,
T. Tanaka,
H. Fujiwara,
M. Hirata,
T. Yamagami,
T. Nakahata, et al
.
1996.
Targeted disruption of gp130, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders.
Proc.
Natl. Acad. Sci. USA.
93:
407-411
[Abstract/Free Full Text].
|
| 48.
|
Kopf, M.,
H. Baumann,
G. Freer,
M. Freudenberg,
M. Lamers,
T. Kishimoto,
R. Zinkernagel,
H. Bluethmann, and
G. Kohler.
1994.
Impaired immune and acute-phase responses
in interleukin-6-deficient mice.
Nature.
368:
339-342
[Medline].
|
| 49.
|
Rennick, D.,
J. Jackson,
G. Yang,
J. Wideman,
F. Lee, and
S. Hudak.
1989.
Interleukin-6 interacts with interleukin-4 and
other hematopoietic growth factors to selectively enhance the
growth of megakaryocytic, erythroid, myeloid, and multipotential progenitor cells.
Blood.
73:
1828-1835
[Abstract/Free Full Text].
|
| 50.
|
Walker, F.,
N.A. Nicola,
D. Metcalf, and
A.W. Burgess.
1985.
Hierarchical down-modulation of hemopoietic growth
factor receptors.
Cell.
43:
269-276
[Medline].
|
| 51.
|
Rosenberg, H.F.,
S.J. Ackerman, and
D.G. Tenen.
1990.
An
alternative method for labeling oligonucleotide probes for
screening cDNA libraries.
Biotechniques.
8:
384
[Medline].
|
| 52.
|
Arcari, P.,
R. Martinelli, and
F. Salvatore.
1984.
The complete sequence of a full-length cDNA for human liver glyceraldehyde-3-phosphate dehydrogenase: evidence for multiple
mRNA species.
Nucleic Acids Res.
12:
9179-9189
[Abstract/Free Full Text].
|