|
||
By
From the Jefferson Medical College, Department of Microbiology and Immunology, Kimmel Cancer Institute, Philadelphia, Pennsylvania 19107
| |
Abstract |
|---|
|
|
|---|
Mature natural killer (NK) cells use Ca2+-dependent granule exocytosis and release of cytotoxic proteins, Fas ligand (FasL), and membrane-bound or secreted cytokines (tumor necrosis
factor [TNF]-
) to induce target cell death. Fas belongs to the TNF receptor family of molecules, containing a conserved intracytoplasmic "death domain" that indirectly activates the
caspase enzymatic cascade and ultimately apoptotic mechanisms in numerous cell types. Two additional members of this family, DR4 and DR5, transduce apoptotic signals upon binding
soluble TNF-related apoptosis-inducing ligand (TRAIL) that, like FasL, belongs to the growing TNF family of molecules. Here, we report that TRAIL produced or expressed by different
populations of primary human NK cells is functional, and represents a marker of differentiation
or activation of these, and possibly other, cytotoxic leukocytes. During differentiation NK
cells, sequentially and differentially, use distinct members of the TNF family or granule exocytosis to mediate target cell death. Phenotypically immature CD161+/CD56
NK cells mediate
TRAIL-dependent but not FasL- or granule release-dependent cytotoxicity, whereas mature
CD56+ NK cells mediate the latter two.
| |
Introduction |
|---|
|
|
|---|
Cytotoxic T lymphocytes (CTLs) and NK cells use a
combination of several mechanisms to lyse different
target cells. These include (a) Ca2+-dependent granule
exocytosis and release of cytotoxic proteins (perforin and
granzymes) from intracytoplasmic granules; (b) FasL, constitutively expressed or induced upon interaction with target cells and inducing Ca2+-independent, Fas (CD95/Apo
1)-mediated apoptosis; and (c) membrane-bound or secreted cytokines (TNF-
) (1-5; for a review, see reference 6). Fas and the TNF-R (CD120a, b) belong to a family of
molecules containing a conserved intracytoplasmic "death
domain" (7, 8) that, through interaction with distinct intermediary adaptor molecules, indirectly results in activation
of the caspase enzymatic cascade (9) and ultimately apoptotic mechanisms in numerous cell types (7). Additional
members of this family include the death receptors DR4
(R1) and DR5 (R2) (10), transducing apoptotic signals
upon binding their soluble ligand, the TNF-related apoptosis-inducing ligand (TRAIL [13]). A third receptor (R3),
homologous to the other two in its extracellular domain
but anchored to the membrane via glycosyl phosphatidylinositol and lacking intracellular domain and apoptosis-
inducing capability (14), has been suggested to function as a
decoy receptor, protecting normal cells against TRAIL-
induced apoptosis.
Engagement of the TCR/CD3 complex on T cells induces increased functional expression of FasL (15). Although most CD4+ T cell-mediated cytotoxicity is Fas/ FasL dependent (16), one report indicates Fas/FasL-independent CD4+ cell-mediated lysis of certain melanoma cell lines (17), suggesting that different members in the same families may also be involved in target cell lysis by CTLs.
Upon stimulation with cytokines (18), appropriate target
cells (4, 19), or Fc
RIIIA ligands (20), functional FasL is
induced on NK cells at significant levels and in appropriate configuration to cross-link Fas on positive target cells (e.g., Jurkat) and induce their death. TRAIL expression, and its
possible role in cytotoxicity mediated by these cells, has not
been analyzed. Here we demonstrate that TRAIL produced and/or expressed by different populations of human
primary NK cells is functional and represents a marker of
differentiation and/or activation of these and possibly other
cytotoxic leukocytes.
| |
Materials and Methods |
|---|
|
|
|---|
mAbs and Polyclonal Sera.
mAbs to CD2 (B67.1, B67.6), CD4 (B66.6), CD5 (B36.1), CD8 (B116.1), CD11b (B43.4), CD14 (B52.1), CD15 (B40.9), CD56 (B159.5 [21, 22]), CD161/NKR-P1A (B199.2) used for cell purification (23), and the TNF-
-
neutralizing mAb (B154.2, B154.7 [24]) have been reported previously. mAbs to CD3 (OKT3), CD21 (THB5), CD34, CD32 (IV.3), CD64 (32.2), and the irrelevant P3x63.Ag8.653 Ig were produced from cells from the American Type Culture Collection (Rockville, MD). The Fas-blocking ZB4 mAb and the Fas-triggering CH11 mAb (25) were from Upstate Biotechnology, Inc.
(Lake Placid, NY). The goat anti-mouse Ig used for panning was
produced in our laboratory, adsorbed on human IgG, and affinity-purified on mouse Ig Sepharose before use (26).
NK Cell Populations.
Immature lineage negative (Lin
) progenitor cell populations were enriched, as described (23), from
umbilical cord blood samples provided by Dr. R. Depp (Department of Obstetrics and Gynecology, Thomas Jefferson University
Hospital, Philadelphia, PA). These were >99% CD3
/CD161
/
CD16
/CD56
(indirect immunofluorescence [23]), not cytotoxic against K562 target cells, and did not express CD16 mRNA
(reverse transcription [RT]-PCR) or CD161 (23; and data not
shown). Their differentiation to NK cells was induced upon coculture with the murine bone marrow stromal cell line Sl/Sl4
hSCF220 (Sl/Sl4 [27]; provided by Dr. D. Williams, University
of Indiana, Indianapolis, IN) and rIL-2 (50 U/ml; Hoffman-LaRoche, Nutley, NJ, through the Biological Response Modifiers
Program, National Cancer Institute, Bethesda, MD) or rIL-15 (10 ng/ml, specific activity 2.95 × 108 U/mg; Immunex Corp., Seattle, WA) during a 20-30-d culture period (23, 28). CD161+/
CD56
immature and CD56+ mature NK cells were purified (23)
from CD3
/CD161+ cells from 25-30-d cultures with IL-2.
Homogeneous populations of CD3
/CD56+/CD16+ NK cells
were also obtained by negative selection from short-term, 10-d
cultures of umbilical cord blood lymphocytes with 30 Gy-irradiated RPMI-8866 cells (22). Each population contained >98% cells
expressing the appropriate phenotype (direct immunofluorescence).
Soluble TRAIL, Fas, DR4, and DR5.
As described (10), Fas, DR4, and DR5 extracellular ligand-binding domain-Fc fusion proteins were produced in human 293 cells transiently transfected with constructs encoding these proteins. Conditioned media were used as source of the soluble proteins. Recombinant His 6-tagged TRAIL was produced in bacteria and purified by affinity chromatography on Ni2+ affinity resin.Cytotoxicity and Cell Death.
Cell-mediated cytotoxicity was analyzed in 4- or 6-h 51Cr-release assays using, respectively, the Fas
K562 and the Fas+/DR4+ Jurkat cells (J32 clone) as targets (5 × 103/well) and a series of effector cell numbers; LU were calculated at 45% specific 51Cr release (21). When indicated, 1 mM EGTA
and 2 mM MgCl2, the Fas-blocking ZB4 or the irrelevant
P3x63.Ag8.653 mAb as control (each 1 µg/ml), the Fas-triggering CH11 mAb (0.2 µg/ml), the TNF-
-neutralizing mAb (ascites, 1:500 dilution), His 6-tagged TRAIL (supernatant, 1:400
dilution), and DR4- and DR5-Fc fusion proteins (supernatants, 1:2 dilution) were present throughout the assay. When indicated, effector cells were preincubated (5 × 106 cell/ml, 18 h, 37°C)
with rIL-2 (50 U/ml) and rIL-12 (2 ng/ml, specific activity 4.5 × 106 U/mg protein in an IFN-
-inducing assay; provided by Dr.
S. Wolf, Genetics Institute, Andover, MA). J32 cell death was analyzed in a 6-h 51Cr-release assay with the indicated reagents present
throughout the assay. rTNF-
(specific activity 107 U/mg protein
on L929 cells,
subline), was provided by Dr. J.S. Price, Cetus
Corp., Emeryville, CA.
RT-PCR Analysis.
RT-PCR was performed as described (23) on total RNA extracted from the different cell populations (5 × 104 cells/sample) with RNAzol (Biotecx Laboratories, Houston, TX). FasL and TRAIL primers (produced at the Kimmel Cancer Center Nucleic Acid Facility) used for RT were, respectively, TGGTTGCCTTGGTAGGATTGGGC (5') and GAGCTTATATAAGCCGAAAAACG (3') (29), and AACCTCTGAGGAAACCAT (5') and TTAGCCAACTAAAAAGGC (3').
-actin
primers were published previously (23). RT-PCR products were
identified on agarose gels after ethidium bromide staining.
| |
Results and Discussion |
|---|
|
|
|---|
NK cells induced to differentiate from Lin
umbilical
cord blood cells in cultures with IL-15 mediated lower levels of cytotoxicity against K562 target cells than those mediated by cells from cultures with IL-2 (Fig. 1 a), but cells
from either culture condition, such as mature adult peripheral or umbilical cord blood NK cells (26, 30), mediated
similar levels of cytotoxicity after stimulation with IL-2 and
IL-12. In both cases cytotoxicity was restricted to the
CD3
/CD161+/CD56+ NK cell population, the only one
detected in cultures with IL-15 (our unpublished data;
Fig. 1, b and c). An additional immature CD161+/CD56
NK cell population generated in cultures with IL-2 neither
produces IFN-
(23) nor mediates cytotoxicity against
K562 cells (Fig. 1 c) although, like mature NK cells, cells in
this population contain perforin and enzymatically active
granzyme B (23) and form conjugates with K562 cells (not
shown). The inability of this cell population to kill K562
cells likely reflects a defect in either expression or granule
exocytosis-triggering function of one or more NK cell receptors activating cytotoxicity or of other accessory molecules involved in it. Interestingly, however, cells in the
same population reproducibly mediated significant levels of
cytotoxicity against the Jurkat cell line (Fig. 1 c).
|
Killing of K562 cells by umbilical cord (Fig. 2 a) and
adult peripheral blood NK cells (31; data not shown) is
completely Ca2+ dependent, granule exocytosis mediated;
that of the Fas+ Jurkat cell line (25) is only partially so (Fig.
2 b, using umbilical cord blood as effector cells; not shown
with adult PBLs). In this case, activation of the Ca2+- and
granule release-independent apoptotic death pathway(s)
depends on engagement of Fas by FasL, expressed or induced at significant levels on the effector cells upon target
cell interaction (18, 31). Thus, the effector cells function
primarily to present target cells with the appropriate configuration of the ligand(s) (FasL) capable of binding and
cross-linking membrane receptor(s) (Fas) that initiate the
target cell apoptotic signals. The Ca2+-independent cytotoxicity mediated against Jurkat cells by NK cells from cultures with IL-15 or IL-2 (Fig. 2, c and d, respectively) was
inhibited, as expected, in the presence of Fas-blocking
mAb, and no greater inhibition was observed upon further
addition of TNF-
-neutralizing mAb. Thus, analogous to
the observations with freshly purified mature umbilical
cord blood and adult peripheral blood NK cells (31), Ca2+-dependent granule exocytosis and Fas/FasL-dependent cytotoxic mechanisms account for most cytotoxic activity of
mature NK cells from Lin
cells under the culture conditions analyzed.
|
Interestingly, the immature CD161+/CD56
NK cells
from cultures with IL-2 (Fig. 2 e) also lysed Jurkat cells, although less efficiently than their mature CD56+ cell counterparts from the same culture. As expected based on lack
of detectable granule exocytosis upon target cell recognition (23), Jurkat cell lysis by these cells, unlike that by mature NK cells, was essentially Ca2+ independent (Fig. 2 e).
Immunofluorescence analysis revealed no detectable FasL,
whereas RT-PCR detected constitutive FasL mRNA expression in all of the NK cell populations (not shown), in
agreement with findings in mature adult human NK cells
(19) and murine NK cell clones (18). However, Fas-blocking mAb did not inhibit killing of Jurkat cells by the immature cells (Fig. 2 e), suggesting that these use soluble or
membrane-bound molecules distinct from FasL to mediate
this effect.
CD161+/CD56
immature NK cells express TNF-
mRNA constitutively (23), and most produce TNF-
upon stimulation (our unpublished observations). Two lines
of evidence exclude a significant role of TNF-
, either secreted (32) or in membrane-bound form (3), in Jurkat cell
death: (a) no significant 51Cr release above background
was detected from Jurkat cells after a 6-h incubation with
up to 103 U/ml rTNF-
(not shown); and (b) no inhibition
of immature NK cell-mediated Jurkat cell killing was
detected in the presence of a TNF-
-neutralizing mAb,
alone or with added Fas-blocking ZB4 mAb (Fig. 2 e).
Similar results with cells from cultures with IL-2 (containing both mature and immature NK cells) confirmed that the TNF-
/TNF-R pathway does not participate
significantly in NK cell-mediated Jurkat cell lysis under
the experimental conditions used, and ligands other than
TNF-
on the immature NK cells bind target cell receptors distinct from TNF-R and Fas but sharing their apoptosis-inducing activity.
Unlike K562 cells (13; not shown), Jurkat cells are sensitive both to Fas-mediated (25; not shown) and to soluble TRAIL-mediated cytotoxicity (13). Engagement of the TRAIL receptors DR4 and DR5 (10, 11) by soluble TRAIL results in apoptosis (33, 34). The J32 Jurkat cell clone used, like most clones of this cell line, undergoes apoptotic cell death upon binding either soluble TRAIL or Fas-triggering mAb (Fig. 3). TRAIL-induced 51Cr release was inhibited to background levels by a mixture of soluble TRAIL-Rs (DR4 and DR5), but not by soluble Fas or Fas-blocking mAb. Conversely, Fas-induced 51Cr release using Fas-triggering mAb was inhibited by the same Fas-blocking mAb, but not by the mixture of TRAIL-R-Fc fusion proteins. The lack of inhibition of the anti-Fas mAb-induced cell death by soluble Fas likely reflects inefficient competition of this molecule for the anti-Fas binding site on the mAb. These data establish that functional Fas and TRAIL-R1 and 2 (DR4 and/or DR5) are expressed on this Jurkat cell clone with their expected and exclusive specificity.
|
TRAIL mRNA expression was detectable (by RT-PCR) in the immature NK cells, although TRAIL protein was undetectable in DR4/DR5 binding analysis (data not shown). To determine whether engagement of functional TRAIL-R by TRAIL, possibly expressed or induced to significant levels on these cells upon target cell interaction, elicits Ca2+-independent target cell death, we analyzed the effect of DR4/DR5-Fc fusion proteins on cytotoxicity of mature and immature NK cells against Jurkat cells. Like the Ca2+-independent lysis mediated by mature NK cells from short-term (10-d) cultures of primary PBLs (Fig. 4 a), that mediated by CD161+/CD56+ mature NK cells from cultures with IL-15 (not shown) was reproducibly inhibited by the Fas-blocking mAb, but not by the DR4/DR5-Fc fusion proteins. Addition of these to the anti-Fas mAb in the presence of EGTA did not result in inhibition greater than that mediated by the mAb alone. However, at the same concentrations, these reagents significantly inhibited J32 cell lysis by immature NK cells (Fig. 4 b; >75%, as quantitated based on LU in the cell populations). This indicates that the molecules transducing apoptotic signals in this case are either or both DR4 and DR5, thus implicating TRAIL in the cytotoxicity mediated by this cell subset. No additional inhibition was observed under the same conditions with ZB4 mAb added, excluding a major role, if any, for the Fas/FasL-dependent cytotoxic pathway by immature NK cells. The possibility that FasL on the immature NK cells is induced, and used, at later times after interaction with the appropriate target cells is unlikely, given the relatively fast kinetics of FasL expression both in T and NK cells. However, formal proof awaits results of experiments using additional target cells in longer assays. The possibility that other (yet to be identified) molecule(s) with ligand binding specificity identical to TRAIL and in addition to it are involved in Jurkat cell killing by the immature NK cells is unlikely, based on a recent report showing anti-TRAIL Ab-mediated inhibition of Jurkat and melanoma cell lysis by cytotoxic human CD4+ T cell clones (35).
|
The data reported here provide the first direct evidence
for the use of functional TRAIL, or a molecule with identical DR4/DR5 binding specificity, by primary human NK
cells, and point to this as a marker of differentiation of these
and possibly other cytotoxic cell types. Our results also indicate a switch in the surface molecules used for target cell
recognition and/or lysis during NK cell differentiation.
TRAIL-TRAIL-R interactions represent the first major
(but possibly not exclusive) mechanism of target cell lysis
used by NK cells to mediate their functions as innate effectors of defense, and this ability is acquired by NK cells at a
specific, phenotypically identifiable stage of differentiation (exclusively CD161+) that precedes acquisition of the ability to mediate granule exocytosis- or FasL-dependent cytotoxicity (23; and this paper) and to produce IFN-
(23).
Interesting and testable questions are raised by these data
related to whether (a) the same molecules are used by NK
cells at different stages of differentiation to kill other target
cells; (b) TRAIL and FasL are also markers of differentiation of other cytotoxic cells, or of specific functional capabilities acquired by activated mature cytotoxic effector cells
or lymphocyte subsets, phenotypically similar to the immature CD161+/CD56
NK cells and present in peripheral
blood (23). This possibility is suggested by preliminary data
(RT-PCR, not shown) indicating TRAIL mRNA expression in mature NK cells; and (c) like granule exocytosis (for
a review, see reference 36), both FasL- and TRAIL-dependent cytotoxicity are negatively regulated by MHC-binding receptors inhibiting cytotoxicity. TRAIL-Rs, expressed
on numerous cell types, have been shown to be functional
on transformed, but not normal cell-derived cell lines (37).
Definition of the expression and functionality of these receptors on primary tumor cells and hematopoietic cells at
distinct stages of differentiation or activation/proliferation is essential to establish whether the use of TRAIL rather
than FasL by immature NK cells, or even (a) phenotypically identical subset among mature NK cells (23), may endow these cells with (relative) specificity in the control of
tumor and possibly immature hematopoietic cell growth.
| |
Footnotes |
|---|
Address correspondence to Bice Perussia, Jefferson Medical College, Kimmel Cancer Institute, BLSB Rm. 750, 233 S. 10th St., Philadelphia, PA 19107. Phone: 215-503-4561; Fax: 215-923-4153; E-mail: Bice. Perussia{at}mail.tju.edu
Received for publication 31 August 1998.
L. Zamai's present address is Istituto di Anatomia Umana Normale, University of Urbino, I-61029 Urbino, Italy.We are grateful to Dr. R. Depp and the staff of the Obstetrics and Gynecology Department of Thomas Jefferson University Hospital for providing the umbilical cord blood samples, Dr. C.-C. Liu for critical discussions and suggestions, Mr. B. Abebe for technical assistance, and Ms. M. Hoffman for editing.
Supported in part by United States Public Health Service grants CA37155, CA45284 (to B. Perussia), AG14357 (to E.S. Alnemri), and T32-CA09683 (to I.M. Bennett), and by the Charlotte Greyer Foundation (E.S. Alnemri). L. Zamai was the recipient of a Dottorato di Ricerca in Scienze Morfologiche Umane (University of Bologna, Italy) from the Italian Ministry of Research and University.
| |
References |
|---|
|
|
|---|
| 1. | Montel, A.H., M.R. Bochan, W.S. Goebel, and Z. Bramhi. 1995. Fas-mediated cytotoxicity remains intact in perforin and granzyme B antisense transfectants of a human NK-like cell line. Cell. Immunol. 165: 312-317 [Medline]. |
| 2. | Lee, P.K., J. Spielman, D.Y. Zhao, K.J. Olsen, and E.R. Podack. 1996. Perforin, Fas ligand, and tumor necrosis factor are the major cytotoxic molecules used by lymphokine-activated killer cells. J. Immunol. 157: 1919-1925 [Abstract]. |
| 3. | Perez, C., I. Albert, K. DeFay, N. Zacharides, L. Gooding, and M. Kriegler. 1990. A nonsecretable cell surface mutant of tumor necrosis factor (TNF) kills by cell-to-cell contact. Cell. 63: 251-258 [Medline]. |
| 4. | Oshimi, Y., S. Oda, Y. Honda, S. Nagata, and S. Miyazaki. 1996. Involvement of Fas ligand and Fas-mediated pathway in the cytotoxicity of human natural killer cells. J. Immunol. 157: 2909-2915 [Abstract]. |
| 5. | Lowin, B., M.C. Peitsch, and J. Tschopp. 1995. Perforin and granzymes: crucial effector molecules in cytolytic T lymphocyte and natural killer cell-mediated cytotoxicity. Curr. Top. Microbiol. Immunol. 198: 1-24 [Medline]. |
| 6. | Berke, G.. 1994. The binding and lysis of target cells by cytotoxic lymphocytes: molecular and cellular aspects. Annu. Rev. Immunol. 12: 735-773 [Medline]. |
| 7. |
Nagata, S., and
P. Golstein.
1995.
The Fas death factor.
Science.
267:
1449-1456
|
| 8. |
Itoh, N., and
S. Nagata.
1993.
A novel protein domain required for apoptosis. Mutational analysis of human Fas antigen.
J. Biol. Chem.
268:
10932-10937
|
| 9. | Cohen, G.M.. 1997. Caspases: the executioners of apoptosis. Biochem. J. 326: 1-16 . |
| 10. | MacFarlane, M., A. Manzoor, S.M. Srinivasula, T. Fernandes-Alnemri, G.M. Cohen, and E.S. Alnemri. 1997. Identification and molecular cloning of two novel receptors for the cytotoxic ligand TRAIL. J. Biol. Chem. 41: 25417-25420 . |
| 11. |
Chaudhary, P.M.,
M. Eby,
A. Jasmin,
A. Bookwalter,
J. Murray, and
L. Hood.
1997.
Death receptor 5, a new member of the TNFR family, and DR4 induce FADD-dependent
apoptosis and activate NF- B.
Immunity.
7:
821-830
[Medline].
|
| 12. | Walczak, H., M.A. Degli-Esposti, R.S. Johnson, P.J. Smolak, J.Y. Waugh, N. Boiani, M.S. Timour, M.J. Gerhart, K.A. Schooley, C.A. Smith, et al . 1997. TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO (Eur. Mol. Biol. Organ.) J. 16: 5386-5397 [Medline]. |
| 13. | Wiley, S.R., K. Schooley, P.J. Smolak, W.S. Din, C.P. Huang, J.K. Nicholl, G.R. Sutherland, T.D. Smith, C. Rauch, and C.A. Smith. 1995. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 3: 673-682 [Medline]. |
| 14. |
Degli-Esposti, M.A.,
P.J. Smolak,
J. Walczak,
J. Waugh,
C.-P. Huang,
R.F. DuBose,
R.G. Goodwin, and
C.A. Smith.
1997.
Cloning and characterization of TRAIL-R3, a novel
member of the emerging TRAIL receptor family.
J. Exp.
Med.
186:
1165-1170
|
| 15. |
Vignaux, F.,
E. Vivier,
B. Malissen,
V. Depraetere,
S. Nagata, and
P. Gotstein.
1995.
TCR/CD3 coupling to Fas-based cytotoxicity.
J. Exp. Med.
181:
781-786
|
| 16. | Stalder, T., S. Hahn, and P. Erb. 1994. Fas antigen is the major target molecule for CD4+ T cell-mediated cytotoxicity. J. Immunol. 152: 1127-1133 [Abstract]. |
| 17. | Thomas, W.D., and P. Hersey. 1998. CD4 T cells kill melanoma cells by mechanisms that are independent of Fas (CD95). Int. J. Cancer. 75: 384-390 [Medline]. |
| 18. |
Tsutsui, H.,
K. Nakanishi,
K. Matsui,
K. Higashino,
H. Okamura,
Y. Miyazawa, and
K. Kaneda.
1996.
IFN- -inducing
factor up-regulates Fas ligand-mediated cytotoxic activity of
murine natural killer cell clones.
J. Immunol.
157:
3967-3973
[Abstract].
|
| 19. | Mori, S., A. Jewett, K. Murakami-Mori, M. Cavalcanti, and B. Bonavida. 1997. The participation of the Fas-mediated cytotoxic pathway by natural killer cells is tumor-cell-dependent. Cancer Immunol. Immunother. 44: 282-290 [Medline]. |
| 20. | Eischen, C.M., J.D. Schilling, D.H. Lynch, P.H. Krammer, and P.J. Leibson. 1996. Fc receptor-induced expression of Fas ligand on activated NK cells facilitates cell-mediated cytotoxicity and subsequent autocrine NK cell apoptosis. J. Immunol. 156: 2693-2699 [Abstract]. |
| 21. | Perussia, B., S. Starr, S. Abraham, V. Fanning, and G. Trinchieri. 1983. Human natural killer cells analyzed by B73.1, a monoclonal antibody blocking Fc receptor functions. I. Characterization of the lymphocyte subset reactive with B73.1. J. Immunol. 130: 2133-2141 [Abstract]. |
| 22. | Perussia, B., C. Ramoni, I. Anegon, M.C. Cuturi, J. Faust, and G. Trinchieri. 1987. Preferential proliferation of natural killer cells among peripheral blood mononuclear cells co-cultured with B lymphoblastoid cell lines. Nat. Immun. Cell Growth Regul. 6: 171-188 [Medline]. |
| 23. |
Bennett, I.M.,
O. Zatsepina,
L. Zamai,
L. Azzoni,
T. Mikheeva, and
B. Perussia.
1996.
Definition of an NKR-P1A+/
CD56 /CD16 functionally immature human NK cell subset that differentiates in vitro in the presence of IL-12.
J. Exp.
Med.
184:
1845-1856
|
| 24. |
Cuturi, M.C.,
M. Murphy,
M.P. Costa-Giomi,
R. Weinmann,
B. Perussia, and
G. Trinchieri.
1987.
Independent
regulation of tumor necrosis factor and lymphotoxin production by human peripheral blood lymphocytes.
J. Exp. Med.
165:
1581-1594
|
| 25. |
Alderson, M.,
T.W. Tough,
S. Braddy,
T. Davis-Smith,
E. Roux,
K. Schooley,
R.E. Miller, and
D.H. Lynch.
1994.
Regulation of apoptosis and T cell activation by Fas-specific
mAb.
Int. Immunol.
6:
1799-1806
|
| 26. |
Trinchieri, G.,
M. Matsumoto-Kobayashi,
S.C. Clark,
J. Seehra,
L. London, and
B. Perussia.
1984.
Response of resting human peripheral blood natural killer cells to interleukin 2.
J.
Exp. Med.
160:
1147-1169
|
| 27. |
Cuturi, M.C.,
I. Anegon,
F. Sherman,
R. Loudon,
S.C. Clark,
B. Perussia, and
G. Trinchieri.
1989.
Production of
hematopoietic colony-stimulating factors by human natural
killer cells.
J. Exp. Med.
169:
569-583
|
| 28. | Suda, T., T. Takahashi, P. Golstein, and S. Nagata. 1993. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family. Cell. 75: 1169-1178 [Medline]. |
| 29. |
Toksoz, D.,
K. Zsebo,
K. Smith,
S. Hu,
D. Brankow,
S.V. Suggs,
F. Martin, and
D.A. Williams.
1992.
Support of human hematopoiesis in long-term bone marrow cultures by
murine stromal cells selectively expressing the membrane-bound and secreted forms of the human homolog of the steel
gene factor, stem cell factor.
Proc. Natl. Acad. Sci. USA.
89:
7350-7354
|
| 30. | Gaddy, J., G. Risdon, and H.E. Broxmeyer. 1995. Cord blood natural killer cells are functionally and phenotypically immature but readily respond to interleukin-2 and interleukin-12. J. Interferon Cytokine Res. 15: 527-536 [Medline]. |
| 31. | Montel, A.H., M.R. Bochan, J.A. Hobbs, D.H. Lynch, and Z. Brahmi. 1995. Fas involvement in cytotoxicity mediated by human NK cells. Cell. Immunol. 166: 236-246 [Medline]. |
| 32. |
Chong, A.S.,
P. Scuderi,
W.J. Grimes, and
E.M. Hersh.
1989.
Tumor targets stimulate IL-2 activated killer cells to
produce interferon- and tumor necrosis factor.
J. Immunol.
142:
2133-2139
[Abstract].
|
| 33. | Marsters, S.A., R.M. Pitti, C.J. Donahue, S. Ruppert, K.D. Bauer, and A. Ashkenazi. 1996. Activation of apoptosis by Apo-2 ligand is independent of FADD but blocked by CrmA. Curr. Biol. 6: 750-752 [Medline]. |
| 34. |
Pitti, R.M.,
S.A. Marsters,
S. Ruppert,
C.J. Donhaue,
A. Moore, and
A. Ashkenazi.
1996.
Induction of apoptosis by
Apo-2 ligand, a new member of the tumor necrosis factor cytokine family.
J. Biol. Chem.
271:
12687-12690
|
| 35. |
Thomas, W.D., and
P. Hersey.
1998.
TNF-related apoptosis-inducing ligand (TRAIL) induces apoptosis in Fas ligand-
resistant melanoma cells and mediates CD4 T cell killing of
target cells.
J. Immunol.
161:
2195-2200
|
| 36. | Renard, V., A. Cambiaggi, F. Vely, M. Blery, L. Olcese, S. Olivero, M. Bouchet, and E. Vivier. 1997. Transduction of cytotoxic signals in natural killer cells: a general model of fine tuning between activatory and inhibitory pathways in lymphocytes. Immunol. Rev. 155: 205-221 [Medline]. |
| 37. |
Gura, T..
1997.
How TRAIL kills cancer cells, but not normal cells.
Science.
277:
768
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|