|
||
Receptor Type 1 Stimulation of Mast Cells
By


From the * Lymphocyte Activation Laboratory, Imperial Cancer Research Fund, London WC2A 3PX,
United Kingdom; and the
Yamanouchi Research Institute, Littlemore Park, Oxford OX4 4SX,
United Kingdom
| |
Abstract |
|---|
|
|
|---|
Transcription factors of the nuclear factor of activated T cells (NFAT) family play a key role in
antigen receptor-mediated responses in lymphocytes by controlling induction of a wide variety of cytokine genes. The GTPases Ras and Rac-1 have essential functions in regulation of
NFAT transcriptional activity in the mast cell system, where Fc
receptor type 1 (Fc
R1) ligation results in induction of multiple NFAT target genes. This report examines the precise biochemical basis for the Rac-1 dependency of Fc
R1 activation of NFAT in mast cells. We are
able to place Rac-1 in two positions in the signaling network that regulates the assembly and
activation of NFAT transcriptional complexes in lymphocytes. First, we show that activity of
Rac-1 is required for Fc
R1-mediated NFATC1 dephosphorylation and nuclear import. Regulation of NFAT localization by the Fc
R1 is a Rac-dependent but Ras-independent process.
This novel signaling role for Rac-1 is distinct from its established regulation of the actin cytoskeleton. Our data also reveal a second GTPase signaling pathway regulating NFAT transcriptional activity, in which Rac-1 mediates a Ras signal. These data illustrate that the GTPase
Rac-1 should now be considered as a component of the therapeutically important pathways
controlling NFATC1 subcellular localization. They also reveal that GTPases may serve multiple functions in cellular responses to antigen receptor ligation.
receptor type 1;
mast cells
| |
Introduction |
|---|
|
|
|---|
Antigenic cross-linking of the high-affinity receptor for
IgE, Fc
R1, on mast cells results in secretion of allergic mediators and induction of the expression of genes encoding multiple cytokines and chemokines (1, 2). Transcription factors of the nuclear factor of activated T cells
(NFAT)1 family play a key role in these antigen receptor-
mediated responses by controlling induction of a wide variety of cytokine genes, including those for IL-2, IL-4, GM-CSF, and the Fas ligand and CD40 ligand molecules (3).
Fc
R1 activation of NFAT in mast cells is mediated by calcium/calcineurin (CN)-controlled signaling pathways acting in synergy with signal transduction pathways regulated by GTPases of the Ras superfamily, Ras and Rac-1 (4).
GTPases cycle between GDP- (inactive) and GTP-bound
(active) conformations. Exchange of GDP for GTP and,
hence, transition to the activated state is promoted by a
class of guanine nucleotide exchange factors (GEFs; references 5 and 6). Regulation of the Ras GEF Sos and activation of a Rac GEF Vav are immediate consequences of Fc
R1 ligation (7). Ras and Rac GTPases are then able
to regulate diverse cellular processes in lymphocytes, including NFAT activation, by virtue of their coupling to
multiple biochemical effector signaling pathways (4, 10).
A simple model explaining the cooperation between calcium and Ras/Rac signaling pathways for Fc
R1 activation of NFAT has been proposed: NFAT transcription factors are cytosolic in quiescent cells and are imported into
the nucleus in response to calcium/CN signals triggered by
ligation of antigen receptors (3, 11). In the nucleus, NFAT
proteins form complexes with activator protein (AP)-1
family proteins and in this context are able to transcriptionally activate cytokine genes (10, 12). Ras/Rac-mediated
signals couple antigen receptors to the activation of AP-1
complexes, and signaling by these GTPases is therefore required for antigen receptor-mediated NFAT responses
(10). The translocation of NFAT from cytosol to nucleus,
where it can contact DNA, is a critical commitment step
for the induction of NFAT/AP-1 transcriptional activity by
immunoreceptors. The subcellular localization of NFAT is
tightly regulated by a phosphorylation cycle: phospho-NFAT is retained in the cytosol and upon antigen receptor activation is dephosphorylated by CN at several sites of constitutive serine phosphorylation (11). The latter pathway is the
focus of much analysis because of its therapeutic importance as the target of the macrolide immunosuppressants
Cyclosporin A (CsA) and FK506 (13). CsA-cyclophilin
and FK506-immunophilin complexes bind to and inactivate CN. This is the basis of the immunosuppressive nature
of these compounds; CN-dependent transcription of multiple NFAT-regulated cytokine genes such as IL-2, IL-4,
and TNF-
is blocked in CsA/FK506-treated cells.
The role of calcium/CN signals in the control of NFAT subcellular localization is well documented (11, 14, 15), as is the role of Ras/Rac GTPases in control of AP-1 complexes (16, 17). However, two recent lines of research question the current simple "two signal" NFAT activation model. First, the regulation of NFAT subcellular localization may be a more complicated process than originally proposed; there are protein kinase pathways that can promote NFAT nuclear export and antagonize the action of calcium/CN-regulated signals (18, 19). Second, it is clear that the Ras and Rac GTPases have functions that extend beyond regulation of AP-1 complexes. For example, regulation of the actin cytoskeleton by both Ras and Rac is well documented (20). The role of the actin cytoskeleton in NFAT translocation has not been examined, although induction of certain NFAT-regulated cytokine genes is sensitive to Cytochalasin D, which inhibits actin polymerization. The relocation of a large pool of protein across the nuclear membrane may require morphological changes dependent on actin, and may encompass a role for GTPases of the Ras family. In addition to these candidate roles for Ras family GTPases in NFAT/AP-1 activation, there are defined roles for at least two GTPases in the regulation of the nuclear import process (21, 22). Ran is an integral part of the nuclear import machinery that functions constitutively to transport proteins and other cargo across the nuclear membrane. There is also biochemical evidence that a GTPase other than Ran is important for nuclear import. It remains to be seen whether this represents another GTPase activity which is part of the basic nuclear transport machinery, or is an indicator of a GTPase signaling requirement which is potentially a target for regulation by transmembrane receptors.
In this study, an assay to monitor NFAT subcellular localization in cells transiently transfected with dominant inhibitory Ras and Rac mutants was established in the
RBL2H3 mast cell line. The role of these GTPases in
Fc
R1 regulation of NFAT nuclear import was then examined. Function of the Rac-1 GTPase, but not Ras, was
absolutely required for Fc
R1 induction of NFATC1 nuclear import. This novel role for Rac-1 was distinct from
its function in regulation of the actin cytoskeleton. Rather,
Rac-1 regulates the phosphorylation status of NFATC1 in
mast cells. We also observed that Rac-1 regulates NFAT
transcriptional complexes in distinct Ras-dependent and
-independent pathways. The latter, Ras-independent, role
for Rac-1 in regulation of NFAT nuclear import identifies Rac-1 as a significant new player in this therapeutically important pathway.
| |
Materials and Methods |
|---|
|
|
|---|
Plasmids.
The full-length NFATC1 cDNA was subcloned into the pEGFP-C1 vector (Clontech, Palo Alto, CA) to give NFATC1-green fluorescent protein (GFP). Constructs were verified by sequencing. The pSR
-CNM (activated CN; reference
17), pEF-N17-Rac-1 (dominant inhibitory Rac-1), pEF-V12Rac-1
(activated Rac-1), and pRSV-N17 Ras (dominant inhibitory
Ras) have all been described previously (10, 23). All constructs
were purified by CsCl density gradient centrifugation before use
in transfection. The amount of plasmid used in transient transfection was 8 µg/107 cells NFATC1-GFP. Cotransfections included
30 µg/107 cells pEF-N17Rac-1, pEF-V12Rac-1, or pEF-N17 Ras,
or 20 µg/107 cells pSR
-CNM. IL-4 NFAT/AP-1 chloramphenicol acetyl transferase (CAT) comprised a trimerized NFAT/
AP-1 site derived from Purine box B of the murine IL-4 promoter (24). The NFAT/AP-1 binding site oligonucleotide used
in the construction of this reporter was GATCCTGAGTTTACATTGGAAAATTTTATAGAGCGAGTTG (5'-3').
Confirmation of Transfection.
In cotransfection experiments, an excess of regulator (i.e., GTPase) plasmid over reporter (NFATC1-GFP) plasmid was used. Coexpression of Rac-1 was confirmed by immunostaining for the myc-epitope tag at the single cell level and by Western analysis of whole cell lysate. In both cases, the anti-myc mAb 9E10 was used (Hybridoma Development Unit, Imperial Cancer Research Fund).Transient Transfection and Cell Imaging.
RBL2H3 mast cells were cultured as described previously and electroporated using a Gene Pulser apparatus (Beckman Instruments, Inc., Fullerton, CA) at 107 cells/0.5 ml DMEM, 960 µF, 310 V. After plating onto glass coverslips, cells were allowed 6 h recovery. In the case of Ionomycin stimulation, cells were incubated for the indicated times with 500 ng/ml Ionomycin (Calbiochem Corp., La Jolla, CA). Cell stimulation via the Fc
R1 was carried out by 1 h incubation
at 37°C with 1 µg/ml IgE anti-DNP (Sigma Chemical Co., St.
Louis, MO) followed by antigenic cross-linking of bound IgE using 250 ng/ml KLH-DNP (Calbiochem Corp.) unless otherwise
indicated. Cells were fixed in 4% paraformaldehyde for 30 min at
room temperature. Nuclear staining using propidium iodide (PI)
was carried out by permeabilization of cells in 0.1% Triton X-100
followed by sequential incubation with 500 mg/ml RNase (37°C, 10 min) and 0.1 µg/ml PI (room temperature, 10 min). Coverslips were washed in PBS after each stage and mounted in 15 µl
Gelvatol (Monsanto Co., St. Louis, MO) which was allowed to
set for 4 h before imaging using a TCS-NT upright confocal microscope (Leica Inc., Deerfield, IL). Images were corrected for
contribution of PI emission to GFP signal and viewed using the
Imaris system (Bitplane AG, Zurich, Switzerland). In scoring experiments, cells were analyzed using an Axiophot fluorescence
microscope (Nikon Inc., Melville, NY). Cells were scored for
NFATC1-GFP localization as blind-coded samples.
Western Blot Analysis.
Transfected RBL2H3 mast cells were primed and stimulated as described. Cells were removed from the culture dish using cell scrapers, washed once in ice-cold PBS, then lysed for 40 min at 4°C with rotation in a buffer containing 20 mM Hepes, pH 7.9, 20% (vol/vol) glycerol, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 10 mM NaF, 1 mM dithiothreitol, 1 mM PMSF, 1 mM Na2VO4, and 1% NP-40. Nuclear membranes were pelleted by centrifugation at 14,000 rpm for 20 min at 4°C, and proteins in the supernatant were then acetone precipitated. Samples were resolved under reducing conditions by 7% SDS-PAGE. The resolved proteins were transferred to polyvinylidene difluoride, and the membranes were blocked in 5% nonfat milk for 1 h at room temperature. Anti-GFP Western blot analysis was performed using an affinity-purified rabbit anti-GFP, a gift of Dr. Ken Sawin, Imperial Cancer Research Fund.CAT Reporter Gene Assay.
RBL2H3 mast cells were transiently transfected using electroporation as described above. For CAT reporter gene assays, 5 × 106 cells were lysed in 150 µl of a buffer containing 0.65% (vol/vol) NP-40, 10 mM Tris, pH 8.0, 1 mM EDTA, and 150 mM NaCl for 15 min on ice. Lysates were then transferred to a 68°C water bath for 10 min. Cell debris was pelleted, and aliquots of lysate were removed to a fresh tube in an assay volume of 100 µl, to which 40 µl of a start solution containing 0.5 mM acetyl coenzyme A, 5 mM chloramphenicol, and 0.5 M Tris, pH 8.0, and 1 µl per point of 50 µCi/ml 14C acetyl coenzyme A was added. The assay was incubated for 16 h at 37°C before chloramphenicol was extracted using 150 µl per point ethyl acetate. The amount of radioactivity in the acetylated product (100 µl top phase) and nonacetylated substrate (50 µl bottom phase) for each reaction was determined by liquid scintillation counting of organic and aqueous phases, respectively. Results are expressed as percentage of conversion of chloramphenicol to the acetylated form.| |
Results |
|---|
|
|
|---|
Initial experiments
established a transient transfection system for the assay of
NFATC1 subcellular localization in RBL2H3 mast cells.
Fig. 1 A shows a schematic representation of the tagged NFATC1 molecule generated for these experiments. A fusion protein comprising NFATC1 (11) was linked to the
GFP molecule of Aequorea victoria (25). The resulting expression plasmid, peGFP-NFATC1, was used in transient
transfection of RBL2H3 cells. The montage of confocal
microscope images in Fig. 1 B shows that NFATC1-GFP is
excluded from the nucleus in quiescent RBL2H3 cells.
The position of the nucleus in these cells is defined by the
red fluorescence of the DNA binding dye PI. Fc
R1 ligation results in expression of numerous genes controlled by
NFAT transcription factor complexes. Accordingly, the
location of NFATC1-GFP in resting and Fc
R1-stimulated RBL2H3 cells was examined. Fig. 1 C shows that in
resting RBL2H3 cells, NFATC1-GFP is predominantly
localized to the cytosol and does not colocalize with the
nuclear stain PI. After 30 min exposure to cross-linking antigen, NFATC1-GFP is exclusively nuclear. The kinetics
of this response are shown in Fig. 1 D. In response to Fc
R1 stimulation, NFATC1-GFP is exported from the cytosol, with a concomitant increase in nuclear GFP. Most
nuclear import is achieved within 10 min. At 30 min stimulation, typically 80-90% cells exhibit exclusively nuclear
NFATC1-GFP. Hence, Fc
R1 stimulation of RBL2H3
cells results in the rapid nuclear import of NFATC1-GFP protein.
|
Fusion to GFP is a major modification of the NFATC1
protein. Control experiments were performed to assess
whether the behavior of NFATC1-GFP was comparable
to that expected for endogenous NFAT. Dephosphorylation of NFAT by the CN phosphatase is permissive for
nuclear import and for assembly of productive NFAT/
AP-1 complexes. CN activity is the target of the immunosuppressive drugs CsA and FK506. To be considered a
good model for endogenous NFAT regulation, NFATC1-GFP nuclear import should therefore be positively regulated by CN and sensitive to inhibition by CsA. Fig. 1 E
shows the results of experiments testing these criteria. In
control cells singly transfected with reporter, NFATC1-GFP is predominantly nuclear after 30 min Fc
R1 stimulation. In cells cotransfected with an activated mutant of CN,
NFATC1-GFP is localized to the nucleus in the absence of
Fc
R1 stimulation. Conversely, pretreatment of RBL2H3
cells with CsA ablates Fc
R1-induced NFATC1-GFP nuclear import. These data demonstrate that the subcellular
localization of NFATC1-GFP is regulated by CN signaling
pathways.
R1-induced
NFATC1-GFP Nuclear Import.
Previous experiments have
identified that Rac-1 and Ras function is required for Fc
R1
induction of NFAT transcriptional activity in mast cells (4).
The effect of dominant inhibitory Rac-1 and Ras upon
NFATC1-GFP nuclear import was examined. The N17
mutants of Ras and Rac-1 act to sequester GEF from endogenous pools of the GTPase, maintaining the GTPase in
its GDP-bound (inactive) state. Cotransfection of these mutants prevents activation of the endogenous GTPases.
Fig. 2 A shows the subcellular localization of NFATC1-GFP in either control RBL2H3 cells or in cells cotransfected with N17Rac-1. In control cells after 30 min Fc
R1
stimulation, NFATC1-GFP is exclusively localized to the
nucleus. In receptor-stimulated cells expressing dominant
inhibitory Rac-1, NFATC1-GFP is effectively retained in
the cytosol. The data in Fig. 2 B show that across a population of cells, NFATC1-GFP nuclear accumulation is severely abrogated in N17Rac-1-expressing cells. After 30 min stimulation, only 15% of cells bearing N17Rac-1 have
predominantly nuclear NFATC1-GFP, compared with
80-90% of control cells. These data suggest that Rac-1 signals are required for Fc
R1-induced NFATC1-GFP nuclear import. NFAT nuclear translocation can also be induced by the pharmacological agent, Ionomycin, a calcium
ionophore. The data in Fig. 2 C show the kinetics of
NFATC1-GFP nuclear import in response to Ionomycin
treatment in the absence or presence of N17Rac-1. In Ionomycin-treated cells, the rate of nuclear uptake of NFATC1-GFP in the presence of N17Rac-1 closely matched that of
control cells. These results imply that expression of N17Rac-1 does not result in a blockade of the general nuclear import
machinery in RBL2H3 cells.
|
Our previous work on NFAT transcriptional activation
has shown that there is clearly a role for both Rac-1- and
Ras-derived signals (4). The data in Fig. 2 D assess the effect of N17Ras upon Fc
R1-regulated NFATC1-GFP nuclear import. The data show that N17Ras expression does
not affect the ability of the Fc
R1 to drive NFATC1-GFP
translocation. In parallel control experiments, N17 Ras
markedly inhibited the Fc
R1 activation of an NFAT/AP-1 CAT reporter gene in RBL2H3 cells (data not shown).
Therefore, the lack of effect upon NFATC1-GFP translocation does not reflect nonexpression of the N17Ras
protein. These data suggest that Rac-1, but not Ras, has
an important role in Fc
R1 regulation of NFAT nuclear
localization.
The data presented so far show that inhibition of Rac-1
signaling antagonizes Fc
R1-induced NFATC1-GFP nuclear uptake. This suggests that one basis of the requirement for Rac-1 in Fc
R1 activation of NFAT transcriptional activity may lie in Rac-1 regulation of NFAT
nuclear accumulation. Given that activity of the Rac-1 GTPase is required for Fc
R1 regulation of NFATC1-GFP subcellular localization, we asked how constitutive activation of Rac-1 would affect this phenomenon. The data
in Fig. 3, A and B, show the effect of cotransfection of a
constitutively active V12 mutant of Rac-1 (V12Rac-1)
upon Fc
R1-stimulated NFATC1-GFP nuclear localization. Cotransfection with V12Rac-1 potentiates the antigen dose response for Fc
R1-stimulated NFATC1-GFP
nuclear accumulation (Fig. 3 A). Moreover, Fig. 3 B shows
that V12Rac-1 causes a slight but reproducible acceleration
in the kinetics of Fc
R1-stimulated NFATC1-GFP nuclear uptake. Activated alleles of GTPases may in theory
acquire function that does not reflect that of the endogenous GTP-loaded protein; activated GTPases may interact
with new regulators or effectors by virtue of overexpression or expression in an unphysiological cellular compartment. However, our combined data using inhibitory and
activated alleles of the Rac-1 GTPase strongly support the conclusion that Fc
R1 regulation of NFAT subcellular localization is Rac-1 dependent.
|
The amount of NFAT protein present in the nucleus at
any given time is controlled by a balance of the rates of nuclear import and export. The data presented above show
that V12Rac-1 enhances the Fc
R1-driven nuclear accumulation of NFATC1-GFP, but only slightly modifies the
initial kinetics of nuclear import. Therefore, we examined
whether expression of V12Rac-1 could influence NFATC1-GFP nuclear export. Protocols for the study of NFAT nuclear export have been established (11, 18). We induced
nuclear accumulation of NFATC1-GFP using the calcium
ionophore, Ionomycin. Ionomycin was washed out, and
cells were treated with CsA to prevent continued nuclear
import of NFATC1-GFP. NFATC1-GFP nuclear export
kinetics were then monitored. Fig. 3 C shows the results of
this experiment in control cells or those expressing V12Rac-1.
The data show that relocalization of NFATC1-GFP from
nucleus to cytosol in RBL2H3 cells occurs rapidly in response to CsA. Full export is achieved in 45 min exposure
to CsA. It is clear that the kinetics or degree of NFATC1-GFP export from the nucleus are both unaffected by the presence of V12Rac-1.
There is an established body of work on the role of the Rac
GTPase in orchestration of actin cytoskeleton rearrangements (26, 27). Fc
R1 stimulation of RBL2H3 mast cells
results in marked rearrangements of the actin cytoskeleton.
Stimulated RBL2H3 cells form actin plaques/focal complexes at their adherent surface and membrane ruffles at the
top of the cell (28, 29). Fc
R1-mediated NFATC1-GFP
nuclear import involves the translocation of a considerable pool of protein from the cytosol to the nucleus. It is possible that this type of event requires a contribution from the
actin cytoskeleton in the form of morphological changes in
the RBL2H3 cells. Since there is evidence that these
changes can be under the control of Rac-1, they are candidates for the basis of the role for Rac-1 in regulation of
NFATC1 subcellular localization. Accordingly, the role of
actin cytoskeleton rearrangements in NFATC1-GFP nuclear import was examined.
Fc
R1 stimulation of RBL2H3 cells causes the formation of actin structures such as stress fibers, focal complexes,
and membrane ruffles (Fig. 4 A, left), which are visualized
using Rhodamine-Phalloidin staining for polymerized actin. Cytochalasin D is an inhibitor of actin polymerization.
This compound prevents Fc
R1-induced cytoskeletal changes
such as the induction of focal complex formation and stress
fibers. Fig. 4 A, left, shows Fc
R1-stimulated RBL2H3 cells stained for polymerized actin. Marked membrane ruffles and punctate structures are observed in stimulated cells.
In cells pretreated with Cytochalasin D for 30 min before
Fc
R1 cross-linking, complete disruption of the cytoskeleton was observed (Fig. 4 A, right). These data confirm the
efficacy of Cytochalasin D.
|
The effect of disruption of the actin cytoskeleton on
NFATC1-GFP nuclear accumulation was then assessed.
RBL2H3 cells were transfected with NFATC1-GFP reporter and incubated either with vehicle or with Cytochalasin D for 30 min before stimulation via IgE/Fc
R1. The
data in Fig. 4 B show that application of Cytochalasin D
does not affect Fc
R1-induced NFATC1-GFP nuclear
translocation. In both control and Cytochalasin D-treated
cells, Fc
R1 stimulation leads to the rapid export of
NFATC1-GFP from the cytosol and its concomitant accumulation in the nucleus. These data suggest that rearrangements of the actin cytoskeleton are in fact not required for
Fc
R1 regulation of NFAT nuclear import. Therefore, the
basis of Rac-1 involvement in the regulation of NFATC1
subcellular localization is distinct from the published roles
for Rac-1 in the regulation of the actin cytoskeleton.
In summary of the data presented so far, it is clear that a
novel role for Rac-1 has been described. Rac-1 activity is a
previously unrecognized player in the regulation of NFAT
subcellular localization. Rac-1 is apparently a selective regulator of NFAT, functioning as a component of the Fc
R1
signaling pathways regulating this transcription factor. This
novel role for Rac-1 cannot be ascribed to a function for
the GTPase at the level of general nuclear transport. Moreover, the mechanism by which Rac-1 accomplishes this
function is separate from the established Rac-1 regulation
of the actin cytoskeleton.
NFAT proteins
are constitutively serine phosphorylated at multiple phosphoacceptor sites in quiescent cells. Upon antigen receptor
ligation, calcium-dependent activation of the CN phosphatase results in the dephosphorylation of a number of these sites and permits nuclear import. The effect of N17Rac-1 upon Fc
R1
regulation of NFATC1-GFP phosphorylation status was
examined. RBL2H3 cells were transfected with NFATC1-GFP alone or in combination with pEF-N17Rac-1. Phosphorylated and dephosphorylated NFAT proteins have distinct electrophoretic mobilities in SDS-PAGE. The data in
Fig. 5 show that antigenic cross-linking of the Fc
R1 results in increased mobility of NFATC1-GFP, reflecting dephosphorylation by CN. Dephosphorylation is evident within
2 min exposure to cross-linking antigen and is sustained for
30 min. Pretreatment of RBL2H3 cells with CsA prevents Fc
R1-mediated dephosphorylation of NFATC1-GFP; in this case, NFATC1-GFP is retained in the lower
mobility, phosphorylated form. Fig. 5 also shows the effect
of N17Rac-1 expression on the Fc
R1-stimulated NFATC1-GFP mobility shift. In cells bearing N17Rac-1, NFATC1-GFP is effectively retained in the lower electrophoretic mobility form. Hence, dominant inhibition of Rac-1 function blocks NFATC1-GFP dephosphorylation.
|
The requirement
for Rac- but not Ras-mediated signals for NFATC1 nuclear import indicates that these GTPases can function in
independent signaling pathways to control NFAT function.
There are also examples where Rac mediates Ras-induced
cellular responses. Ras regulates fibroblast transformation
via activation of a Rac-1 signaling pathway (30, 31). Moreover, Ras-mediated activation of NFAT in T lymphocytes
is dependent on Rac function (10). Therefore, we explored
the possibility that Rac might have a second function in
mast cells and mediate Ras regulation of NFAT. The relationship between Ras and Rac-1 in mast cells was examined more closely using an assay for NFAT transcriptional
activity. The NFAT/AP-1 reporter gene consisted of a CAT
reporter controlled by an NFAT/AP-1 site derived from
the murine IL-4 promoter (IL-4 NFAT/AP-1 CAT). These
experiments tested the ability of activated mutants of Ras and
Rac to rescue the effects of the inhibitory Ras and Rac-1
mutants on Fc
R1 induction of IL-4 NFAT/AP-1 CAT.
The data in Fig. 6 A show that N17Ras cotransfection
causes a marked inhibition of NFAT/AP-1 transcriptional
activity induced in response to antigenic cross-linking of
the Fc
R1. However, if N17Ras and the activated V12
mutant of Rac-1 (V12Rac-1) are doubly cotransfected, the
inhibition observed with N17Ras alone is alleviated.
Hence, V12Rac-1 rescues N17Ras inhibition of Fc
R1-induced NFAT/AP-1 transcriptional activity. These data
suggest that there is a linear Ras/Rac-1 pathway regulating
the activity of the NFAT/AP-1 complex in mast cells. The
data in Fig. 6 B show that conversely, an activated mutant
of Ras cannot rescue the N17Rac-1 inhibition of NFAT
induction.
|
| |
Discussion |
|---|
|
|
|---|
Regulation of NFAT transcription factor complexes by
antigen receptors such as the Fc
R1 is crucial to the initiation and maintenance of immune responses. This report
describes that the GTPase Rac-1 has a critical function in
Fc
R1 control of the subcellular localization of NFATC1
and a separate function in the regulation of the transcriptional activity of nuclear localized NFAT molecules. Accordingly, activity of Rac-1 is required for Fc
R1-mediated NFATC1 dephosphorylation and nuclear import.
Disruption of actin polymerization and, hence, cytoskeletal
structure has no impact on the regulated nuclear import of
NFAT. Thus, the role of Rac-1 in control of NFAT subcellular localization is independent of the established role of
this GTPase in control of the actin cytoskeleton. These results also show that in Fc
R1-activated cells, NFAT complexes are nuclear localized in the absence of endogenous
Ras function but transcriptionally inactive. However,
NFAT transcriptional function can be restored by activation of Rac signaling pathways. Thus, we are able to place
Rac-1 in two positions in the signaling network that regulates the assembly and activation of NFAT/AP-1 transcriptional complexes in lymphocytes, as follows.
Dephosphorylation of NFAT molecules permits their
subsequent nuclear import. In quiescent cells, NFAT is
phosphorylated upon multiple sites within the NH2-terminal regulatory region. Upon antigen receptor stimulation,
dephosphorylation of NFAT is rapid and sustained, and it is
proposed that dephosphorylation results in a conformational change that exposes previously buried nuclear localization sequences (NLS). Thus, NFAT subcellular localization is controlled by the phosphorylation state of this
molecule. The effect of inhibition of Rac-1 signaling in
RBL2H3 cells is to maintain NFATC1 in a phosphorylated
state and, hence, in a "closed" conformation where NLS
remain buried, causing cytosolic retention of NFATC1.
Protein phosphorylation levels are determined by a balance
of regulatory kinase and phosphatase activities. The calcium-dependent phosphatase CN is responsible for NFAT dephosphorylation, whereas NFAT kinases have a fundamental role
in regulating NFAT subcellular localization. In nonlymphoid
cells, the nuclear localization of NFAT4 is prevented when
this NFAT isoform is phosphorylated by the MAP kinase
c-Jun NH2-terminal kinase (JUN; reference 19). It has also
been described that NFATC1 is a substrate for glycogen synthase kinase (GSK)-3
and that phosphorylation of
NFATC1 by GSK-3
promotes its nuclear export (18). In
a variety of cell types, GSK-3
is inactivated in response to
stimulation of cells via protein kinase C or protein kinase B
(32, 33). A failure to inactivate GSK-3
would be assumed
to promote NFAT phosphorylation and cytoplasmic retention. For the interpretation of our current data, two clear
possibilities exist. First, Rac-1 function may regulate the
activity of the kinase(s) responsible for NFAT phosphorylation and nuclear export. Second, Rac-1 may regulate the
activity of the NFAT phosphatases that control nuclear import. These results show that dominant activation of Rac
signaling pathways did not prevent NFAT nuclear export.
These data suggest that Rac-1 is exerting its effects through
regulation of NFAT import into the nucleus. Therefore, in
terms of the current simple models for the regulation of
NFAT subcellular localization, it seems most likely that
Rac-1 regulates NFAT nuclear import by regulating the
activity and/or localization of the NFAT phosphatase CN.
Rac-1 signals that affect NFATC1 nuclear import are independent of the activity of the Ras GTPase. However,
Ras signals are necessary for Fc
R1 induction of the transcriptional activity of nuclear localized NFAT. Therefore, a
simple model would show parallel Ras/Rac Fc
R1 signaling
pathways regulating NFAT. In this model, a Rac-1-mediated pathway controls NFATC1 subcellular localization,
whereas Ras regulates the transcriptional activity of the
complex without regulating NFATC1 distribution. However, this simple model is not adequate to explain our previous
observations that Ras regulates NFAT transcriptional activity in a Rac-1-dependent fashion. Moreover, the data presented here show that activation of Rac-1 signaling pathways can restore transcriptional activity of nuclear localized
NFAT in cells lacking endogenous Ras function. Thus,
there is a component of NFAT regulation in mast cells that is both Ras and Rac-1 dependent; Rac-1 signals can clearly
regulate the transcriptional activity of NFAT complexes as
well as regulating their subcellular location. To reconcile
these data, a model is proposed in Fig. 7.
|
In Fig. 7, two pools of Rac-1 are shown to affect distinct processes contributing to NFAT transcriptional activity. First, Rac-1 is postulated to couple Ras to NFAT complexes. Second, a Ras-independent Rac-1 signal regulates the phosphorylation status and, hence, subcellular localization of NFAT protein. NFAT transcription factors function in the context of a dimer of AP-1 family proteins. In the T cell system, Ras and Rac-1 functions have clearly defined roles in AP-1 regulation and are required for AP-1 transcriptional activity. Therefore, the role of these GTPases in the induction of transcriptional activity of NFAT complexes could reflect their contribution to AP-1 activity. Nevertheless, the data presented here show that the role of Rac-1 in NFAT induction cannot be considered solely in the context of AP-1 regulation; Rac-1 also directly influences the subcellular localization of NFAT protein.
In summary, the Rac-1 GTPase has a previously unsuspected role as a regulator of NFATC1 phosphorylation status and subcellular localization. Rac-1 also functions to control the transcriptional activity of nuclear localized NFAT complexes. These experiments on the role of Rac-1 in NFAT regulation illustrate several important aspects of signal transduction by Rac GTPases. First, it is clear that not all functions of Rac GTPases can be attributed to the role of the GTPase in regulation of the actin cytoskeleton. Second, our data show that functionally distinct pools of a GTPase may coexist within the same cell and regulate disparate targets in response to similar upstream signals. Numerous Rac effectors have been identified, including the Pak family of serine/threonine kinases and mixed lineage kinases (MLK)2,3, the tyrosine kinase p120Ack, partner of Rac-1 (POR1), p67phox, MEKs, and the phosphatidylinositol 4-phosphate 5-kinase (PI4-P 5-kinase). Rac GTPases are able to regulate diverse cellular responses because they can couple to these multiple effector molecules. Hence, Rac-1 regulation of NFAT cellular localization or NFAT transcriptional activity may reflect the activation of distinct effector cascades.
| |
Footnotes |
|---|
Address correspondence to Doreen A. Cantrell, Lymphocyte Activation Laboratory, Imperial Cancer Research Fund, P.O. Box 123, Lincoln's Inn Fields, London WC2A 3PX, UK. Phone: 44-171-269-3307; Fax: 44-171-269-3479; E-mail: cantrell{at}icrf.icnet.uk
Received for publication 26 December 1997 and in revised form 21 April 1998.
H. Turner was supported by Glaxo-Wellcome and Imperial Cancer Research Fund.The authors thank Alex Stokes and Peter Jordan (Confocal Imaging Laboratory, Imperial Cancer Research Fund) for excellent advice on microscopy, and Dr. Paul Brennan and Steve Cleverley (Lymphocyte Activation Laboratory, Imperial Cancer Research Fund) for discussion of and help with the manuscript. Rac-1 constructs were generously provided by Dr. Alan Hall (University College, London, UK).
Abbreviations used in this paper AP-1, activator protein 1; CAT, chloramphenicol acetyl transferase; CN, calcineurin; CsA, Cyclosporin A; GEF, guanine nucleotide exchange factor; GFP, green fluorescent protein; GSK, glycogen synthase kinase; PI, propidium iodide; NFAT, nuclear factor of activated T cells; NLS, nuclear localization sequences.
| |
References |
|---|
|
|
|---|
| 1. | Daeron, M.. 1997. Fc receptor biology. Annu. Rev. Immunol. 15: 203-234 [Medline]. |
| 2. | Jouvin, M.H., R.P. Numerof, and J.P. Kinet. 1995. Signal transduction through the conserved motifs of the high affinity IgE receptor Fc epsilon RI. Semin. Immunol. 7: 29-35 [Medline]. |
| 3. | Rao, A., C. Luo, and P. Hogan. 1997. Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 15: 707-748 [Medline]. |
| 4. |
Turner, H., and
D.A. Cantrell.
1997.
Distinct Ras effector
pathways are involved in Fc R1 regulation of the transcriptional activity of Elk-1 and NFAT in mast cells.
J. Exp. Med.
185:
43-57
|
| 5. | Boguski, M.S., and F. McCormick. 1993. Proteins regulating Ras and its relatives. Nature. 366: 643-654 [Medline]. |
| 6. | Downward, J.. 1996. Control of ras activation. Cancer Surv. 27: 87-100 [Medline]. |
| 7. |
Turner, H.,
K. Reif,
J. Rivera, and
D.A. Cantrell.
1995.
Regulation of the adapter molecule Grb2 by the Fc R1 in
the mast cell line RBL2H3.
J. Biol. Chem.
270:
9500-9506
|
| 8. | Crespo, P., K.E. Schuebel, A.A. Ostrom, J.S. Gutkind, and X.R. Bustelo. 1997. Phosphotyrosine-dependent activation of Rac-1 GDP/GTP exchange by the vav proto-oncogene product. Nature. 385: 169-172 [Medline]. |
| 9. | Margolis, B., P. Hu, S. Katzav, W. Li, J.M. Oliver, A. Ullrich, A. Weiss, and J. Schlessinger. 1992. Tyrosine phosphorylation of vav proto-oncogene product containing SH2 domain and transcription factor motifs. Nature. 356: 71-74 [Medline]. |
| 10. | Genot, E., S. Cleverley, S. Henning, and D.A. Cantrell. 1996. Multiple p21ras effector pathways regulate nuclear factor of activated T cells. EMBO (Eur. Mol. Biol. Organ.) J. 15: 3923-3933 [Medline]. |
| 11. |
Beals, C.R.,
N.A. Clipstone,
S.N. Ho, and
G.R. Crabtree.
1997.
Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin A-sensitive intramolecular interaction.
Genes Dev.
11:
824-834
|
| 12. | Jain, J., P.G. McCaffrey, Z. Miner, T.K. Kerppola, J.N. Lambert, G.L. Verdine, T. Curran, and A. Rao. 1993. The T-cell transcription factor NFATp is a substrate for calcineurin and interacts with Fos and Jun. Nature. 365: 352-355 [Medline]. |
| 13. | Schreiber, S.L., and G.R. Crabtree. 1992. The mechanism of action of cyclosporin A and FK506. Immunol. Today. 13: 136-142 [Medline]. |
| 14. |
Loh, C.,
K.T. Shaw,
J. Carew,
J.P. Viola,
C. Luo,
B.A. Perrino, and
A. Rao.
1996.
Calcineurin binds the transcription
factor NFAT1 and reversibly regulates its activity.
J. Biol.
Chem.
271:
10884-10891
|
| 15. | Shibasaki, F., E.R. Price, D. Milan, and F. McKeon. 1996. Role of kinases and the phosphatase calcineurin in the nuclear shuttling of transcription factor NF-AT4. Nature. 382: 370-373 [Medline]. |
| 16. |
Genot, E.M.,
P.J. Parker, and
D.A. Cantrell.
1995.
Analysis
of the role of protein kinase C , - , and - in T cell activation.
J. Biol. Chem.
270:
9833-9839
|
| 17. |
Woodrow, M.,
N.A. Clipstone, and
D. Cantrell.
1993.
p21ras and calcineurin synergize to regulate the nuclear factor
of activated T cells.
J. Exp. Med.
178:
1517-1522
|
| 18. |
Beals, C.R.,
C.M. Sheridan,
C.W. Turck,
P. Gardner, and
G.R. Crabtree.
1997.
Nuclear export of NF-ATc enhanced
by glycogen synthase kinase-3.
Science.
275:
1930-1933
|
| 19. |
Chow, C.W.,
M. Rincon,
J. Cavanagh,
M. Dickens, and
R.J. Davis.
1997.
Nuclear accumulation of NFAT4 opposed
by the JNK signal transduction pathway.
Science.
278:
1638-1641
|
| 20. | Ridley, A.J., H.F. Paterson, C.L. Johnston, D. Diekmann, and A. Hall. 1992. The small GTP binding protein rac regulates growth factor-induced membrane ruffling. Cell. 70: 401-410 [Medline]. |
| 21. | Nigg, E.A.. 1997. Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature. 386: 779-786 [Medline]. |
| 22. |
Sweet, D.J., and
L. Gerace.
1996.
A GTPase distinct from
Ran is involved in nuclear protein import.
J. Cell Biol.
133:
971-983
|
| 23. |
Izquierdo, M.,
S.J. Leevers,
C. Marshall, and
D.A. Cantrell.
1993.
p21ras couples the T cell antigen receptor to extracellular signal-regulated kinase 2 in T lymphocytes.
J. Exp. Med.
178:
1199-1208
|
| 24. |
Chuvpilo, S.,
C. Schomberg,
R. Gerwig,
A. Heinfling,
R. Reeves,
F. Grummt, and
E. Serfling.
1993.
Multiple closely
linked NFAT/octamer and HMG I(Y) binding sites are part
of the interleukin-4 promoter.
Nucleic Acids Res.
21:
5694-5704
|
| 25. | Heim, R., and R.Y. Tsien. 1996. Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer. Curr. Biol. 6: 178-182 [Medline]. |
| 26. | Nobes, C., and A. Hall. 1995. Rho, Rac and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell. 81: 53-62 [Medline]. |
| 27. | Tapon, N., and A. Hall. 1997. Rho, Rac and Cdc42 GTPases regulate the organization of the actin cytoskeleton. Curr. Opin. Cell Biol. 9: 86-92 [Medline]. |
| 28. |
Norman, J.C.,
L.S. Price,
A. Ridley,
A. Hall, and
A. Koffer.
1994.
Actin filament organization on activated mast cells is
regulated by heterotrimeric and small GTP-binding proteins.
J. Cell Biol.
126:
1005-1015
|
| 29. | Pfeiffer, J.R., and J.M. Oliver. 1994. Tyrosine kinase-dependent assembly of actin plaques linking Fc epsilon R1 cross-linking to increased cell substrate adhesion in RBL-2H3 tumor mast cells. J. Immunol. 152: 270-279 [Abstract]. |
| 30. | Khosravi-Far, R., P.A. Solski, G.J. Clark, M.S. Kinch, and C.J. Der. 1995. Activation of Rac1, RhoA, and mitogen-activated protein kinases is required for Ras transformation. Mol. Cell. Biol. 15: 6443-6453 [Abstract]. |
| 31. | Qiu, R.G., J. Chen, D. Kirn, F. McCormick, and M. Symons. 1995. An essential role for Rac in Ras transformation. Nature. 374: 457-459 [Medline]. |
| 32. | Cross, D.A.E., D.R. Alessi, P. Cohen, M. Andjelkovich, and B.A. Hemmings. 1995. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 378: 785-789 [Medline]. |
| 33. |
Welsh, G.,
S. Miyamoto,
N. Price,
B. Safer, and
C. Proud.
1996.
T cell activation leads to rapid stimulation of eIF2B and
inactivation of glycogen synthase kinase 3.
J. Biol. Chem.
271:
11410-11413
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|