|
|
|
|
|
|
|
||
Articles |
Department of Molecular Biology and Immunology, University of North Texas Health Science Center, Fort Worth, Texas 76107; and the Department of Pathology, University of Texas Southwestern Medical Center, Dallas, Texas 75235
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
16 µM at 37°C) than its other ligand, CD2. Human CD48 bound human 2B4 with a similar affinity (Kd 8 µM). The finding of an additional ligand for CD48 provides an explanation for distinct functional effects observed on perturbing CD2 and CD48 with mAbs or by genetic manipulation.
Key Words: 2B4 • CD48 • natural killer cell • T cell • ligand
Abbreviations used: CD4d3+4, domains 3 and 4 of rat CD4; CD4L, rat CD4 leader; h, human; IgSF, immunoglobulin superfamily; m, mouse; r, rat; RU, response unit(s).
The majority of leukocyte surface proteins can be grouped according to the type of domain they contain (1). The immunoglobulin superfamily (IgSF)1 domain is the most highly represented domain type, found in 34% of leukocyte surface proteins. Of these, 45% have extracellular regions comprised of two IgSF domains in tandem, an arrangement that appears to be particularly favored for cell– cell recognition molecules, including the TCR. Other two-IgSF-domain leukocyte surface antigens known to mediate cell–cell interactions include CD2, CD58, CD48, CD80, CD86, CD102 (1), and OX2 (2). Among these, CD2 and its ligands, CD58 in humans (3, 4) and CD48 in rodents (5, 6) belong to the CD2 subset of the IgSF, which also includes 2B4, CDw150, CD84, and Ly-9 (Fig. 1), all of which are expressed on hematopoietic cells (1, 7, 8). With the exception of Ly-9, the extracellular regions of all of these molecules contain a membrane distal IgSF V-set domain and a membrane proximal C2-set domain (Fig. 1 A). In Ly-9, this arrangement is duplicated to give four IgSF domains. The related sequence and chromosomal location of this subset together with interactions among members suggest they evolved from one molecule which mediated homophilic recognition (1, 9).
|
/
T cells (DETCs [11, 12]). A correlation in DETCs between 2B4 expression and capacity to lyse transformed keratinocytes suggests a role for 2B4 in killing skin tumors (11). Evidence for a role in regulation of NK and T cell activity by 2B4 is provided by the cross-linking effects of the 2B4 mAb, which enhances lytic function of 2B4-expressing cells, suggesting that 2B4 can transduce stimulatory signals (10, 12). Costimulation experiments with CD3 and 2B4 mAbs suggest 2B4, like CD2 (7), can enhance signals through the TCR (12). However, the mechanisms by which 2B4 and CD2 regulate cell activation are presumably different, as there are marked differences in their cytoplasmic regions. For example, the 2B4 cytoplasmic region contains tyrosine motifs that are potential targets for phosphorylation (13), whereas the CD2 cytoplasmic region contains proline-rich motifs and no tyrosine residues (14). Since CD2 binds to CD58 and CD48, it seemed reasonable to predict that 2B4 would also bind another molecule within the CD2 subfamily. Interactions between leukocyte cell surface molecules are weak and transient, often making them difficult to identify (15). For use as ligand-binding tools, recombinant forms of extracellular regions must be made sufficiently multivalent to achieve the necessary avidity to bind to cells. In a modification of a previously described assay (16), an enzymatically biotinylated peptide (17, 18) engineered onto CD4d3+4 (domains 3 and 4 of rat CD4) fusion proteins was used to attach the recombinant molecules in an oriented manner to fluorescent beads. We used this assay to explore the ligand-binding properties of 2B4, and discovered it is a ligand for CD48 in rodents and humans.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Vector Construction for Recombinant Proteins.
The constructs for CD4d3+4 chimeric proteins used previously (22) were modified to contain at the COOH terminus a consensus peptide sequence recognized by the Escherichia coli biotin holoenzyme synthetase, BirA (17, 18). DNA encoding the amino acid sequence NSGSLHHILDAQKMVWNHR* was amplified by PCR using 5' (agggttgaattccggatcactgcatcatattctgg) and 3' (ctactaggatccttaacgatgattccacacc) oligonucleotides (restriction enzyme sites are underlined) and an HLA A2 construct as template (17), provided by Dr. Paul Moss (Institute of Molecular Medicine, Oxford, UK). This fragment was inserted via a 5' EcoRI site and a 3' BamHI site into a modified Bluescript (BS KS+) vector containing a rat CD4 leader and rat CD4d3+4 (CD4Ld3+4RI [23]). An XbaI-BamHI fragment encoding XbaI-CD4L-SalI-CD4d3+4-EcoRI-biotin peptide-stop-BamHI was transferred to a modified pEF-BOS vector (24), pEF-BOS-XB. To construct fusion proteins, the XbaI-SalI fragment encoding CD4L was replaced with DNA encoding the extracellular region of m2B4 or h2B4 amplified from plasmid DNA (13; Boles, K., and P.A. Mathew, manuscript in preparation) or domains 1–3 of rCD5 (25). XbaI sites were introduced 42 bases (m2B4) and 52 bases (h2B4) upstream of the initiation Met. The join at the SalI (g tcg acc) junction with rCD4d3 was m2B4:VPSNFRST (the residues containing the SalI site are underlined) and at the homologous region for h2B4. Confirmatory sequence analysis of all constructs (model 373A DNA sequencing system; Applied Biosystems, Inc., Foster City, CA) revealed for m2B4-CD4d3+4 a 3-base deletion, the correct sequence reading at base 619: gctttgtac encoding ALY in the C strand of domain 2. To construct soluble His-tagged hCD48, DNA (sequence data available from EMBL/GenBank/ DDBJ under accession no. M37766) encoding the extracellular region with an XbaI site 13 bases upstream of the initiation Met and a His-tag:TLARSTHHHHHH* contained in the 3' oligonucleotide (ccactaggatcctaatgatggtggtgatgatgggtcgaccgggccagggtacagggtggactgag) was amplified by PCR from mouse macrophage cDNA (provided by Dr. J. Mahoney, Sir William Dunn School of Pathology) and cloned into pEF-BOS-XB.
Expression of Recombinant Biotinylated Chimeric Proteins.
Recombinant proteins were expressed by transfection of 293T cells with 40 µg plasmid DNA/5 x 106 cells/175-cm2 flask using calcium phosphate. After removal of precipitate at 16 h, cells were incubated for 48 h in 7.5–10 ml X-Vivo-10 serum-free medium (BioWhittaker, Walkersville, MD). Levels of four Ig domain fusion proteins as assayed in a CD4d3+4 inhibition ELISA (22) were routinely in the region of 50–150 µg/175-cm2 flask. To enzymatically biotinylate CD4d3+4 fusion proteins, supernatant was exchanged (
1:20) into 10 mM Tris-HCl, pH 8, and concentrated to 0.5–0.8 ml using a 10,000 mol wt cutoff 15-ml centricon (Amicon, Inc., Beverly, MA) and incubated with 1 µl BIR enzyme (Avidity, Denver, CO). Biotinylation was complete after 2–4 h at 30°C or overnight incubation at room temperature as assessed by binding of streptavidin to chimeras immobilized via a CD4d3+4 mAb in a BIAcoreTM (reference 26, and see below). Excess biotin was removed by dialysis (twice with 800 ml PBS for 20 h), and biotinylated material was aliquoted and stored at –20°C.
Expression of His-tagged Recombinant Proteins.
Purified monomeric mCD48 containing a COOH-terminal His-tag was prepared as described (27). Soluble hCD48 was expressed as for CD4d3+4 fusion proteins in DMEM containing 10% FCS. Soluble hCD48 was purified using an FPLC (Pharmacia Biotech Ltd., St. Albans, UK) first on a 1-ml HiTrap® column (Pharmacia Biotech Ltd.). Monomeric soluble hCD48 was then eluted in 0.1-ml fractions from Superdex 75 (Pharmacia Biotech Ltd.) and used within 4 h. Concentration was measured at 280 nm using an extinction coefficient of 1.6 cm2/mg (28), and purity was checked by SDS-PAGE. Purified hCD48 was shown to be antigenically active by binding stoichiometric amounts of the 6.28 mAb when immobilized via the His-tag on an NTA chip (Biacore AB, Uppsala, Sweden). In experiments with h2B4-CD4d3+4 and control CD4d3+4 immobilized on streptavidin-coated beads (Dynal A.S., Oslo, Norway), >70% hCD48 could be depleted as assessed by SDS-PAGE and densitometry.
Cell-binding Experiments.
Experimental procedures were essentially as described (16). Biotinylated proteins (1–2 µg/sample) were mixed with 10–20 µl avidin-coated fluorescent beads/sample (VFP-0552-5; Spherotech, Inc., Libertyville, IL). Small volumes were shaken in round-bottomed microtiter plates. Where volume adjustment was necessary, beads were centrifuged and resuspended in PBS containing 0.2% BSA (PBS/BSA). For coating beads with mAbs in blocking studies, beads were washed twice in PBS/BSA and resuspended in PBS/BSA containing 2B4 or OX68 mAb (1 µg/20 µl beads).
BIAcoreTM Analysis of Affinity and Kinetics of the 2B4–CD48 Interaction.
Experiments were carried out on a BIAcoreTM 2000 (Biacore AB) using HBS buffer (25 mM Hepes, pH 7.4, 150 mM NaCl, 3.4 mM EDTA, and 0.005% surfactant P20) supplied by the manufacturer. Streptavidin 0.2 mg/ml (Pierce Chemical Co., Rockford, IL) was coupled in 10 mM sodium acetate, pH 5, to a research grade CM5 chip (Biacore AB) using an amine coupling kit (Biacore AB) using an activation time of 5 min, resulting in immobilization of 2,000–3,000 response units (RU). Soluble mCD2 comprising the extracellular region of mCD2 (27) at 90 µg/ml was coupled similarly with an activation time of 1.8 min. The surface of the chip was washed with 0.1 M glycine-HCl, pH 2.5, after coupling. Biotinylated 2B4-CD4d3+4 and control rCD5-CD4d3+4 or CD4d3+4 were then injected over immobilized streptavidin. Equilibrium affinity measurements were performed as described (26). Increasing and decreasing concentrations of mCD48 (5-µl injections at 20 µl/min) were passed over m2B4-CD4d3+4, rCD5-CD4d3+4, and mCD2. Kinetic measurements were made at 37°C (28). mCD48 (23.4 µM) was injected for 3 s at 100 µl/min over high and low levels of m2B4-CD4d3+4, rCD5-CD4d3+4, and mCD2. Similarly, to measure affinity, hCD48 was passed over h2B4-CD4d3+4 and CD4d3+4, and for kinetics, hCD48 (14.4 µM) was passed over high and low levels of h2B4-CD4d3+4 and CD4d3+4. Dissociation rates were measured for mCD48 as described (28) using Origin software, version 5.0 (Microcal Software, Inc., Northampton, MA). The effect of 2B4 mAb on mCD48 (23.4 µM) binding was tested by first passing 2B4 mAb at 10 µg/ml at 5 µl/min over m2B4-CD4d3+4 until saturation was reached.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
m2B4-CD4d3+4 beads bound to LPS and Con A–activated mouse spleen cells (Fig. 2, A and B). The broad distribution of the ligand and our own expectation that it might be another member of the CD2 subset suggested CD48 as a likely candidate. In support of this, the binding of m2B4-CD4d3+4 beads was blocked by the CD48 mAb, OX78, but not by a control CD2 mAb (Fig. 2, A and B). A second CD48 mAb, HM48-1, which blocks the CD2–CD48 interaction (5) and is known to have functional effects in vivo (29, 30), also inhibited the binding of m2B4-CD4d3+4 beads (Fig. 2 C).
|
The m2B4-CD4d3+4 beads also bound to rat thymocytes (not shown) and a rat mast cell line (Fig. 2 E). This binding was completely inhibited by a rat CD48 mAb (Fig. 2 E), indicating that the 2B4–CD48 interaction is conserved between these species, as is the CD2–CD48 interaction (27).
h2B4 Binds to CD48.
The finding that rodent 2B4 and CD48 bind to each other suggests that 2B4 may be a ligand for CD48 in humans. The recent isolation of h2B4 cDNA (Boles, K., and P.A. Mathew, manuscript in preparation) made it possible to test this hypothesis. An h2B4 rCD4d3+4 fusion protein with a COOH-terminal biotinylation tag (h2B4-CD4d3+4) was expressed at levels similar to those obtained with the m2B4-CD4d3+4 construct, consistent with it being correctly folded. Biotinylated h2B4-CD4d3+4 immobilized on fluorescent beads bound to PBMCs (Fig. 3 A). Two hCD48 mAbs (6.28 and MEM 102) were tested for blocking effects on h2B4-CD4d3+4 cell binding. Preincubation of cells with the mAbs revealed blocking of h2B4-CD4d3+4 binding by 6.28 mAb but not by MEM 102 mAb (Fig. 3 A). Both 6.28 and MEM 102 mAbs bound to the cells, with the IgG3 6.28 mAb giving a lower signal as detected by the FITC-labeled secondary reagent (Fig. 3 B). The specificity of blocking by a CD48 mAb against a particular epitope provides convincing evidence that antigenically active h2B4 is binding to CD48 at the cell surface.
|
16 µM at 37°C (Fig. 4, B and C, and Table 1). This was significantly higher than the mCD48–mCD2 interaction (Kd 90 µM) measured simultaneously (Fig. 4 C, and Table 1). Values determined for the mCD48–mCD2 interaction agree with published data (27; Table 1). At 25°C, mCD48 bound m2B4 and mCD2 with a Kd of 7 and 49 µM, respectively (data not shown).
|
|
The partial blocking effect of 2B4 mAb on cell binding (Fig. 2 D) was reproduced in BIAcoreTM analysis as shown in Fig. 4 E. Saturation of m2B4-CD4d3+4 with 2B4 mAb before injection of mCD48 reduced the level of mCD48 binding.
To measure the affinity of the interaction between h2B4 and hCD48, a soluble form of hCD48 was produced. In analyses similar to that carried out for the m2B4–mCD48 interaction, affinity measurements were made with soluble hCD48 and immobilized h2B4-CD4d3+4. Both nonlinear curve fitting (Fig. 5 B) and linear regression analysis of the Scatchard plot (Fig. 5 C) yielded a Kd 8 µM (Table 1). The apparent koff was 5 and 7 s–1 when measured with high and low levels of immobilized h2B4 (Fig. 5 D). This indicates that dissociation is limited by mass transport and/or rebinding and that the true koff is 
7 s–1.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Our finding that the m2B4–mCD48 interaction in the mouse has a significantly higher affinity than the mouse or rat CD2–CD48 interactions (26, 27; Table 1) suggests that it is biologically significant. Moreover, the strength of the 2B4–CD48 interaction is conserved across species, with similar affinities being observed for the mouse and human 2B4–CD48 interactions (Table 1). Although fast, the 2B4– CD48 dissociation rate constants are comparable with values measured for other cell–cell recognition molecules, including the CD2–CD48 and CD2–CD58 interactions (27, 28). An interaction has been reported between hCD48 and hCD2 (32, 33), but this appears to be exceptionally weak (Kd >0.5 mM [28]). Since CD2 binds with a much higher affinity to CD58 and essentially all cells that express CD48 also express CD58, it is doubtful that the CD2–CD48 interaction is of physiological significance in humans. In contrast, the relatively high affinity of h2B4 for hCD48 suggests that this latter interaction is physiologically important.
The same CD48 mAbs block CD2 and 2B4 binding to CD48, suggesting that the 2B4 ligand binding site, like the CD2 binding site (34), lies on the GFCC'C'' face of the V domain. Thus, a similar topology for the CD2–CD48 and 2B4–CD48 complexes can be predicted. The dimensions of the CD2–CD48 complex are predicted to be similar to the dimensions of the TCR–MHC complex (14 nm from membrane to membrane [7]). This has led to the suggestion that the maintenance of this intercellular distance is important for initiation of TCR–peptide MHC ligation (7). Interestingly, structure determination of an NK killer inhibitory receptor (KIR [35]) predicts that when bound to MHC class I, the complex will also span a similar distance. Together with functional studies (for a review, see reference 36), this suggests that CD2 on NK cells may contribute to activation through NK receptors. This hypothesis is supported by studies with mAbs and CD58-transfected cells that suggest that CD2 ligation can enhance activation of NK cells (36, 37). By analogy with CD2 (7) and substantiated by experiments with 2B4 mAb (10, 12), the 2B4–CD48 interaction may enhance NK and TCR ligand interaction as well as contributing to signals initiated through NK receptors and the TCR.
The expression on the same lymphocytes of two proteins (2B4 and CD2) that bind the same ligand (CD48) raises the question of whether CD2 and 2B4 have distinct functions. An analogy is exemplified by the well-characterized interactions of the T cell molecules CD28 and CD152, which bind the same ligands, CD80 and CD86 (38). There are several interesting parallels that can be drawn between these two pairs of molecules (CD28/CD152 and 2B4/CD2) that share ligands. First, they have different affinities for the same ligand, i.e., 2B4 and CD2 have different affinities for CD48, and CD152 has a 10-fold higher affinity than CD28 for CD80 (39). Second, their patterns of expression differ. The expression of both 2B4 and CD152 is much enhanced on activated cells (10, 11, 38), whereas both CD2 and CD28 are present on resting and activated cells. Third, they have different cytoplasmic regions. In the case of CD28 and CD152, this results in completely different functions, with CD28 stimulating and CD152 inhibiting (38). Thus, it seems likely that the cytoplasmic portions of 2B4 and CD2 will confer different functions. The more restricted expression of 2B4 on cells associated with non-MHC–restricted killing compared with CD2, which is present on virtually all T cells, suggests the primary role of 2B4 may be in generation of lytic activity. This is supported by the absence of effects of CD48 mAbs on target recognition (29).
Experiments have been done in vitro and in vivo with CD48 and CD2 mAbs that can now be reinterpreted in the light of there being two ligands for mCD48. For example, a CD48 mAb (HM48-1) has been shown to inhibit development of non-MHC–restricted lytic activity, whereas a blocking CD2 mAb had no effect (29). One explanation for this is that it is the 2B4–CD48 and not the CD2–CD48 interaction that has a major role in the development of the lytic population. In vivo, the synergistic effects of blocking CD2 and CD48 mAbs on allograft survival may be explained by disruption of the 2B4–CD48 and the CD2– CD48 interactions (30). Clearly, further experiments are needed to clarify this point. The activating properties (10) and partial inhibition of the 2B4–CD48 interaction make the currently available 2B4 mAb unsuitable for such experiments. Finally, recent observations that there are differences in phenotype between CD48- (40) and CD2-deficient mice (41, 42) can now be investigated with reference to the existence of an alternative ligand for CD48.
|
Acknowledgments |
|---|
Submitted: 26 August 1998
Revised: 23 September 1998
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
1 Barclay, A.N., M.H. Brown, S.K.A. Law, A.J. McKnight, M.G. Tomlinson, and P.A. van der Merwe. 1997. The Leucocyte Antigen Factsbook. 2nd ed. Academic Press Ltd., London. 613 pp.
2 Preston S, Wright GJ, Starr K, Barclay AN & Brown MH. The leukocyte/neuron cell surface antigen OX2 binds to a ligand on macrophages, Eur J Immunol, 1997, 27, 1911–1918.[Medline]
3 Hunig T. The cell surface molecule recognized by the erythrocyte receptor of T lymphocytes. Identification and partial characterization using a monoclonal antibody, J Exp Med, 1985, 162, 890–901.
4 Selvaraj P, Plunkett ML, Dustin M, Sanders ME, Shaw S & Springer TA. The T lymphocyte glycoprotein CD2 binds the cell surface ligand LFA-3, Nature, 1987, 326, 400–403.[Medline]
5 Kato K, Koyanaga M, Okada H, Takanashi T, Wong YW, Williams AF, Okumura K & Yagita H. CD48 is a counter-receptor for mouse CD2 and involved in T cell activation, J Exp Med, 1992, 176, 1241–1249.
6 van der Merwe PA, McPherson DC, Brown MH, Barclay AN, Cyster JG, Williams AF & Davis SJ. The NH2-terminal domain of rat CD2 binds rat CD48 with a low affinity and binding does not require glycosylation of CD2, Eur J Immunol, 1993, 23, 1373–1377.[Medline]
7 Davis SJ & van der Merwe PA. The structure and ligand interactions of CD2: implications for T cell function, Immunol Today, 1996, 17, 177–187.[Medline]
8 de la Fuente MA, Pizcueta P, Nadal M, Bosch J & Engel P. CD84 leukocyte antigen is a new member of the Ig superfamily, Blood, 1997, 90, 2398–2405.
9 Wong YW, Williams AF, Kingsmore SF & Seldin MF. Structure, expression, and genetic linkage of the mouse BCM1 (OX45 or Blast-1) antigen. Evidence for genetic duplication giving rise to the BCM1 region on mouse chromosome 1 and the CD2/LFA3 region on mouse chromosome 3, J Exp Med, 1990, 171, 2115–2130.
10 Garni-Wagner BA, Purohit A, Mathew PA, Bennett M & Kumar V. A novel function-associated molecule related to non-MHC-restricted cytotoxicity mediated by activated natural killer cells and T cells, J Immunol, 1993, 151, 60–70.[Abstract]
11 Schuhmachers G, Ariizumi K, Mathew PA, Bennett M, Kumar V & Takashima A. 2B4, a new member of the immunoglobulin gene superfamily, is expressed on murine dendritic epidermal T cells and plays a functional role in their killing of skin tumors, J Investig Dermatol, 1995, 105, 592–596.[Medline]
12 Schuhmachers G, Ariizumi K, Mathew PA, Bennett M, Kumar V & Takashima A. Activation of murine epidermal gamma delta T cells through surface 2B4, Eur J Immunol, 1995, 25, 1117–1120.[Medline]
13 Mathew PA, Garni-Wagner BA, Land K, Takashima A, Stoneman E, Bennett M & Kumar V. Cloning and characterization of the 2B4 gene encoding a molecule associated with non-MHC-restricted killing mediated by activated natural killer cells and T cells, J Immunol, 1993, 151, 5328–5337.[Abstract]
14 Sewell WA, Brown MH, Owen MJ, Fink PJ, Kozak CA & Crumpton MJ. The murine homologue of the T lymphocyte CD2 antigen: molecular cloning, chromosome assignment and cell surface expression, Eur J Immunol, 1987, 17, 1015–1020.[Medline]
15 van der Merwe PA & Barclay AN. Transient intercellular adhesion: the importance of weak protein-protein interactions, Trends Biochem Sci, 1994, 19, 354–358.[Medline]
16 Brown MH, Preston S & Barclay AN. A sensitive assay for detecting low-affinity interactions at the cell surface reveals no additional ligands for the adhesion pair rat CD2 and CD48, Eur J Immunol, 1995, 25, 3222–3228.[Medline]
17 Altman JD, Moss PAH, Goulder PJR, Barouch DH, McHeyzer-Williams MG, Bell JI, McMichael AJ & Davis MM. Phenotypic analysis of antigen-specific T lymphocytes, Science, 1996, 274, 94–96.
18 Schatz PJ. Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. , Biotechnology, 1993, 11, 1138–1143.[Medline]
19 Yagita H, Nakamura T, Karasuyama H & Okumura K. Monoclonal antibodies specific for murine CD2 reveal its presence on B as well as T cells, Proc Natl Acad Sci USA, 1989, 86, 645–649.
20 Korinek V, Stefanova I, Angelisova P, Hilgert I & Horejsi V. The human leucocyte antigen CD48 (MEM-102) is closely related to the activation marker Blast-1, Immunogenetics, 1991, 33, 108–112.[Medline]
21 Yokoyama S, Staunton D, Fisher R, Amiot M, Fortin JJ & Thorley-Lawson DA. Expression of the Blast-1 activation/adhesion molecule and its identification as CD48, J Immunol, 1991, 146, 2192–2200.[Abstract]
22 Brown MH & Barclay AN. Expression of immunoglobulin and scavenger receptor superfamily domains as chimeric proteins with domains 3 and 4 of CD4 for ligand analysis, Protein Eng, 1994, 7, 515–521.
23 Al-Shamkhani A, Mallett S, Brown MH, James W & Barclay AN. Affinity and kinetics of the interaction between soluble trimeric OX40 ligand, a member of the tumor necrosis factor superfamily, and its receptor OX40 on activated T cells, J Biol Chem, 1997, 272, 5275–5282.
24 Mizushima S & Nagata S. pEF-BOS, a powerful mammalian expression vector, Nucleic Acids Res, 1990, 18, 5322, .
25 McAlister MSB, Brown MH, Barclay AN, Willis AC, Campbell ID & Driscoll PC. Structural studies of the CD5 antigen, Eur J Biochem, 1998, 257, 131–141.[Medline]
26 van der Merwe PA, Brown MH, Davis SJ & Barclay AN. Affinity and kinetic analysis of the interaction of the cell adhesion molecules rat CD2 and CD48, EMBO J, 1993, 12, 4945–4954.[Medline]
27 Davis SJ, Ikemizu S, Wild MW & van der Merwe PA. CD2 and the nature of protein interactions mediating cell-cell recognition, Immunol Rev, 1998, 163, 217–236.[Medline]
28 van der Merwe PA, Barclay AN, Mason DW, Davies EA, Morgan BP, Tone M, Krishnam AKC, Ianelli C & Davis SJ. Human cell adhesion molecule CD2 binds CD58 (LFA-3) with a very low affinity and an extremely fast dissociation rate but does not bind CD48 or CD59, Biochemistry, 1994, 33, 10149–10160.[Medline]
29 Chavin KD, Qin L, Lin J, Woodward J, Baliga P, Kato K, Yagita H & Bromberg JS. Anti-CD48 (murine CD2 ligand) mAbs suppress cell-mediated immunity in vivo, Int Immunol, 1994, 6, 701–709.
30 Qin L, Chavin KD, Lin J, Yagita H & Bromberg JS. Anti-CD2 receptor and anti-CD2 ligand (CD48) antibodies synergize to prolong allograft survival, J Exp Med, 1994, 179, 341–346.
31 Ianelli CJ, Edson CM & Thorley-Lawson DA. A ligand for human CD48 on epithelial cells, J Immunol, 1997, 159, 3910–3920.[Abstract]
32 Sandrin MS, Mouhtouris E, Vaughan HA, Warren HS & Parish CR. CD48 is a low affinity ligand for human CD2, J Immunol, 1993, 151, 4606–4613.[Abstract]
33 Arulanandam AR, Moingeon P, Concino MF, Recny MA, Kato K, Yagita H, Koyasu S & Reinherz EL. A soluble multimeric recombinant CD2 protein identifies CD48 as a low affinity ligand for human CD2: divergence of CD2 ligands during the evolution of humans and mice, J Exp Med, 1993, 177, 1439–1450.
34 van der Merwe PA, McNamee PN, Davies EA, Barclay AN & Davis SJ. Topology of the CD2-CD48 cell-adhesion molecule complex: implications for antigen recognition by T cells, Curr Biol, 1995, 5, 74–84.[Medline]
35 Fan QR, Mosyak L, Winter CC, Wagtmann N, Long EO & Wiley DC. Structure of the inhibitory receptor for human natural killer cells resembles haematopoietic receptors [published erratum 390:315], Nature, 1997, 389, 96–100.[Medline]
36 Lanier LL, Corliss B & Phillips JH. Arousal and inhibition of human NK cells, Immunol Rev, 1997, 155, 145–154.[Medline]
37 Spruyt LL, Glennie MJ, Beyers AD & Williams AF. Signal transduction by the CD2 antigen in T cells and natural killer cells: requirement for expression of a functional T cell receptor or binding of antibody Fc to the Fc receptor, FcRIIIA (CD16), J Exp Med, 1991, 174, 1407–1415.
38 Thompson CB & Allison JP. The emerging role of CTLA-4 as an immune attenuator, Immunity, 1997, 7, 445–450.[Medline]
39 van der Merwe PA, Bodian DL, Daenke S, Linsley P & Davis SJ. CD80 (B7-1) binds both CD28 and CTLA-4 with a low affinity and very fast kinetics, J Exp Med, 1997, 185, 393–403.
40 Reiser, H. 1997. Role of CD48 molecule in lymphocyte activation. Immunology. 92:IS46.
41 Killeen N, Stuart SG & Littman DR. Development and function of T cells in mice with a disrupted CD2 gene, EMBO J, 1992, 11, 4329–4336.[Medline]
42 Teh SJ, Killeen N, Tarakhovsky A, Littman DR & Teh HS. CD2 regulates the positive selection and function of antigen-specific CD4– CD8+ T cells, Blood, 1997, 89, 1308–1318.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
