|
||
By


§
From the * Department of Microbiology and Immunology and the
Division of Digestive Diseases,
Department of Medicine, University of California at Los Angeles, Los Angeles, California 90095;
and the § La Jolla Institute for Allergy and Immunology, San Diego, California 92121
| |
Abstract |
|---|
|
|
|---|
The differentiation of intestinal intraepithelial lymphocytes (IEL) remains controversial, which
may be due in part to the phenotypic complexity of these T cells. We have investigated here the development of IEL in mice on the recombination activating gene (RAG)-2
/
background which express a T cell antigen receptor (TCR) transgene specific for an H-Y peptide
presented by Db (H-Y/Db × RAG-2
mice). In contrast to the thymus, the small intestine in
female H-Y/Db × RAG-2
mice is severely deficient in the number of IEL; TCR transgene+
CD8
and CD8
are virtually absent. This is similar to the number and phenotype of IEL
in transgenic mice that do not express the Db class I molecule, and which therefore fail positive
selection. Paradoxically, in male mice, the small intestine contains large numbers of TCR+ IEL
that express high levels of CD8
homodimers. The IEL isolated from male mice are functional, as they respond upon TCR cross-linking, although they are not autoreactive to stimulator cells from male mice. We hypothesize that the H-Y/Db TCR fails to undergo selection in
IEL of female mice due to the reduced avidity of the TCR for major histocompatibility complex peptide in conjunction with the CD8
homodimers expressed by many cells in this lineage. By contrast, this reduced TCR/CD8
avidity may permit positive rather than negative
selection of this TCR in male mice. Therefore, the data presented provide conclusive evidence
that a TCR which is positively selected in the thymus will not necessarily be selected in IEL,
and furthermore, that the expression of a distinct CD8 isoform by IEL may be a critical determinant of the differential pattern of selection of these T cells.
| |
Introduction |
|---|
|
|
|---|
The development of T cells in the thymus ultimately results in one of three fates: negative selection leading to
deletion of autoreactive clones, positive selection leading to
thymocyte survival and emigration, or a lack of selection
that also results in programmed cell death of thymocytes
(1). Although there is significant evidence consistent with
the extrathymic differentiation of intestinal intraepithelial
lymphocytes (IEL),1 it has been difficult to clearly define
the requirements for the development and selection of
these cells (2). Part of this challenge arises from the phenotypic complexity of IEL, and the still undefined lineage
relationships between some of the phenotypic subsets (6).
Besides the TCR 
+ IEL, five TCR 
+ phenotypes
have been reported in IEL based on their expression pattern of coreceptor molecules (6). In addition to the two subsets predominant in circulating T lymphocytes outside
of the intestine, CD4+ and CD8
+ single positive cells,
IEL also contain unique TCR 
+ subsets that express
CD8
either alone or in combination with CD4 (CD4+,
CD8
+ double positive cells). Finally, as found elsewhere
in peripheral lymphoid tissues, there is a small population
of double negative (DN) IEL that do not express either
CD4 or CD8. Notably, in contrast to other peripheral T
cell populations, IEL of the small intestine are composed
predominantly of CD8+ single positive T cells, with approximately equal proportions of cells that express either
CD8
heterodimers or CD8
homodimers among the
TCR 
+ cells, whereas the TCR 
+ IEL are nearly exclusively CD8
+ (7, 8).
Perhaps the best evidence in favor of some type of selection of TCR 
IEL comes from the analysis of
2 microglobulin knockout mice (9). In these class I-deficient mice,
thymic selection of TCR 
+ CD8 single positive T cells
is almost completely inhibited. In the intestine of these
mice, normal numbers of TCR 
+ CD8
IEL can be
found, although the vast majority of CD8
single positive
and CD8
single positive TCR 
+ IEL are absent (10-
12). These data suggest that all TCR 
+ CD8+ IEL require class I molecules for their positive selection, like their
counterparts in the spleen and LN, although the data do not determine if this positive selection occurred in the thymus or elsewhere.
TCR transgenic mice can be used to study the positive
and negative selection of individual TCRs in the thymus
and in IEL. A useful and widely studied transgenic model
for the selection of CD8+ T cells involves expression of the
TCR derived from a clone reactive to a male-derived peptide (H-Y) presented by the Db class I molecule (H-Y/Db
mice; reference 13). In male mice that express the Db class I
gene, this TCR is autoreactive. As a result, thymocytes in
Db+ male mice undergo extensive deletion, and these mice
have a small thymus with few double or single positive T
cells (14, 15). Interestingly, H-Y/Db male TCR transgenic
mice do have significant numbers of TCR transgene+ cells
in the periphery, but these T lymphocytes are either DN or
CD8
low
low (15, 16). It has been proposed that the TCR
transgene+ cells in male mice may be derived from thymocytes that have downregulated CD8 expression in order
to avoid negative selection, or that they may be 
lineage
cells that have been forced to express an 
TCR (17). By
contrast, female Db+ transgenic mice lack the male antigen,
but in the thymus, they must express a peptide or peptides
that can positively select this TCR. As a consequence, the
thymus of female TCR transgenic mice is approximately
normal or somewhat larger than normal in size, and it has a
greatly increased number of CD8
+ single positive thymocytes (18). Finally, in either male or female H-Y/Db
TCR transgenic mice that do not express Db, the TCR
transgene does not undergo positive selection, and thymocyte differentiation is blocked at the double positive
stage (18, 20).
To study the selection of a single TCR within IEL, several groups have previously used the H-Y/Db TCR transgenic mouse model (21). These investigations have resulted in partially discordant outcomes. In one report, it
was concluded that the CD8
IEL subset was able to develop exclusively in the male intestine of transgenic mice
(21). In a different report, this finding was challenged, as
the investigators found CD8
IEL development was able
to occur not only in male H-Y/Db TCR transgenic mice,
but also in female H-Y/Db TCR transgenic mice on either
the H-2Db or Dd background (22). Most importantly, it
was concluded that positive selection of TCR transgene+
CD8
+ IEL occurs via an extrathymic pathway in these
female transgenic mice (22). The issue of positive selection
of TCR 
+ CD8
+ IEL was not addressed in the other
investigation (21). Therefore, because of discordant results,
or the lack of corroborating results, the possibility of positive selection of TCR transgene+ IEL in these mice remains unresolved.
Despite the use of transgenic TCR models aimed at generating monoclonal T cell populations in the two studies
cited above, the rearrangement of endogenous TCR genes,
particularly the rearrangement of
genes (21, 22, 24), provides a significant factor complicating the interpretation of
results. The H-Y/Db-specific TCR transgene may be particularly leaky, since in the above cited studies, most of the
IEL expressed endogenous TCR
chains (20, 25), and up
to 30% coexpressed 
TCRs on cells expressing one or
both of the H-Y/Db-specific TCR transgene chains (21).
In such a context, it is difficult to rigorously determine that
expression of the transgenic TCR leads to the selection of a
particular lymphocyte, despite expression of detectable levels of both the transgene-encoded
and
chains by that
cell. The degree of endogenous TCR expression could be
one reason for the discrepancies described above. Therefore, in this report, we have revisited this TCR transgenic
model of T cell selection, except that we have analyzed
truly monoclonal H-Y/Db-specific TCR transgenic mice
by crossing these mice onto the recombination activating
gene (RAG)-2-deficient background. The data we have
obtained demonstrate that a TCR positively selected in the
thymus is not necessarily also selected among the IEL. The
data also suggest that the CD8 isoform expressed may be an important factor in the different patterns of selection of single TCRs in the thymus and in the small intestine epithelium.
| |
Materials and Methods |
|---|
|
|
|---|
Mice.
Mice transgenic for a TCR specific for a male-derived peptide presented by Db (H-Y/Db transgenic mice [13]) were obtained from Dr. Wendy Shores at the National Institutes of Health (Bethesda, MD). RAG-2
/
mice (26) were obtained
from Dr. Ellen Rothenberg, California Institute of Technology
(Pasadena, CA). Transporter associated with antigen processing
(TAP)-1
/
mice (27) were obtained from Dr. Luc Van Kaer,
Vanderbilt University (Nashville, TN). H-Y/Db × RAG-2
mice were from the F2 generation of an intercross between H-Y/ Db transgenic mice and RAG-2
/
mice. Identification of H-Y/
Db × RAG-2
mice was done by staining peripheral blood with
mAbs directed against V
8 for the TCR transgene and CD4.
Mice with only V
8+, CD4
lymphocytes were selected, because all CD4 T cells are absent in RAG-2
/
mice with (V
8+)
or without the transgene. Doubly deficient and TCR transgenic H-Y/Db × RAG-2
× TAP-1
mice were obtained from the
F3 generation of an intercross between H-Y/Db × RAG-2
mice and TAP-1
/
mice. Typing of these mice required two
steps: (a) identification of RAG-2 and TAP-1 deficiencies was
done by staining peripheral blood with mAbs directed against Kb
and CD4. Kb
(TAP-1
/
) and CD4
(RAG-2
/
) mice were
selected, and (b) identification of the H-Y/Db V
8 transgene was
done by PCR typing. Primers used to identify the transgene
chain spanned the V-D-J region. Sequences of the primers used
are 5', GACATTGAGCTGTAATCAGAC and 3', ACAGCGTTTCTGCACTGTTATCACC. H-Y/Db × RAG-2
× Dd
mice were obtained from the F3 generation of an intercross between H-Y/Db × RAG-2
mice and BALB/c mice. Staining of
peripheral blood from the progeny with mAbs to Kd and Kb class
I molecules confirmed the MHC haplotype, and negative results from staining with mAbs to CD4 confirmed the RAG-2
/
status. PCR typing was used to identify the TCR transgene as described above. All mice were housed under specific pathogen- free conditions in the UCLA Center for Health Sciences vivarium. Mice were analyzed between 8 and 20 wk of age.
Preparation of Lymphocytes.
Thymus and LNs were excised, and single cell suspensions were prepared by grinding the organs between the frosted ends of two glass slides in complete RPMI 1640 medium with 5% FCS. Isolation of IEL was performed as described previously (28), with minor modifications. In brief, small and large intestines were removed and separated from mesentery and Peyer's patches. They were cut longitudinally and then into 0.5-cm pieces. The pieces were shaken three times for 20 min in Mg2+-free, Ca2+-free HBSS (Life Technologies, Inc., Gaithersburg, MD) supplemented with 1 mM dithiothreitol (Sigma Chemical Co., St. Louis, MO). Cells were collected from these washes and passed over a discontinuous 40/70% Percoll (Pharmacia Biotech, Piscataway, NJ) gradient at 900 g for 20 min. IEL were then isolated from the Percoll-gradient interface, washed free of Percoll, and counted by light microscopy.Flow Cytometric Analysis.
The following mAbs were used for phenotypic analysis of lymphocytes: PE-labeled or biotinylated V
8.1 and 8.2 (clone MR5-2), FITC- or PE-labeled or biotinylated anti-CD8
clone 53-6.7, FITC- or PE-labeled anti-CD8
clone 53-5.8, PE-labeled or biotinylated anti-Kb clone AF6-88.5,
biotinylated anti-Kd clone SF1-1.1, FITC- or PE-labeled anti-CD4 clone GK1.5, and FITC-labeled anti-
E integrin clone
M290. All of the above were purchased from PharMingen (San
Diego, CA). Hybridoma cells producing the clonotypic antibody
(T3.70) that recognizes the transgenic TCR
chain were a gift
of Dr. B.J. Fowlkes, National Institutes of Health. Secondary reagents used included FITC-labeled anti-mouse IgG1 clone A85-1
(PharMingen) as a secondary antibody against the mouse T3.70
antibody, and streptavidin coupled to tricolor (Caltag Laboratories, Inc., South San Francisco, CA) was used for all biotinylated
antibodies. For staining, cells were suspended in buffer composed
of PBS, pH 7.3, with 2% (wt/vol) BSA, 0.02% NaN3. mAbs
were added at a predetermined concentration that gave optimal
staining. Cells were incubated at 4°C for 20 min with the primary
mAb, washed twice, and then incubated with secondary reagents
for another 20 min at 4°C. Cells were analyzed on a FACScan®
440 flow cytometer (Becton Dickinson, San Jose, CA) at the Jonsson Cancer Center Flow Cytometry Core Facility, UCLA (or the
La Jolla Institute for Allergy and Immunology). Viable lymphocytes were gated by forward and side angle light scatter parameters, and the number in each subset of IEL was determined by
multiplying the number of total IEL by the percentage obtained
by staining after gating on either total or TCR+ lymphocytes.
The total number of IEL obtained was determined by counting
lymphocytes that excluded trypan blue in a hemacytometer.
Proliferation and IFN-
Release Assays.
transgenic mice were
stained with anti-CD8
and anti-CD8
mAbs and then sorted
with a FACStar® fluorescence-activated cell sorter (Becton Dickinson) in order to obtain a highly enriched (>98% pure)
CD8
+ IEL population. 105 CD8
+ IEL or total lymphocytes
isolated from LN of female H-Y/Db transgenic mice were cultured in RPMI supplemented with 12 U of recombinant human
IL-2 and 5% FCS in plates that had been coated with 5 µg/ml of
anti-CD3 mAb (2C11; PharMingen) or anti-
TCR clone
UC7. Cells were cultured for 48 h, pulsed with 1 µCi [3H]thymidine, and harvested 24 h later. Proliferation levels are expressed
as mean ± SEM of culture triplicates. For the IFN-
release assays, cells were cultured in triplicate in a similar manner except
that 100 µl of supernatant was withdrawn after 48 h of culture.
The IFN-
levels in the supernatants were detected using a sandwich ELISA with a coated capture mAb (purified R4-6A2) and a
biotinylated detection mAb (XMG1.2) according to the manufacturer's protocol (PharMingen). Cytokine levels are expressed
as mean OD ± SEM of culture triplicates.
| |
Results |
|---|
|
|
|---|
H-Y/Db
transgenic mice were crossed onto the RAG-2
/
background in order to completely eliminate rearrangement of
endogenous
,
,
, and
TCR genes. Expression of the
H-Y/Db-specific TCR was examined by two-color flow
cytometry analysis with the T3.70 mAb, which recognizes
the transgene-encoded V
3 chain, and with the M35-2
mAb, which recognizes V
8.1- and V
8.2-containing TCRs. In contrast to the results obtained from mice not on
the RAG-2-deficient background, all of the peripheral LN
T cells in both male and female TCR transgenic mice expressed only the H-Y/Db-specific TCR (Fig. 1 A). Similarly, all of the TCR+ small intestine IEL in male and female TCR transgenic mice expressed only the
and
chains encoded by the TCR transgenes (Fig. 1 B). Although the percentage of TCR+ cells obtained from different sources varies, among the TCR+ cells the level of expression of both TCR chains is approximately similar. This
is significant, because in small intestine IEL of female H-Y/
Db transgenic mice which are not RAG-2
/
, heterogeneous levels of expression of the TCR
transgene are found, most likely reflecting the rearrangement and coexpression of endogenous TCR
genes (22).
|
As noted above, when Db molecules
are expressed by thymic epithelial cells, this has been reported
to lead to the positive selection of thymocytes expressing
the H-Y/Db TCR transgene in female mice, and to the
negative selection of these same T cells in male mice (22).
Consistent with these results, the thymus of male H-Y/Db × RAG-2
transgenic mice contains relatively few cells (Fig.
2), and the double positive population is greatly reduced in
number (data not shown). However, opposite to the pattern observed in the thymus, H-Y/Db transgenic × RAG-2
male mice have relatively large numbers of TCR+ cells in
IEL obtained from the small intestine, whereas the small intestine epithelium of their female counterparts is severely hypocellular with respect to lymphocytes (Fig. 2). Strikingly, of the few IEL isolated from female H-Y/Db × RAG-2
mice, the majority did not express the TCR
transgene (Fig. 1 B). By contrast, in H-Y/Db transgenic × RAG-2
male mice, the proportion of TCR+ small intestine IEL (Fig. 1 B) is equal to or greater than that typical of
nontransgenic mice. Male TCR transgenic mice also have increased numbers of lamina propria lymphocytes (LPL)
from the small intestine compared with female TCR transgenic mice, the increase averaging 15-fold (n = 3) when
age matched mice were analyzed. The difference between
male and female TCR transgenic mice was more modest in
the LPL than that seen in small intestine IEL, which had
~90 times more TCR+ cells in male transgenic than in female transgenic mice (Table 1). This difference between
small intestine IEL and LPL in TCR+ cell numbers may
reflect the presence of substantial numbers of circulating T
cells in female mice, and the more extensive colonization
by these circulating T cells of the lamina propria compared
with the epithelium (8). By contrast, in the large intestine,
there was little difference in the number of IEL and LPL
when male and female TCR transgenic mice were compared, and the total number of lymphocytes in H-Y/Db
transgenic × RAG-2
mice tended to be less than the
number in nontransgenic mice (data not shown). In summary, the small intestine IEL compartment appeared to be
unique in the mucosa with regard to the differentiation and/or expansion of TCR transgene+ lymphocytes in male
mice.
|
|
Female Mice.
Althoug h
H-Y/Db transgenic × RAG-2
female mice contain circulating TCR transgene+ CD8
high
high T cells in the periphery as a result of positive selection in the thymus, surprisingly, relatively few TCR transgene+ CD8
IEL are
present in IEL from the small intestines of these mice (Fig.
3 A, and Table 1). The number of TCR+ CD8
+ IEL
isolated from the small intestine of female mice averaged only 6 × 103 in the set of animals of matched age analyzed
in Table 1. This is ~100-fold less than the number reported in female TCR transgenic mice that are not RAG-2
/
(22), suggesting that in the presence of a functional
RAG-2 gene, IEL coexpressing both the
transgene and
an endogenous
gene had expanded. Female TCR transgenic mice also contain only a very few TCR+ CD8
+
IEL (Fig. 3 A, and Table 1). These findings clearly show
that the earlier reported selection of TCR transgene+
CD8
+ IEL in small intestine IEL of H-Y/Db transgenic
female mice that were not on the RAG-2
/
background
was probably due to the coexpression of endogenous TCR
chains (22).
|
Small intestine IEL from female TCR transgenic mice
are predominantly CD3
cells (Fig. 3 A, and Table 1), with
some TCR+ DN cells. The exact number of such CD3
IEL is difficult to determine because there may be some
contaminating nonlymphoid cells that fall into the lymphocyte light scatter gate. However, the majority of the CD3
cells from female H-Y/Db transgenic × RAG-2
mice
stain positively for CD69 (data not shown), and it therefore is likely that the majority belong to the lymphoid/hemopoietic lineages.
Although the very small number of TCR transgene+
IEL in female mice is consistent with an inefficient positive
selection of these cells, it more likely reflects the complete
lack of positive selection. A few peripheral T cells or short-term residents of the epithelium could have been obtained
in the IEL preparation. Although proportionally few such
cells might be present in IEL from normal mice, in the setting of the severely hypocellular IEL compartment of female H-Y/Db × RAG-2
transgenic mice, such a population could be numerically very significant. To investigate
the possible origin of these cells in female mice, IEL were
stained with mAbs specific for V
8, CD8
, and the
E
subunit of the mucosa-specific integrin. This mucosa-specific integrin is expressed on nearly all subpopulations of
IEL, but it is expressed much less frequently by circulating
T cells (29, 30) and is absent from LN T cells of H-Y/Db
transgenic × RAG-2
mice (data not shown). Fig. 3 B
shows two-color flow cytometry data on cells gated for
V
8 expression. In H-Y/Db transgenic × RAG-2
female
mice, most TCR+ IEL, including the few that are CD8
+
and that might constitute the positively selected subset derived from the thymus, are
E negative. This lack of
E expression in TCR transgene+ IEL from female mice is consistent with these cells being contaminants from blood, or
with them being recent emigrants and transient residents of
the epithelial compartment. Thus, in the absence of endogenous TCR rearrangement, female mice cannot support
the selection and/or expansion of CD8
+ IEL expressing
the H-Y/Db-specific TCR transgene.
The decreased number and largely CD8
and/or TCR
phenotype of small intestine IEL in H-Y/Db
transgenic × RAG-2
female mice suggested that cells expressing the TCR transgene failed to undergo positive selection. To determine if this is the case, we also analyzed
IEL from H-Y/Db TCR × RAG-2
transgenic mice that
lack expression of the Db class I molecule, a situation in
which positive selection of the TCR transgene should not
occur either in male or in female mice. To do this, H-Y/Db
TCR transgenic × RAG-2
mice were bred either to
TAP-1
/
mice, in order to generate TCR transgenic
mice doubly deficient for both the expression of classical
class I molecules and for endogenous V gene rearrangement,
or to the nonselecting H-2d background. Consistent with
the requisite role of class I molecules in the thymic positive
selection of peripheral CD8
+ T cells (9), H-Y/Db TCR
transgenic × RAG-2
× TAP-1
male and female mice
lack TCR transgene+, CD8+ thymocytes, although they
contain a few TCR+ DN peripheral T cells (data not
shown). Similarly, without the expression of TAP-dependent classical class I molecules, TCR transgene+ small intestine IEL are greatly reduced in number in either male (Fig. 4 A, and Table 1) or female mice (Fig. 4 B, and Table
1). The remaining few TCR+ cells in mice of both sexes
are either DN or CD8
+. The very small population of
TCR+ CD8
+ IEL, described above, which is present in
female Db+ H-Y/Db transgenic × RAG-2
mice, is completely absent in TCR transgenic mice that are also TAP-1-deficient (Table 1). Furthermore, a specific interaction of the TCR with the selecting Db molecule is required, as
H-Y/Db TCR transgenic × RAG-2
male mice on the nonselecting Dd background also fail to support the development of more than just a very few TCR transgene+ IEL,
similar to the greatly reduced cell numbers observed in IEL
from H-Y/Db TCR transgenic × RAG-2
× TAP-1
mice (Fig. 4 C). Other than the presence of a few CD8
+
cells in female TCR transgenic Db mice, the greatly reduced number and TCR
phenotype of the IEL in Db+ female mice is similar to that in mice that do not express selecting class I molecules. However, female Db+ mice do
contain increased numbers of TCR transgene+ DN IEL
compared with their Db
counterparts, but the total cell
numbers are quite low in both kinds of animals.
|
Mice Have Unusual Patterns of Coreceptor Expression.
In male
H-Y/Db TCR transgenic mice, T cells in the periphery are
either TCR transgene+ and DN, or TCR transgene+ and
CD8
low
low (15, 16). Both of these populations are unresponsive to male antigen (16). By contrast, there are three
patterns of coreceptor expression in TCR transgene+ small
intestine IEL of male H-Y/Db × RAG-2
transgenic mice;
only one of these, the DN subset, is also found in peripheral lymphoid tissues.
The major cell population in small intestine IEL of TCR
transgenic male mice expresses a relatively high amount of
CD8
homodimers (Fig. 3 A, and Table 1). The level of
CD8
expression on these IEL is higher than that expressed by the major population of peripheral CD8
low
low
T cells in these male TCR transgenic mice, and it is nearly
comparable to the level seen in female LN or spleen
cells (Fig. 5 A). There are no detectable cells with this
CD8
high phenotype in either spleen or LNs of male mice
(Fig. 5 A).
|
Interestingly, in H-Y/Db TCR transgenic × RAG-2
male mice, there are nearly 100-fold more small intestine
IEL that are CD8
+ than in TCR transgenic females
(Table 1). This population was not observed previously in
H-Y/Db transgenic male mice that are not on the RAG-2
/
background (22). However, the majority of these
CD8
+ cells are unique in that they express high levels of
CD8
(Figs. 3 A and 5 A), comparable to the levels expressed by the CD8
+ cells, along with relatively low
levels of CD8
(Figs. 3 A and 5 B). Such a combination
suggests that CD8
high
low IEL express both CD8
homodimers and CD8
heterodimers on their cell surface.
By contrast to the CD8
+ cells in the female small intestine, most of the CD8
+ cells in the male small intestine
express
E integrin (Fig. 3 B), suggesting that they are
likely to be long-term residents of the epithelial compartment.
In addition, male H-Y/Db × RAG-2
mice on the Db
background contain significant numbers of TCR transgene+
DN IEL in the small intestine. The number of DN IEL is
increased substantially compared with the numbers present
in small intestine IEL of female mice with the same MHC
haplotype, or TCR transgenic mice on either one of the
nonselecting MHC haplotypes we tested (Table 1). Finally,
in the presence of endogenous TCR gene rearrangements, a substantial frequency of CD4+ and CD4+, CD8
+ IEL
were reported in H-Y/Db transgenic mice (21, 22). By
contrast, there is no significant expression of CD4 on IEL
in either male or female H-Y/Db transgenic × RAG-2
mice (Fig. 6).
|
It is possible that the TCR transgene+ T cells in IEL of
male mice are derived from T cells circulating in the periphery. Although the CD8
+ and CD8
high
low phenotypes of the male IEL in transgenic mice are not found in circulating T cells, the migration of T cells to the intestine could cause an upregulation in CD8
coreceptor expression leading to the generation of CD8
+ IEL from DN
cells, and CD8
high
low IEL from the CD8
low
low cells.
These hypothetical changes in CD8
expression are analogous to the behavior of splenic or LN CD4+ T cells, which
after transfer to SCID mice, can migrate to the intestine
and acquire CD8
homodimers (31). However, in
contrast to the results derived from the transfer of CD4+ T
cells, when splenic or LN lymphocytes obtained either
from male or female transgenic mice were transferred to either male or female Db+ SCID mice, we could not detect
donor-derived IEL in the intestine of multiple SCID recipients (data not shown). However, this is not due to an intrinsic defect in intestinal homing by CD8 T cells after
SCID transfer, as polyclonal CD8+ splenic T cells can migrate to the intestine after transfer to a SCID host (33).
Therefore, we consider it unlikely that circulating T cells in
male transgenic mice give rise to the majority of IEL in
these animals.

+ IEL in Male Transgenic Mice Are Not Anergic.
We analyzed the functional state of the CD8
+ IEL in
male TCR transgenic mice, the major small intestine IEL
population in these individuals, to determine if these T
lymphocytes had been tolerized as a result of exposure to
male antigen. Anergy has been reported to be a major
mechanism for self-tolerance induction of TCR 
+ IEL
(34), and the oligoclonal TCR 
+ CD8
+ IEL from
normal mice have been reported to express self-reactive V
chains and to be relatively anergic when stimulated in vitro (35). The CD8
+ IEL were enriched by flow cytometry and were >98% pure (data not shown). Upon CD3
cross-linking, these IEL proliferate to a similar degree as do
LN T cells isolated from female H-Y/Db transgenic mice
(Fig. 7 A). In addition, in comparison to LN cells from female H-Y/Db transgenic mice, CD8
+ IEL from male
transgenic mice are also able to produce similar levels of
IFN-
in response to CD3 cross-linking (Fig. 7 B). Despite their ability to respond to TCR-mediated signals in vitro
and in agreement with previously published results (22),
CD8
+ IEL from male transgenic mice are unable to
proliferate, even in the presence of added IL-2, in response
to H-Y antigen-bearing splenocytes (data not shown).
|
| |
Discussion |
|---|
|
|
|---|
We have used transgenic mice that are monoclonal for
the expression of a TCR specific for an H-Y peptide presented by Db to analyze the development and selection of
IEL. As noted above, previous analyses of these same TCR
transgenic mice, which were not on the RAG-2
/
background, led to conclusions that were not entirely in agreement (21). This is probably due to the significant level
of rearrangement of endogenous TCR
genes in this
TCR transgenic model, and the phenotypic complexity of
mouse small intestine IEL subpopulations. Phenotypic complexity is inherent to IEL, as even in truly monoclonal male
TCR transgenic mice on the RAG-2
/
background, we
found three significant subpopulations of TCR transgene+
cells, including DN, CD8
+, and CD8
high
low IEL.
Nevertheless, analysis of lymphocytes in these TCR monoclonal mice has allowed us to resolve inconsistencies in the
prior studies and to provide an explanation for the distinct
selective processes in IEL.
A major finding in this report is that the pattern of selection of a single TCR is different when thymus-selected peripheral lymphocytes are compared with small intestine
IEL. Although the H-Y/Db TCR is positively selected in
the thymus of female mice, it fails to be selected in their
IEL. IEL in female H-Y/Db transgenic mice on the Db+ selecting background are similar in number and phenotype to
the IEL numbers in H-Y/Db transgenic mice that are Db
negative. The paucity of IEL in female transgenic mice is
also consistent with a possible negative selection of TCR
transgene+ cells, but it is very difficult to believe this could
occur in female mice. It is noteworthy that lymphocytes from
the population of circulating TCR transgene+ CD8
+ T
cells in female transgenic mice do not migrate to the IEL
compartment. Because of the absence of male antigen in
these mice, this observation is consistent with recent findings indicating that antigenic stimulation is likely to be an
important determinant fostering the migration of circulating T cells to the intestinal epithelium and their long-term
residence in that location (39, 40).
In contrast to the IEL in female transgenic mice, in male
mice, IEL expressing the TCR transgene seem to undergo
a selection process that could be similar to positive selection. Positive selection is a process in which immature T
cells are tested for the expression of TCRs with an appropriate specificity, with cells undergoing programmed cell
death unless they express the correct coreceptor and have a
low affinity recognition of a self-MHC molecule plus selecting self-peptide in the absence of foreign antigen (1).
After maturation, the selected T cells do not respond to
doses of the positively selecting peptide(s) equivalent to those
in the thymus. Positive selection in IEL of male transgenic mice is consistent with the large numbers of IEL that express the TCR transgene, the majority of which also have
relatively high levels of CD8
homodimers. The presence of large numbers of TCR transgene+ CD8
+ IEL
requires both Db and the male antigen, suggesting that
these are positively selected cells rather than immature precursors. Consistent with this, in vitro studies indicate that
the CD8
+ IEL from male transgenic mice are capable of
responding to TCR-mediated signals, although they do not
respond to H-Y+ stimulator cells. Therefore, although in
some studies the oligoclonal CD8
+ IEL from normal mice
were relatively poor responders to TCR-mediated stimulation (35), these data clearly demonstrate that some
CD8
+ IEL can respond vigorously to such stimulation.
Our findings on the TCR responsiveness of CD8
+ IEL
are more consistent with those from a recent study of the 2C TCR transgenic model, which demonstrated that at
least some CD8
+ IEL are able to proliferate and secrete
cytokines in response to clonotypic antibodies (41).
However, it remains possible that extrathymic 
T
cells, including IEL, do not require a true positive selection
process, as has been proposed for differentiating 
T cells
(42). According to this view, maturing IEL might be allowed to survive if they expressed any 
TCR, and these
cells could then be subjected to antigen-driven expansion
as mature T cells. This model would account for the near
complete absence of TCR transgene+ cells in female mice,
as well as for their expansion in Db+ male mice. However,
it should be noted that we and others could not detect reactivity by TCR transgene+ CD8
+ IEL for male stimulator cells in vitro, and the male transgenic mice do not
show any histologic evidence for small intestine inflammation (data not shown), despite the presence of very large
numbers of potentially autoreactive T cells in their intestine. Although these findings argue collectively against the
antigen-driven expansion model described above, it is formally possible that a very weak antigenic stimulation in
vivo causes the gradual accumulation of large numbers of
TCR transgene+ small intestine IEL in the absence of an
overt inflammatory condition. Therefore, other than in the
discussion of models, we have used the word "selection,"
which encompasses both positive selection as well as antigen-driven expansion, to describe the presence of large
numbers of functional TCR+ CD8+ IEL in male transgenic mice.
The experiments in this report do not determine if the
TCR transgene+ IEL in male mice arise via an extrathymic
route, although we favor this possibility. In fact, years of
investigation on the origin of IEL have not fully resolved
this issue (43), which is complicated by the likely thymic
influence on the extrathymic differentiation pathway (44,
45). However, the CD8
+ phenotype of the major population of IEL in male mice is consistent with a possible extrathymic origin. The thymus-independent origin of the
CD8
IEL subpopulation is supported by studies in
which adult thymectomized mice were given a source of
stem cells, including two more recent studies that avoided
irradiation of the host by using either RAG-2
/
recipients
or W/W v recipients with reduced c-Kit receptor function
(46, 47). Furthermore, we could not generate these CD8
+
IEL by transfer of circulating T cells from TCR transgenic
mice into SCID recipients. Therefore, we consider it unlikely that the TCR and CD8+ IEL in male transgenic
mice arise from circulating T cells that have entered the intestine, although it remains possible that the CD8
+ and
CD8
high
low cells in these mice have a thymic origin, and
that these cells are transported directly to the intestine after
thymic maturation.
Analysis of the expression of the CD4 and CD8 coreceptors in TCR monoclonal mice gives further insight into
IEL differentiation. Although it has been proposed that the
CD4+ CD8
+ double positive IEL are precursors of single positive IEL, CD4+ and CD4+ CD8
+ IEL are nearly
completely absent in the H-Y/Db × RAG-2
mice. By
contrast to IEL, double positive thymocytes can be found in abundance in female Db+ transgenic mice, as well as on
thymocytes from mice of both sexes with a nonselecting
MHC haplotype (48). The lack of double positive IEL in
all mice studied, including those in which positive selection of the TCR transgene cannot occur and those where it
might be fostered, suggests that the double positives are not
precursors of TCR transgene+ CD8 single positive IEL.
The population of CD8
high
low IEL in male transgenic
mice has not been reported previously in studies of these
TCR transgenic mice. They are found only in Db+ male
TCR transgenic mice, and they are less numerous in these mice than the CD8
+ IEL. Interestingly, CD8
high
low
IEL were reported recently in normal mice, and compared
with CD8
high
high IEL, these cells were not highly sensitive to the absence of
2 integrins or ICAM-1 (49). There
are several possible explanations for the origin of these
CD8
high
low cells, but the implication is that high levels of
both CD8
and CD8
lead to negative selection, whereas
the CD8
high
low phenotype permits survival.
All of the results on the selection of IEL that we have
presented in this report can be explained by a relatively
simple model, outlined in Fig. 8, which incorporates four
assumptions. First, the model presumes that some IEL are
derived from a separate group of cells than the mainstream
CD4+ and CD8
+ single positive T cells that mature in
the thymus and that are found in spleen and LNs. It is further presumed that mainstream T cells will only enter the
IEL compartment after antigenic stimulation. Second, as
discussed above, the model hypothesizes that the T cells in
this separate IEL lineage, distinct from the mainstream T
cells, require a true positive selection process, which may occur either in the thymus or elsewhere. Third, the model
assumes that in these TCR transgenic mice, positive selection in female and male mice can be explained by the differential avidity model, with high avidity leading to negative selection, low avidity leading to lack of selection, and
intermediate avidity leading to positive selection. Fourth,
the model assumes that it is the differences in the amount
and the type of CD8 coreceptor expressed that are the major determinants of the differences between TCR selection in male and female IEL and thymocytes. Indeed, it has
been demonstrated that the affinity of the CD8 coreceptor
can affect the avidity threshold for positive selection (50).
Furthermore, the results from several experiments indicate
an important role for CD8
in increasing the strength of
the CD8
-mediated signal, including data showing directly
that it can increase the avidity of the TCR-MHC class I
interaction (51, 52), that coexpression of CD8
can increase the reactivity of mature CD8
+ T cells for antigen
(53, 54), and that CD8
is required for the positive selection of most CD8+ T cells (55).
|
Interpreted in the context of this model, it is possible
that the expression of the CD8
coreceptor in IEL leads
to a decrease in the overall avidity of the interaction of the
H-Y/Db TCR with peptide plus class I. In male mice, this
would shift the avidity of this TCR from the range in
which negative selection occurs to the intermediate range
in which positive selection might occur (Fig. 8). Furthermore, CD8
IEL would be able to persist in great numbers in the male intestine without any signs of autoreactivity, as a result of a decreased avidity of the TCR transgene
for H-Y peptide plus Db. By a similar reasoning, in female
mice, the expression of CD8
coreceptors in the IEL-specific lineage would decrease the overall avidity of this
H-Y/Db TCR from the positive selection range to an
avidity too low to support positive selection. The female
transgenic mice remain virtually devoid of IEL because, as
noted above, mainstream thymus-derived CD8
+ T cells
in the female transgenic mice are not likely to enter the intestine without antigenic stimulation. This interpretation emphasizing the importance of the CD8
chain is consistent with the analysis of female H-Y/Db TCR transgenic
mice crossed onto a CD8
/
background, as in the absence of CD8
, positive selection of the H-Y/Db TCR
transgene is not supported (55). However, it should be noted that male H-Y/Db TCR transgenic mice crossed
onto a CD8
/
background do not positively select large
numbers of TCR transgene+, CD8
+ thymocytes (55).
This indicates that besides differences in coreceptor expression, additional factors might contribute to the differential
selection of this TCR transgene in IEL. Because the
CD8
IEL express CD3 complexes containing Fc
RI
chains, either as heterodimers with CD3
/
, or as homodimers, although such CD3 complexes are not found
on CD8
IEL (58, 59), Fc
RI
expression could be one
such factor important for the differentiation of the CD8
subpopulation.
In conclusion, the data presented here from female transgenic mice demonstrate that CD8+ T cells positively selected in the thymus will not necessarily be present in small
intestine IEL. We also provide data from male mice
strongly suggesting the opposite, namely that a CD8+
TCR well represented among IEL need not be efficiently
selected in the thymus. Furthermore, the data demonstrate
that CD8
IEL need not be anergic. The results from
both male and female mice give rise to a relatively simple
model for the differential selection of thymocytes and IEL,
based upon the expression of CD8
coreceptors by IEL
and the expression of CD8
coreceptors by thymocytes
and peripheral T cells derived from CD8 single positive
thymocytes. This differential selection model is consistent
with a previous analysis indicating that the predominant
clones in polyclonal CD8
IEL populations are different
from the predominant clones in CD8
IEL (60). Despite
these insights, the specificity and function of the oligoclonal TCR 
CD8
+ IEL repertoire in normal mice,
as well as the reason for the expression of this form of CD8
in the intestine, remain to be determined.
| |
Footnotes |
|---|
Address correspondence to Hilde Cheroutre, La Jolla Institute for Allergy and Immunology, 10355 Science Center Dr., San Diego, CA 92121. Phone: 619-678-4541; Fax: 619-678-4595; E-mail: hilde{at}liai.org
Received for publication 2 March 1998 and in revised form 15 April 1998.
We thank the Jonsson Cancer Center Flow Cytometry Core Facility for help with cell sorting, Drs. Richard Aranda and Chetan Panwala for helpful discussions, and Drs. Laurent Gapin and Tesu Lin for review of the manuscript. This is manuscript 225 from the La Jolla Institute for Allergy and Immunology.
This work was supported by National Institutes of Health grant PO1 DK 46763 (to M. Kronenberg), National Institutes of Health Medical Scientist Training Program grant GM 08042, and by grants from the Crohn's and Colitis Foundation of America (to B.C. Sydora and G. Yakoub).
Abbreviations used in this paper IEL, intestinal intraepithelial lymphocyte(s); DN, double negative; LPL, lamina propria lymphocyte(s); RAG, recombination activating gene; TAP, transporter associated with antigen processing.
| |
References |
|---|
|
|
|---|
| 1. | Robey, E., and B.J. Fowlkes. 1994. Selective events in T cell development. Annu. Rev. Immunol. 12: 675-705 [Medline]. |
| 2. |
Poussier, P., and
M. Julius.
1994.
Intestinal intraepithelial
lymphocytes: the plot thickens.
J. Exp. Med.
180:
1185-1189
|
| 3. | Poussier, P., and M. Julius. 1995. T-cell development and selection in the intestinal epithelium. Semin. Immunol. 7: 321-334 [Medline]. |
| 4. | Rocha, B., D. Guy-Grand, and P. Vassalli. 1995. Extrathymic T cell differentiation. Curr. Opin. Immunol. 7: 235-242 [Medline]. |
| 5. |
Klein, J.R..
1996.
Whence the intestinal intraepithelial lymphocyte?
J. Exp. Med.
184:
1203-1206
|
| 6. | Lefrancois, L.. 1991. Phenotypic complexity of intraepithelial lymphocytes of the small intestine. J. Immunol. 147: 1746-1751 [Abstract]. |
| 7. |
Guy-Grand, D.,
N. Cerf-Bensussan,
B. Malissen,
M. Malassis-Seris,
C. Briottet, and
P. Vassalli.
1991.
Two gut intraepithelial CD8+ lymphocyte populations with different T cell
receptors: a role for the gut epithelium in T cell differentiation.
J. Exp. Med.
173:
471-481
|
| 8. |
Poussier, P.,
P. Edouard,
C. Lee,
M. Binnie, and
M. Julius.
1992.
Thymus-independent development and negative selection of T cells expressing T cell receptor / in the intestinal
epithelium: evidence for distinct circulation patterns of gut-
and thymus-derived T lymphocytes.
J. Exp. Med.
176:
187-199
|
| 9. | Zijlstra, M., M. Bix, N.E. Simister, J.M. Loring, D.H. Raulet, and R. Jaenisch. 1990. Beta 2-microglobulin deficient mice lack CD4-8+ cytolytic T cells. Nature. 344: 742-746 [Medline]. |
| 10. |
Correa, I.,
M. Bix,
N.S. Liao,
M. Zijlstra,
R. Jaenisch, and
D. Raulet.
1992.
Most gamma delta T cells develop normally in
beta 2-microglobulin-deficient mice.
Proc. Natl. Acad. Sci.
USA.
89:
653-657
|
| 11. | Schleussner, C., and R. Ceredig. 1993. Analysis of intraepithelial lymphocytes from major histocompatibility complex (MHC)-deficient mice: no evidence for a role of MHC class II antigens in the positive selection of V delta 4+ gamma delta T cells. Eur. J. Immunol. 23: 1615-1622 [Medline]. |
| 12. | Sydora, B.C., L. Brossay, A. Hagenbaugh, M. Kronenberg, and H. Cheroutre. 1996. TAP-independent selection of CD8+ intestinal intraepithelial lymphocytes. J. Immunol. 156: 4209-4216 [Abstract]. |
| 13. | Bluthmann, H., P. Kisielow, Y. Uematsu, M. Malissen, P. Krimpenfort, A. Berns, H. von Boehmer, and M. Steinmetz. 1988. T-cell-specific deletion of T-cell receptor transgenes allows functional rearrangement of endogenous alpha- and beta-genes. Nature. 334: 156-159 [Medline]. |
| 14. | Kisielow, P., H. Bluthmann, U.D. Staerz, M. Steinmetz, and H. von Boehmer. 1988. Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature. 333: 742-746 [Medline]. |
| 15. |
Teh, H.S.,
H. Kishi,
B. Scott, and
H. von Boehmer.
1989.
Deletion of autospecific T cells in T cell receptor (TCR)
transgenic mice spares cells with normal TCR levels and low
levels of CD8 molecules.
J. Exp. Med.
169:
795-806
|
| 16. |
von Boehmer, H.,
J. Kirberg, and
B. Rocha.
1991.
An unusual lineage of / T cells that contains autoreactive cells.
J.
Exp. Med.
174:
1001-1008
|
| 17. | Bruno, L., H.J. Fehling, and H. von Boehmer. 1996. The alpha beta T cell receptor can replace the gamma delta receptor in the development of gamma delta lineage cells. Immunity. 5: 343-352 [Medline]. |
| 18. | Kisielow, P., H.S. Teh, H. Bluthmann, and H. von Boehmer. 1988. Positive selection of antigen-specific T cells in thymus by restricting MHC molecules. Nature. 335: 730-733 [Medline]. |
| 19. | Teh, H.S., P. Kisielow, B. Scott, H. Kishi, Y. Uematsu, H. Bluthmann, and H. von Boehmer. 1988. Thymic major histocompatibility complex antigens and the alpha beta T-cell receptor determine the CD4/CD8 phenotype of T cells. Nature. 335: 229-233 [Medline]. |
| 20. | Scott, B., H. Bluthmann, H.S. Teh, and H. von Boehmer. 1989. The generation of mature T cells requires interaction of the alpha beta T-cell receptor with major histocompatibility antigens. Nature. 338: 591-593 [Medline]. |
| 21. |
Rocha, B.,
H. von Boehmer, and
D. Guy-Grand.
1992.
Selection of intraepithelial lymphocytes with CD8 alpha/alpha
co-receptors by self-antigen in the murine gut.
Proc. Natl.
Acad. Sci. USA.
89:
5336-5340
|
| 22. |
Poussier, P.,
H.S. Teh, and
M. Julius.
1993.
Thymus-independent positive and negative selection of T cells expressing a
major histocompatibility complex class I restricted transgenic
T cell receptor / in the intestinal epithelium.
J. Exp. Med.
178:
1947-1957
|
| 23. | Fung-Leung, W.P., K. Kishihara, D. Gray, H.S. Teh, C.Y. Lau, and T.W. Mak. 1995. Intestinal T cells in CD8 alpha knockout mice and T cell receptor transgenic mice. Adv. Exp. Med. Biol. 371A:121-124. |
| 24. |
Heath, W.R., and
J.F. Miller.
1993.
Expression of two chains on the surface of T cells in T cell receptor transgenic
mice.
J. Exp. Med.
178:
1807-1811
|
| 25. | Reimann, J., A. Rudolphi, S. Spiess, and M.H. Claesson. 1995. A gut-homing, oligoclonal CD4+ T cell population in severe-combined immunodeficient mice expressing a rearranged, transgenic class I-restricted alpha beta T cell receptor. Eur. J. Immunol. 25: 1643-1653 [Medline]. |
| 26. | Shinkai, Y., G. Rathbun, K.P. Lam, E.M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A.M. Stall, et al . 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 68: 855-867 [Medline]. |
| 27. | Van Kaer, L., P.G. Ashton-Rickardt, H.L. Ploegh, and S. Tonegawa. 1992. TAP1 mutant mice are deficient in antigen presentation, surface class I molecules, and CD4-8+ T cells. Cell. 71: 1205-1214 [Medline]. |
| 28. | Van der Heijden, P.J., and W. Stok. 1987. Improved procedure for the isolation of functionally active lymphoid cells from the murine intestine. J. Immunol. Methods. 103: 161-167 [Medline]. |
| 29. | Kilshaw, P.J., and S.J. Murant. 1990. A new surface antigen on intraepithelial lymphocytes in the intestine. Eur. J. Immunol. 20: 2201-2207 [Medline]. |
| 30. | Kilshaw, P.J., and S.J. Murant. 1991. Expression and regulation of beta 7(beta p) integrins on mouse lymphocytes: relevance to the mucosal immune system. Eur. J. Immunol. 21: 2591-2597 [Medline]. |
| 31. | Morrissey, P.J., K. Charrier, D.A. Horovitz, F.A. Fletcher, and J.D. Watson. 1995. Analysis of the intra-epithelial lymphocyte compartment in SCID mice that received co-isogenic CD4+ T cells. Evidence that mature post-thymic CD4+ T cells can be induced to express CD8 alpha in vivo. J. Immunol. 154: 2678-2686 [Abstract]. |
| 32. | Reimann, J., and A. Rudolphi. 1995. Co-expression of CD8 alpha in CD4+ T cell receptor alpha beta + T cells migrating into the murine small intestine epithelial layer. Eur. J. Immunol. 25: 1580-1588 [Medline]. |
| 33. | Aranda, R., B.C. Sydora, P.L. McAllister, S.W. Binder, H.Y. Yang, S.R. Targan, and M. Kronenberg. 1997. Analysis of intestinal lymphocytes in mouse colitis mediated by transfer of CD4+, CD45RBhigh T cells to SCID recipients. J. Immunol. 158: 3464-3473 [Abstract]. |
| 34. |
Barrett, T.A.,
M.L. Delvy,
D.M. Kennedy,
L. Lefrancois,
L.A. Matis,
A.L. Dent,
S.M. Hedrick, and
J.A. Bluestone.
1992.
Mechanism of self-tolerance of / T cells in epithelial
tissue.
J. Exp. Med.
175:
65-70
|
| 35. | Barrett, T.A., T.F. Gajewski, D. Danielpour, E.B. Chang, K.W. Beagley, and J.A. Bluestone. 1992. Differential function of intestinal intraepithelial lymphocyte subsets. J. Immunol. 149: 1124-1130 [Abstract]. |
| 36. |
Gramzinski, R.A.,
E. Adams,
J.A. Gross,
T.G. Goodman,
J.P. Allison, and
L. Lefrancois.
1993.
T cell receptor-triggered activation of intraepithelial lymphocytes in vitro.
Int. Immunol.
5:
145-153
|
| 37. |
Croitoru, K.,
J. Bienenstock, and
P.B. Ernst.
1994.
Phenotypic
and functional assessment of intraepithelial lymphocytes bearing
a "forbidden" alpha beta TCR.
Int. Immunol.
6:
1467-1473
|
| 38. | Gelfanov, V., Y.G. Lai, V. Gelfanova, J.Y. Dong, J.P. Su, and N.S. Liao. 1995. Differential requirement of CD28 costimulation for activation of murine CD8+ intestinal intraepithelial lymphocyte subsets and lymph node cells. J. Immunol. 155: 76-82 [Abstract]. |
| 39. | Kim, S.K., D.S. Reed, W.R. Heath, F. Carbone, and L. Lefrancois. 1997. Activation and migration of CD8 T cells in the intestinal mucosa. J. Immunol. 159: 4295-4306 [Abstract]. |
| 40. |
Camerini, V.,
B.C. Sydora,
R. Aranda,
C. Nguyen,
C. MacLean,
W.H. McBride, and
M. Kronenberg.
1998.
Generation
of intestinal mucosal lymphocytes in SCID mice reconstituted with mature, thymus-derived T cells.
J. Immunol.
160:
2608-2618
|
| 41. |
Guehler, S.R.,
J.A. Bluestone, and
T.A. Barrett.
1996.
Immune deviation of 2C transgenic intraepithelial lymphocytes
in antigen-bearing hosts.
J. Exp. Med.
184:
493-503
|
| 42. |
Schweighoffer, E., and
B.J. Fowlkes.
1996.
Positive selection
is not required for thymic maturation of transgenic ![]() T
cells.
J. Exp. Med.
183:
2033-2041
|
| 43. | Lefrancois, L., and L. Puddington. 1995. Extrathymic intestinal T-cell development: virtual reality? Immunol. Today. 16: 16-21 [Medline]. |
| 44. |
Wang, J., and
J.R. Klein.
1994.
Thymus-neuroendocrine interactions in extrathymic T cell development.
Science.
265:
1860-1862
|
| 45. |
Wang, J.,
M. Whetsell, and
J.R. Klein.
1997.
Local hormone
networks and intestinal T cell homeostasis.
Science.
275:
1937-1939
|
| 46. |
Rocha, B.,
P. Vassalli, and
D. Guy-Grand.
1994.
Thymic and
extrathymic origins of gut intraepithelial lymphocyte populations in mice.
J. Exp. Med.
180:
681-686
|
| 47. | Lefrancois, L., and S. Olson. 1997. Reconstitution of the extrathymic intestinal T cell compartment in the absence of irradiation. J. Immunol. 159: 538-541 [Abstract]. |
| 48. | von Boehmer, H., W. Swat, and P. Kisielow. 1993. Positive selection of immature alpha beta T cells. Immunol. Rev. 135: 67-79 [Medline]. |
| 49. |
Huleatt, J.W., and
L. Lefrancois.
1996.
2 integrins and
ICAM-1 are involved in the establishment of the intestinal
mucosal T cell compartment.
Immunity.
5:
263-273
[Medline].
|
| 50. |
Sherman, L.A.,
S.V. Hesse,
M.J. Irwin,
D. La Face, and
P. Peterson.
1992.
Selecting T cell receptors with high affinity
for self-MHC by decreasing the contribution of CD8.
Science.
258:
815-818
|
| 51. |
Renard, V.,
P. Romero,
E. Vivier,
B. Malissen, and
I.F. Luescher.
1996.
CD8 increases CD8 coreceptor function and participation in TCR-ligand binding.
J. Exp. Med.
184:
2439-2444
|
| 52. | Garcia, K.C., C.A. Scott, A. Brunmark, F.R. Carbone, P.A. Peterson, I.A. Wilson, and L. Teyton. 1996. CD8 enhances formation of stable T-cell receptor/MHC class I molecule complexes. Nature. 384: 577-581 [Medline]. |
| 53. | Wheeler, C.J., P. von Hoegen, and J.R. Parnes. 1992. An immunological role for the CD8 beta-chain. Nature. 357: 247-249 [Medline]. |
| 54. | Karaki, S., M. Tanabe, H. Nakauchi, and M. Takiguchi. 1992. Beta-chain broadens range of CD8 recognition for MHC class I molecule. J. Immunol. 149: 1613-1618 [Abstract]. |
| 55. |
Fung-Leung, W.P.,
T.M. Kundig,
K. Ngo,
J. Panakos,
J. De
Sousa-Hitzler,
E. Wang,
P.S. Ohashi,
T.W. Mak, and
C.Y. Lau.
1994.
Reduced thymic maturation but normal effector
function of CD8+ T cells in CD8 gene-targeted mice.
J.
Exp. Med.
180:
959-967
|
| 56. | Crooks, M.E., and D.R. Littman. 1994. Disruption of T lymphocyte positive and negative selection in mice lacking the CD8 beta chain. Immunity. 1: 277-285 [Medline]. |
| 57. |
Nakayama, K.,
K. Nakayama,
I. Negishi,
K. Kuida,
M.C. Louie,
O. Kanagawa,
H. Nakauchi, and
D.Y. Loh.
1994.
Requirement for CD8 beta chain in positive selection of
CD8-lineage T cells.
Science.
263:
1131-1133
|
| 58. |
Malissen, M.,
A. Gillet,
B. Rocha,
J. Trucy,
E. Vivier,
C. Boyer,
F. Köntgen,
N. Brun,
G. Mazza,
E. Spanopoulou, et al
.
1993.
T cell development in mice lacking the CD3- /
gene.
EMBO (Eur. Mol. Biol. Organ.) J.
12:
4347-4355
[Medline].
|
| 59. |
Guy-Grand, D.,
B. Rocha,
P. Mintz,
M. Malassis-Seris,
F. Selz,
B. Malissen, and
P. Vassalli.
1994.
Different use of T
cell receptor transducing modules in two populations of gut
intraepithelial lymphocytes are related to distinct pathways of
T cell differentiation.
J. Exp. Med.
180:
673-679
|
| 60. |
Regnault, A.,
A. Cumano,
P. Vassalli,
D. Guy-Grand, and
P. Kourilsky.
1994.
Oligoclonal repertoire of the CD8![]() and
the CD8![]() TCR- / murine intestinal intraepithelial T
lymphocytes: evidence for the random emergence of T cells.
J. Exp. Med.
180:
1345-1358
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|