© The Rockefeller University Press, 0022-1007/1998/7/211/ $5.00
The Journal of Experimental Medicine, Volume 188, Number 1, July 1, 1998 211-216
Nuclear Factor (NF)-
B–regulated X-chromosome–linked iap Gene Expression Protects Endothelial Cells from Tumor Necrosis Factor
–induced Apoptosis
Christian Stehlik,
Rainer de Martin,
Ichiro Kumabashiri,
Johannes A. Schmid,
Bernd R. Binder, and
Joachim Lipp
From the Department of Vascular Biology and Thrombosis Research, Vienna International Research and Cooperation Center/University of Vienna, A-1235 Vienna, Austria
 |
Abstract
|
|---|
By differential screening of tumor necrosis factor
(TNF-
) and lipopolysaccharide (LPS)- activated endothelial cells (ECs), we have identified a cDNA clone that turned out to be a member of the inhibitor of apoptosis (iap) gene family. iap genes function to protect cells from undergoing apoptotic death in response to a variety of stimuli. These iap genes, hiap1, hiap2, and xiap were found to be strongly upregulated upon treatment of ECs with the inflammatory cytokines TNF-
, interleukin 1β, and LPS, reagents that lead to activation of the nuclear transcription factor
B (NF-
B). Indeed, overexpression of I
B
, an inhibitor of NF-
B, suppresses the induced expression of iap genes and sensitizes ECs to TNF-
–induced apoptosis. Ectopic expression of one member of the human iap genes, human X-chromosome–linked iap (xiap), using recombinant adenovirus overrules the I
B
effect and protects ECs from TNF-
– induced apoptosis. We conclude that xiap represents one of the NF-
B–regulated genes that counteracts the apoptotic signals caused by TNF-
and thereby prevents ECs from undergoing apoptosis during inflammation.
Key Words: activation inhibitor of apoptosis gene family endothelial cells adenovirus nuclear factor
B
Address correspondence to Joachim Lipp, Department of Vascular Biology and Thrombosis Research, VIRCC/University of Vienna, Brunnerstr. 59, A-1235 Vienna, Austria. Phone: 43-1-86634-565; Fax: 43-1-86634-623; E-mail: hans-joachim.lipp{at}univie.ac.at
Endothelial cells (ECs) are located at the strategic interface between blood stream and tissue and regulate local exchange of cells and nutrients. They are critically involved in local and systemic inflammatory responses at the sites of transmigration of immune cells such as neutrophils, monocytes, and lymphocytes. The concentration of inflammatory cytokines at the site of transmigration is expected to be high, and in fact inflammatory cytokine–mediated activation of ECs is responsible for the attraction, adhesion, and extravasation of white blood cells to the inflamed tissue.
Stimulation of cells with TNF-
, a potent inflammatory cytokine, generates two types of signals: one that initiates programmed cell death (1), and one that leads to activation of the transcription factor NF-
B (2), and subsequently to the inflammatory response. The overall result in a specific cell type is dependent on the balance of the two signals. Direct inhibition of NF-
B or of the upstream parts of its signaling pathway during TNF-
activation results in apoptosis in a variety of cell types originally resistant to TNF-
– induced apoptosis (3, 4). Furthermore, fibroblasts and macrophages from NF-
B subunit p65–deficient mice are more sensitive to TNF-
–induced apoptosis (5). Therefore, it has been proposed that activation of NF-
B induces the expression of genes that counteract apoptotic signals and prevent cell death.
Members of the inhibitor of apoptosis (iap) gene family have been demonstrated to suppress apoptosis induced by a variety of stimuli in different cell types (6–13, and for review see reference 14). The iap genes have also been shown to play a role in TNF-
–induced programmed cell death. Different iap gene family members appear to interfere with the cell death–triggering cascade at different levels. hiap1 and hiap2 can bind to the TNFR-associated factor 2 (TRAF2), a molecule that is associated with the cytoplasmic part of the TNFR complex and is essential for the activation of NF-
B (9, 15). Both have also been shown to be direct inhibitors of cell death proteases caspase 3 and caspase 7 (16). Another iap gene family member, the X-chromosome–linked iap (xiap), protects embryonic kidney 293T cells from bax-triggered apoptosis by inhibiting the same proteases, but in contrast it has not been found to be associated with members of the TRAF family (16, 17).
The studies presented here demonstrate that three human iap gene family members (xiap, hiap1, and hiap2) are strongly upregulated in TNF-
–stimulated primary ECs, which are resistant to TNF-
–induced apoptosis. However, adenovirus-mediated overexpression of I
B
(18, 19), an inhibitor of NF-
B, renders primary ECs sensitive to TNF-
–induced apoptosis and at the same time inhibits iap gene upregulation. Thus, iap gene expression appears to be dependent on NF-
B activation. Importantly, we show that ectopic expression of xiap is sufficient to overcome the I
B
effect in I
B
-overexpressing ECs and protects these cells from TNF-
–induced apoptosis.
 |
Materials and Methods
|
|---|
Cell Culture
Cell culture flasks were coated with 1% gelatine for 30 min at 37°C. Human umbilical vein endothelial cells (HUVECs) and human skin microvascular endothelial cells (HSMECs) were grown in medium M199 supplemented with 20% bovine calf serum (HyClone, Logan, UT), endothelial cell growth factor supplement (Technoclone, Vienna, Austria), penicillin, streptomycin, fungizone, and heparin (3 U/ml). Confluent cells were split in a 1:3 ratio and used up to the sixth passage.
U937 cells were cultivated in RPMI-1640 medium supplemented with 10% FCS, L-glutamine, penicillin, and streptomycin. Cells were split 1:10 when grown to a density of 106 cells/ml.
Northern Analysis
Total RNA was isolated using Trizol reagent (GIBCO BRL, Gaithersburg, MD). 10 µg total RNA was separated on a 1.3% formaldehyde agarose gel. Samples were run in 0.02 M MOPS (3-[N-morpholino]propanesulfonic acid), pH 7.0, 5 mM sodium acetate, 1 mM EDTA. The gel was blotted overnight using 10x SSC onto a GeneScreen Plus nylon membrane (Dupont-NEN, Boston, MA), dried, and fixed by UV-light (UV-cross-linker 120.000 µJ; Stratagene Inc., La Jolla, CA). Membranes were hybridized with
-[32P]dATP-labeled (Terminal Transferase, Boehringer Mannheim, Mannheim, Germany) oligonucleotides specific to hiap1 (5'-agaaatgtttcagtggcattcaatcaacccaaagatgtaatgtgtgactcatgaagcttct-3'), hiap2 (5'-aagatttccaccacaaaaagaaatcaatgatagactcttatgtagaatttactacactttc -3' ), xiap (5'-gaagggtggtgggtgggaaacaacacagctccctaggaagagcacaggatagtcacggggg-3'), and naip (5'-actgcatctaggcccagaagagcagacagctctggcagcaaattgtgatcaaactgggaga-3') using Quickhyb-solution (Stratagene, Inc.) at 65°C. Membranes were washed twice for 15 min at room temperature in 1% SDS/3x SSC/20 mM sodium phosphate buffer, pH 7.2, and twice for 30 min at 65°C in 1% SDS/1x SSC. Signals were analyzed on a PhosphorImager SF (Molecular Dynamics, Sunnyvale, CA).
Adenovirus Construction and Infection
Adenovirus I
B
has been described previously (26), and construction of xiap adenovirus was done by firstly introducing a fragment encoding the myc peptide sequence MEQKLISEEDL into the adenovirus transfer vector pACCMVpLpASR+ (20). Subsequently, a 1,600-bp BamHI/XbaI cDNA fragment containing the entire coding region of human xiap was ligated and the construct was cotransfected together with pJM17, a plasmid containing the adenoviral genome with a deletion in the E1 region into 293 cells (21). Plaques appearing after 10 d of culture were subcloned on 293 cells and were tested for xiap expression on immunoblots using anti-myc mAb 9E10 (22). Purification of a large batch of the recombinant adenovirus was done by two consecutive cesium chloride centrifugations as previously described (23).
Postconfluent HSMECs and HUVECs were washed once with complete PBS and incubated at a multiplicity of infection of 100 with the respective adenovirus constructs in PBS. After 30 min at 37°C, the adenovirus was washed off and fresh medium was added. Cells were maintained for an additional 2 d before being assayed.
Analysis of DNA Fragmentation
Electrophoresis of Genomic DNA.
Cells were incubated for 3 h at 55°C (100 mM NaCl, 10 mM Tris Hcl, pH 8.0, 25 mM EDTA, 0.5% SDS, 0.47 mg/ml Proteinase K), and then incubated with 100 µg/ml RNAseA for 1 h at 37°C. After phenol– chloroform extraction and isopropanol precipitation, the DNA was dissolved in 50 µl Tris/EDTA and resolved on 1.3% agarose gel.
Quantification of Fragmented DNA.
For quantification of apoptosis fragmented DNA was determined by sandwich ELISA with antihistone coated microtiter plates and peroxidase-conjugated anti-DNA antibodies using the Cell Death Detection ELISA system from Boehringer Mannheim, according to the manufacturer's protocol.
Flow Cytometry
48 h after infection cells were treated with TNF-
(500 U/ml) for 6 h or left untreated. Cells were harvested, fixed in 70% ethanol, and the proportion of cells undergoing apoptosis was determined by flow cytometric analysis (FACSort®, Becton Dickinson, San Jose, CA) after staining with propidium iodide. Cells with a DNA content <2 N appear in the sub-G1 region (M1).
 |
Results and Discussion
|
|---|
Using a modified differential screening technique to identify and clone genes regulated by inflammatory mediators in porcine aortic ECs (PAECs) (23a) we have obtained a porcine homologue (piap) of the human iap gene family. Initially identified as a TNF-
–inducible gene, piap was found also to respond to the inflammatory stimuli LPS and to a lesser degree to IL-1β. Subsequently, we have tested whether members of the human iap gene family (xiap [hILP, MIHA], hiap1 [ciap2, MIHC], and hiap2 [ciap1, MIHB]; references 6–12) show similar responses to inflammatory cytokines. Using oligonucleotides specific for the different iap genes, we performed Northern blot analysis of HSMECs (Fig. 1) and HUVECs (data not shown). We demonstrate that, apart from the neuronal inhibitor of apoptosis (naip) that is not expressed in ECs, the xiap, hiap1, and hiap2 genes were strongly upregulated in response to TNF-
in HSMECs and HUVECs.

View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1 Northern blot analysis of iap gene expression in HSMECs. 10 µg of total RNA from either nontreated or TNF- –treated (500 U/ml) HSMECs was loaded in each lane and hybridized to oligonucleotides specific to hiap1, hiap2, xiap, and naip. The predicted transcript size corresponds to the published one (7) for hiap1 (6.5 kb), hiap2 (4.5 kb), and xiap (9 kb). To confirm the equal loading of RNA, membranes were stripped and reprobed with GAPDH.
| |
Treatment of HSMECs or HUVECs with TNF-
for up to 24 h did not lead to apoptosis, whereas the well- established TNF-
–sensitive monocytic cell line U937 became apoptotic under these experimental conditions. iap gene expression has been shown to inhibit apoptosis induced by a variety of apoptotic stimuli (12). Thus, we speculated that induced iap gene expression may prevent ECs from undergoing programmed cell death in response to TNF-
.
TNF-
is a proinflammatory cytokine whose pleiotropic biological effects are signaled through two distinct cell surface receptors, TNFR 1 and TNFR 2 (2). It is known to be a potent activator of NF-
B that has been shown to be the central mediator of gene regulation in the inflammatory response of activated ECs leading to leukocyte adhesion and thrombosis (24, 25). Therefore, we tested whether NF-
B was involved in upregulation of iap genes in response to inflammatory stimuli. Having shown previously that expression of I
B
from a recombinant adenovirus vector abolishes NF-
B-dependent upregulation of inflammatory genes such as IL-1β, IL-6, IL-8, and vascular cell adhesion molecule 1 in LPS-stimulated ECs (26), we used this adenovirus-I
B
construct to investigate whether NF-
B inhibition also impairs iap gene expression. HUVECs and HSMECs were infected with either a control adenovirus or the recombinant adenovirus I
B
(27). After 2 d, cells were stimulated with TNF-
for 4 h and probed for xiap, hiap1, and hiap2 expression. As shown in Fig. 2, the expression of all three iap genes tested in adenovirus I
B
– infected ECs was suppressed, indicating that the upregulation of iap genes is controlled by activation of NF-
B.
We then raised the question whether blocking the activation of NF-
B would actually sensitize ECs to TNF-
–induced apoptosis. Indeed, ECs infected with the recombinant adenovirus I
B
construct started to die
6 h after TNF-
stimulation. To demonstrate that the apoptotic program is involved in cell death, genomic DNA was isolated from dying cells. As shown in Fig. 3, genomic DNA from I
B
-expressing and TNF-
–treated cells, but not from control virus–infected or nontreated cells, showed the DNA fragmentation pattern characteristic for apoptosis. Thus, inhibition of NF-
B activation renders ECs TNF-
sensitive, indicating that induction of apoptosis in ECs can occur independent of NF-
B.
These data suggested that TNF-
–induced expression of iap genes could be required to protect ECs from undergoing apoptosis. To directly demonstrate the ability of iap genes to prevent ECs from TNF-
–induced apoptosis, we coinfected HUVECs with recombinant adenovirus constructs expressing myc-tagged xiap and I
B
, respectively. Infection with recombinant adenovirus I
B
alone and stimulation with TNF-
–induced apoptosis in HUVECs (Fig. 4 B, c and d). Coexpression of xiap and I
B
(Fig. 4 B, f ) reduced the percentage of apoptotic cells to background levels obtained in TNF-
–treated or nontreated HUVECs (Fig. 4 B, a and b). A recombinant adenovirus expressing green fluorescent protein (27) was used as a control to show that adenovirus infection itself had no influence on apoptosis induced by TNF-
in I
B
-overexpressing cells (Fig. 4 B, g and h). Expression of myc-tagged xiap in infected HUVECs was demonstrated by Western blots stained with anti-myc mAb (Fig. 4 A).
Since the monocytic cell line U937 is sensitive to TNF-
–induced apoptosis when compared to primary ECs, we analyzed whether this cell line also differs with respect to TNF-
–inducible upregulation of iap genes. U937 and HUVECs were treated with TNF-
for 4, 6, and 9 h. At the same time points we monitored and quantified apoptosis by analysis of fragmented genomic DNA using an ELISA assay for histone-associated DNA fragments. Fig. 5 C shows that xiap gene was barely expressed in nontreated U937 cells and expression could not be induced by TNF-
. Consistently, U937 cells became significantly apoptotic after 4 h (Fig. 5 D). In contrast, as shown in Fig. 5, A and B, xiap was upregulated in HUVECs and no increase in fragmented DNA could be assayed in response to TNF-
. Identical results were obtained for hiap1 and hiap2 in U937 cells and HSMECs (data not shown).
Our findings provide several lines of evidence that the iap gene products are regulated by NF-
B and that xiap appears to be sufficient to protect primary ECs from undergoing apoptosis in response to TNF-
: (a) iap genes are expressed in response to TNF-
, IL-1β, and LPS, respectively; (b) inhibition of NF-
B activation suppresses inducible iap gene expression; (c) inhibition of NF-
B activation by overexpressing its inhibitor I
B
renders ECs sensitive to TNF-
–induced apoptosis; and (d) ectopic expression of xiap in I
B
-overexpressing ECs overrules the I
B
/ TNF-
effect.
These data show that ECs and presumably other cells have developed cellular mechanisms that protect them from apoptosis and keep them able to function properly in an inflammatory situation. Fast activation of NF-
B in response to proinflammatory signals, like TNF-
, would be an appropriate mechanism to ensure the prompt expression of antiapoptotic gene(s). This hypothesis is supported by the demonstration that NF-
B p65 is necessary to protect fibroblasts from TNF-
–induced apoptosis (5).
Whether under physiological circumstances the expression of xiap is sufficient or whether simultanous expression of all three iap genes (or other genes such as A20 [28], manganese superoxide dismutase [29], plasminogen activator– inhibitor type 2 [30], A1 [31], or other as yet undefined genes) is required to protect ECs from TNF-
–induced apoptosis remains open. Chu et al. (32) have shown recently that hiap1 expression is dependent on activation of NF-
B in Jurkat cells and hiap1 protein is able to protect these cells from apoptosis. However, in contrast to primary ECs, hiap2 showed a steady state level of expression in Jurkat cells and was not controlled by NF-
B. The data indicate that expression of the iap gene family members and their involvement in protection from apoptosis varies in certain cell types and follows a rather complex scheme. iap gene expression appears to be specific for the cell type and the given stimulus. This view is supported by our finding that iap gene expression seems to be not involved in the TNF-
response of the monocytic cell line U937. These cells become partially apoptotic upon TNF-
treatment but do not express iap genes, suggesting that other protective mechanisms are operative. Recent reports demonstrated that hiap1/2 can interfere at different levels with the apoptotic program. hiap1 and hiap2 associate via TRAF 2 with the TNFR 2, leading to NF-
B activation (9), and hiap2 is also part of the TNFR 1 signaling complex (15). On the other hand, hiap1 and hiap2 as well as xiap directly inhibit caspase 3 and caspase 7 activity, two members of the caspase family of cell death proteases, in embryonic kidney 293T cells (16, 17). However, inhibition by xiap is two to three orders of magnitude more potent, suggesting xiap as the physiological inhibitor of caspase 3 and 7 (16). These data and our finding that xiap expression is sufficient to prevent TNF-
–induced apoptosis in ECs support the concept that xiap plays a central role in inhibition of programmed cell death. It remains to be established whether xiap operates via an identical mechanism in ECs as in 293T cells and which other cell-type specific and stimulus-dependent mechanisms exist.
Unexpectedly, iap gene expression is also induced by LPS and IL-1β. Pretreatment of a human fibrosarcoma line (HT1080V) with the nonapoptotic, NF-
B–inducing IL-1 protects these cells from apoptosis induced by the later addition of TNF-
even in the presence of a protein synthesis inhibitor (3). In cells expressing a super-repressor form of the NF-
B inhibitor I
B
, IL-1β does not have this protective effect, suggesting that IL-1β also induces the expression of NF-
B–regulated antiapoptotic genes. A mechanism to overrule apoptotic signals during inflammation would enable ECs to respond properly by upregulation of inflammatory mediators such as tissue factor and adhesion molecules and at the same time to survive inflammation in order to maintain homeostasis of the inflamed tissue and initiate the healing process.
 |
Acknowledgments
|
|---|
We thank Drs. R. Kroismayr and T. Ebel for critical reading of the manuscript, and C. Kaun for providing HSMECs and HUVECs.
This work was supported by grants to J. Lipp from the Austrian Science Foundation, project SFB 005-05, and from the Jubilaeumsfonds of the Austrian National Bank, project 5548.
Submitted: 8 December 1997
Revised: 2 March 1998
Ichiro Kumabashiri's current address is Department of Internal Medicine, Keiju General Hospital, Tomiokamachi 94, Nanao, Japan.
 |
References
|
|---|
1 Hale AJ, Smith CA, Sutherland LC, Stoneman VEA, Longthorne VL, Culhane AC & Williams GT. Apoptosis: molecular regulation of cell death, Eur J Biochem, 1996, 236, 1–26.[Medline]
2 Barinaga M. Forging a path to cell death, Science, 1996, 273, 735–737.[Free Full Text]
3 Wang CY, Mayo MW & Baldwin AS Jr. TNF- and cancer therapy–induced apoptosis: potentiation by inhibition of NF-
B, Science, 1996, 274, 784–787.[Abstract/Free Full Text]
4 Van Antwerpen DJ, Martin SJ, Kafri T, Green DR & Verma IM. Suppression of TNF-
–induced apoptosis by NF-
B, Science, 1996, 274, 787–789.[Abstract/Free Full Text]
5 Beg AA & Baltimore D. An essential role for NF-
B in preventing TNF-
–induced cell death, Science, 1996, 274, 782–784.[Abstract/Free Full Text]
6 Crook NE, Clem RJ & Miller LK. An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif, J Virol, 1993, 67, 2168–2174.[Abstract/Free Full Text]
7 Birnbaum MJ, Clem RJ & Miller LK. An apoptosis inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs, J Virol, 1994, 68, 2521–2528.[Abstract/Free Full Text]
8 Hay BA, Wassarman DA & Rubin GM. Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death, Cell, 1995, 83, 1253–1262.[Medline]
9 Rothe M, Pan MG, Henzel WJ, Ayres TM & Goeddel DV. The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins, Cell, 1995, 83, 1243–1252.[Medline]
10 Roy N, Mahadevan MS, McLean M, Shutler G, Yaraghi Z, Farahani R, Baird S, Besner-Johnston A, Lefebvre C, Kang X et al.. The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy, Cell, 1995, 80, 167–178.[Medline]
11 Duckett CS, Nava VE, Gedrich RW, Clem RJ, Van Dongen JL, Gilfillan MC, Shiels H, Hardwick JM & Thompson CB. A conserved family of cellular genes related to the baculovirus iapgene and encoding apoptosis inhibitors, EMBO (Eur Mol Biol Organ) J, 1996, 15, 2685–2694.[Medline]
12 Liston P, Roy N, Tamai K, Lefebvre C, Baird S, Cherton-Horvat G, Farahani R, McLean M, Ikeda JE, MacKenzie A & Korneluk RG. Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes, Nature, 1996, 379, 349–353.[Medline]
13 Uren AG, Pakusch M, Hawkins CJ, Puls KL & Vaux DL. Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor–associated factors, Proc Natl Acad Sci USA, 1996, 93, 4974–4978.[Abstract/Free Full Text]
14 Clem RJ & Duckett CS. The iap genes: unique arbitrators of cell death, Trends Cell Biol, 1997, 7, 337–339.[Medline]
15 Shu HB, Takeuchi M & Goeddel DV. The tumor necrosis factor receptor 2 signal transducers TRAF2 and c-IAP1 are components of the tumor necrosis factor receptor 1 signaling complex, Proc Natl Acad Sci USA, 1996, 93, 13973–13978.[Abstract/Free Full Text]
16 Roy N, Deveraux QL, Takahashi R, Salvesen GS & Reed JC. The c-IAP and c-IAP proteins are direct inhibitors of specific caspases, EMBO (Eur Mol Biol Organ) J, 1997, 16, 6914–6925.[Medline]
17 Deveraux QL, Takahashi R, Salvesen GS & Reed JC. X-linked IAP is a direct inhibitor of cell-death proteases, Nature, 1997, 388, 300–304.[Medline]
18 Baeuerle PA & Baltimore D. NF-
B: ten years after, Cell, 1996, 87, 13–20.[Medline]
19 Baldwin AS Jr. The NF-
B and I
B proteins: new discoveries and insights, Annu Rev Immunol, 1996, 14, 649–681.[Medline]
20 Gomex-Foix AM, Coats WS, Baques S, Alam T, Gerard RD & Newgard CB. Adenovirus-mediated transfer of the muscle glycogen phosphorylase gene into hepatocytes confers altered regulation of glycogen metabolism, J Biol Chem, 1992, 267, 25129–25134.[Abstract/Free Full Text]
21 McGrory WJ, Bautista DS & Graham FL. A simple technique for the rescue of early region I mutations into infectious human adenovirus type 5, Virology, 1988, 163, 614–617.[Medline]
22 Evan GI, Lewis KG, Ramsay G & Bishop M. Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product, Mol Cell Biol, 1985, 5, 3610–3616.[Abstract/Free Full Text]
23 Graham FL & Van der Eb AJ. A new technique for the assay of infectivity of human adenovirus 5 DNA, Virology, 1973, 52, 456–467.[Medline]
23 Stehlik C, de Martin M, Binder BR & Lipp J. Cytokine induced expression of porcine inhibitor of apoptosis protein (iap) family member is regulated by NF-
B, Biochem Biophys Res Commun, 1998, 243, 827–832.[Medline]
24 Collins T. Biology of disease: endothelial nuclear factor-
B and the initiation of the atherosclerotic lesion, Lab Invest, 1993, 68, 499–508.[Medline]
25 Collins T, Read MA, Neish AS, Whitley MZ, Thanos D & Maniatis T. .Transcriptional regulation of endothelial cell adhesion molecules: NF-
B and cytokine-inducible enhancers, FASEB (Fed Am Soc Exp Biol) J, 1995, 9, 899–909.[Abstract]
26 Wrighton CJ, Hofer-Warbinek R, Moll T, Eytner R, Bach FH & de Martin R. Inhibition of endothelial cell activation by adenovirus-mediated expression of I
B
, an inhibitor of the transcription factor NF-
B, J Exp Med, 1996, 183, 1013–1022.[Abstract/Free Full Text]
27 de Martin R, Raidl M, Hofer E & Binder BR. Adenovirus-mediated expression of green fluorescent protein, Gene Ther, 1997, 4, 493–495.[Medline]
28 Opipari AW Jr, Hu HM, Yabkowitz R & Dixit VM. The A20 zinc finger protein protects cells from tumor necrosis factor cytotoxicity, J Biol Chem, 1992, 267, 12424–12427.[Abstract/Free Full Text]
29 Wong GHW, Elwell JH, Oberley LW & Goeddel DV. Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity of tumor necrosis factor, Cell, 1989, 58, 923–931.[Medline]
30 Kumar S & Baglioni C. Protection from tumor necrosis factor–mediated cytolysis by overexpression of plasminogen activator inhibitor type-2, J Biol Chem, 1991, 266, 20960–20964.[Abstract/Free Full Text]
31 Karsan A, Yee E, Kaushansky K & Harlan JM. Cloning of a human bcl-2 homologue: inflammatory cytokines induce human A1 in cultured endothelial cells, Blood, 1996, 87, 3089–3096.[Abstract/Free Full Text]
32 Chu ZL, McKinsey TA, Liu L, Gentry JJ, Malim MH & Ballard DW. Suppression of tumor necrosis factor– induced cell death by inhibitor of apoptosis c-iap2 is under NF-
B control, Proc Natl Acad Sci USA, 1997, 94, 10057–10062.[Abstract/Free Full Text]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
-
Zhang, X., Zou, T., Rao, J. N., Liu, L., Xiao, L., Wang, P.-Y., Cui, Y.-H., Gorospe, M., Wang, J.-Y.
(2009). Stabilization of XIAP mRNA through the RNA binding protein HuR regulated by cellular polyamines. Nucleic Acids Res
0: gkp755v1-gkp755
[Abstract]
[Full Text]
-
Welch, C., Santra, M. K., El-Assaad, W., Zhu, X., Huber, W. E., Keys, R. A., Teodoro, J. G., Green, M. R.
(2009). Identification of a Protein, G0S2, That Lacks Bcl-2 Homology Domains and Interacts with and Antagonizes Bcl-2. Cancer Res.
69: 6782-6789
[Abstract]
[Full Text]
-
Wu, X., Guo, R., Chen, P., Wang, Q., Cunningham, P. N.
(2009). TNF induces caspase-dependent inflammation in renal endothelial cells through a Rho- and myosin light chain kinase-dependent mechanism. Am. J. Physiol. Renal Physiol.
297: F316-F326
[Abstract]
[Full Text]
-
Funakoshi-Tago, M., Tago, K., Sumi, K., Abe, M., Aizu-Yokota, E., Oshio, T., Sonoda, Y., Kasahara, T.
(2009). The Acute Lymphoblastic Leukemia-associated JAK2 L611S Mutant Induces Tumorigenesis in Nude Mice. J. Biol. Chem.
284: 12680-12690
[Abstract]
[Full Text]
-
Prager, G. W., Mihaly, J., Brunner, P. M., Koshelnick, Y., Hoyer-Hansen, G., Binder, B. R.
(2009). Urokinase mediates endothelial cell survival via induction of the X-linked inhibitor of apoptosis protein. Blood
113: 1383-1390
[Abstract]
[Full Text]
-
Aggarwal, B. B., Vijayalekshmi, R.V., Sung, B.
(2009). Targeting Inflammatory Pathways for Prevention and Therapy of Cancer: Short-Term Friend, Long-Term Foe. Clin. Cancer Res.
15: 425-430
[Abstract]
[Full Text]
-
Kavurma, M. M., Tan, N. Y., Bennett, M. R.
(2008). Death Receptors and Their Ligands in Atherosclerosis. Arterioscler. Thromb. Vasc. Bio.
28: 1694-1702
[Abstract]
[Full Text]
-
Buron, N., Guery, L., Creuzot-Garcher, C., Lafontaine, P.-O., Bron, A., Rio, M.-C., Solary, E.
(2008). Trefoil Factor TFF1-Induced Protection of Conjunctival Cells from Apoptosis at Premitochondrial and Postmitochondrial Levels. IOVS
49: 3790-3798
[Abstract]
[Full Text]
-
Van Themsche, C., Lafontaine, L., Asselin, E.
(2008). X-Linked Inhibitor of Apoptosis Protein Levels and Protein Kinase C Activity Regulate the Sensitivity of Human Endometrial Carcinoma Cells to Tumor Necrosis Factor{alpha}-Induced Apoptosis. Endocrinology
149: 3789-3798
[Abstract]
[Full Text]
-
Damico, R. L., Chesley, A., Johnston, L., Bind, E. P., Amaro, E., Nijmeh, J., Karakas, B., Welsh, L., Pearse, D. B., Garcia, J. G. N., Crow, M. T.
(2008). Macrophage Migration Inhibitory Factor Governs Endothelial Cell Sensitivity to LPS-Induced Apoptosis. Am. J. Respir. Cell Mol. Bio.
39: 77-85
[Abstract]
[Full Text]
-
Sethi, G., Ahn, K. S., Aggarwal, B. B.
(2008). Targeting Nuclear Factor-{kappa}B Activation Pathway by Thymoquinone: Role in Suppression of Antiapoptotic Gene Products and Enhancement of Apoptosis. Mol Cancer Res
6: 1059-1070
[Abstract]
[Full Text]
-
Sethi, G., Ahn, K. S., Sung, B., Aggarwal, B. B.
(2008). Pinitol targets nuclear factor-{kappa}B activation pathway leading to inhibition of gene products associated with proliferation, apoptosis, invasion, and angiogenesis. Molecular Cancer Therapeutics
7: 1604-1614
[Abstract]
[Full Text]
-
Takada, Y., Sethi, G., Sung, B., Aggarwal, B. B.
(2008). Flavopiridol Suppresses Tumor Necrosis Factor-Induced Activation of Activator Protein-1, c-Jun N-Terminal Kinase, p38 Mitogen-Activated Protein Kinase (MAPK), p44/p42 MAPK, and Akt, Inhibits Expression of Antiapoptotic Gene Products, and Enhances Apoptosis through Cytochrome c Release and Caspase Activation in Human Myeloid Cells. Mol. Pharmacol.
73: 1549-1557
[Abstract]
[Full Text]
-
Kim, J., Park, J., Choi, S., Chi, S.-G., Mowbray, A. L., Jo, H., Park, H.
(2008). X-Linked Inhibitor of Apoptosis Protein Is an Important Regulator of Vascular Endothelial Growth Factor-Dependent Bovine Aortic Endothelial Cell Survival. Circ. Res.
102: 896-904
[Abstract]
[Full Text]
-
Davies, J. E., Sarkar, S., Rubinsztein, D. C.
(2008). Wild-type PABPN1 is anti-apoptotic and reduces toxicity of the oculopharyngeal muscular dystrophy mutation. Hum Mol Genet
17: 1097-1108
[Abstract]
[Full Text]
-
Sherrill, K. W., Lloyd, R. E.
(2008). Translation of cIAP2 mRNA Is Mediated Exclusively by a Stress-Modulated Ribosome Shunt. Mol. Cell. Biol.
28: 2011-2022
[Abstract]
[Full Text]
-
Kanayama, A., Miyamoto, Y.
(2007). Apoptosis triggered by phagocytosis-related oxidative stress through FLIPS down-regulation and JNK activation. J. Leukoc. Biol.
82: 1344-1352
[Abstract]
[Full Text]
-
Affara, M., Dunmore, B., Savoie, C., Imoto, S., Tamada, Y., Araki, H., Charnock-Jones, D. S., Miyano, S., Print, C.
(2007). Understanding endothelial cell apoptosis: what can the transcriptome, glycome and proteome reveal?. Phil Trans R Soc B
362: 1469-1487
[Abstract]
[Full Text]
-
Singh, S. V., Choi, S., Zeng, Y., Hahm, E.-R., Xiao, D.
(2007). Guggulsterone-Induced Apoptosis in Human Prostate Cancer Cells Is Caused by Reactive Oxygen Intermediate Dependent Activation of c-Jun NH2-Terminal Kinase. Cancer Res.
67: 7439-7449
[Abstract]
[Full Text]
-
Wullaert, A., van Loo, G., Heyninck, K., Beyaert, R.
(2007). Hepatic Tumor Necrosis Factor Signaling and Nuclear Factor-{kappa}B: Effects on Liver Homeostasis and Beyond. Endocr. Rev.
28: 365-386
[Abstract]
[Full Text]
-
Kashkar, H., Deggerich, A., Seeger, J.-M., Yazdanpanah, B., Wiegmann, K., Haubert, D., Pongratz, C., Kronke, M.
(2007). NF-{kappa}B-independent down-regulation of XIAP by bortezomib sensitizes HL B cells against cytotoxic drugs. Blood
109: 3982-3988
[Abstract]
[Full Text]
-
Arroba, A. I, Lechuga-Sancho, A. M, Frago, L. M, Argente, J., Chowen, J. A
(2007). Cell-specific expression of X-linked inhibitor of apoptosis in the anterior pituitary of streptozotocin-induced diabetic rats. J Endocrinol
192: 215-227
[Abstract]
[Full Text]
-
Choi, S., Lew, K. L., Xiao, H., Herman-Antosiewicz, A., Xiao, D., Brown, C. K., Singh, S. V.
(2007). D,L-Sulforaphane-induced cell death in human prostate cancer cells is regulated by inhibitor of apoptosis family proteins and Apaf-1. Carcinogenesis
28: 151-162
[Abstract]
[Full Text]
-
Braeuer, S. J., Buneker, C., Mohr, A., Zwacka, R. M.
(2006). Constitutively Activated Nuclear Factor-{kappa}B, but not Induced NF-{kappa}B, Leads to TRAIL Resistance by Up-Regulation of X-Linked Inhibitor of Apoptosis Protein in Human Cancer Cells. Mol Cancer Res
4: 715-728
[Abstract]
[Full Text]
-
Ichikawa, H., Nair, M. S., Takada, Y., Sheeja, D.B. A., Kumar, M.A. S., Oommen, O. V., Aggarwal, B. B.
(2006). Isodeoxyelephantopin, a Novel Sesquiterpene Lactone, Potentiates Apoptosis, Inhibits Invasion, and Abolishes Osteoclastogenesis through Suppression of Nuclear Factor-{kappa}B (NF-{kappa}B) Activation and NF-{kappa}B-Regulated Gene Expression.. Clin. Cancer Res.
12: 5910-5918
[Abstract]
[Full Text]
-
Merendino, A. M., Bucchieri, F., Gagliardo, R., Daryadel, A., Pompeo, F., Chiappara, G., Santagata, R., Bellia, V., David, S., Farina, F., Davies, D. E., Simon, H.-U., Vignola, A. M.
(2006). CD40 Ligation Protects Bronchial Epithelium against Oxidant-Induced Caspase-Independent Cell Death. Am. J. Respir. Cell Mol. Bio.
35: 155-164
[Abstract]
[Full Text]
-
Carter, B. Z., Mak, D. H., Schober, W. D., McQueen, T., Harris, D., Estrov, Z., Evans, R. L., Andreeff, M.
(2006). Triptolide induces caspase-dependent cell death mediated via the mitochondrial pathway in leukemic cells. Blood
108: 630-637
[Abstract]
[Full Text]
-
von Wnuck Lipinski, K., Keul, P., Ferri, N., Lucke, S., Heusch, G., Fischer, J. W., Levkau, B.
(2006). Integrin-Mediated Transcriptional Activation of Inhibitor of Apoptosis Proteins Protects Smooth Muscle Cells Against Apoptosis Induced by Degraded Collagen. Circ. Res.
98: 1490-1497
[Abstract]
[Full Text]
-
Shishodia, S., Sethi, G., Konopleva, M., Andreeff, M., Aggarwal, B. B.
(2006). A Synthetic Triterpenoid, CDDO-Me, Inhibits I{kappa}B{alpha} Kinase and Enhances Apoptosis Induced by TNF and Chemotherapeutic Agents through Down-Regulation of Expression of Nuclear Factor {kappa}B-Regulated Gene Products in Human Leukemic Cells. Clin. Cancer Res.
12: 1828-1838
[Abstract]
[Full Text]
-
Mittal, A., Papa, S., Franzoso, G., Sen, R.
(2006). NF-{kappa}B-Dependent Regulation of the Timing of Activation-Induced Cell Death of T Lymphocytes. J. Immunol.
176: 2183-2189
[Abstract]
[Full Text]
-
Carter, B. Z., Mak, D. H., Schober, W. D., Cabreira-Hansen, M., Beran, M., McQueen, T., Chen, W., Andreeff, M.
(2006). Regulation of survivin expression through Bcr-Abl/MAPK cascade: targeting survivin overcomes imatinib resistance and increases imatinib sensitivity in imatinib-responsive CML cells. Blood
107: 1555-1563
[Abstract]
[Full Text]
-
Ravi, R., Fuchs, E. J., Jain, A., Pham, V., Yoshimura, K., Prouser, T., Jalla, S., Zhou, X., Garrett-Mayer, E., Kaufmann, S. H., Schulick, R. D., Pardoll, D. M., Bedi, A.
(2006). Resistance of Cancers to Immunologic Cytotoxicity and Adoptive Immunotherapy via X-Linked Inhibitor of Apoptosis Protein Expression and Coexisting Defects in Mitochondrial Death Signaling. Cancer Res.
66: 1730-1739
[Abstract]
[Full Text]
-
Hua, B., Tamamori-Adachi, M., Luo, Y., Tamura, K., Morioka, M., Fukuda, M., Tanaka, Y., Kitajima, S.
(2006). A Splice Variant of Stress Response Gene ATF3 Counteracts NF-{kappa}B-dependent Anti-apoptosis through Inhibiting Recruitment of CREB-binding Protein/p300 Coactivator. J. Biol. Chem.
281: 1620-1629
[Abstract]
[Full Text]
-
Aggarwal, S., Ichikawa, H., Takada, Y., Sandur, S. K., Shishodia, S., Aggarwal, B. B.
(2006). Curcumin (Diferuloylmethane) Down-Regulates Expression of Cell Proliferation and Antiapoptotic and Metastatic Gene Products through Suppression of I{kappa}B{alpha} Kinase and Akt Activation. Mol. Pharmacol.
69: 195-206
[Abstract]
[Full Text]
-
Kaur, S., Wang, F., Venkatraman, M., Arsura, M.
(2005). X-linked Inhibitor of Apoptosis (XIAP) Inhibits c-Jun N-terminal Kinase 1 (JNK1) Activation by Transforming Growth Factor {beta}1 (TGF-{beta}1) through Ubiquitin-mediated Proteosomal Degradation of the TGF-{beta}1-activated Kinase 1 (TAK1). J. Biol. Chem.
280: 38599-38608
[Abstract]
[Full Text]
-
Mishra, S., Mishra, J. P., Gee, K., McManus, D. C., LaCasse, E. C., Kumar, A.
(2005). Distinct Role of Calmodulin and Calmodulin-dependent Protein Kinase-II in Lipopolysaccharide and Tumor Necrosis Factor-{alpha}-mediated Suppression of Apoptosis and Antiapoptotic c-IAP2 Gene Expression in Human Monocytic Cells. J. Biol. Chem.
280: 37536-37546
[Abstract]
[Full Text]
-
Singh, S. V., Zeng, Y., Xiao, D., Vogel, V. G., Nelson, J. B., Dhir, R., Tripathi, Y. B.
(2005). Caspase-dependent apoptosis induction by guggulsterone, a constituent of Ayurvedic medicinal plant Commiphora mukul, in PC-3 human prostate cancer cells is mediated by Bax and Bak. Molecular Cancer Therapeutics
4: 1747-1754
[Abstract]
[Full Text]
-
Takeuchi, H., Kim, J., Fujimoto, A., Umetani, N., Mori, T., Bilchik, A., Turner, R., Tran, A., Kuo, C., Hoon, D. S.B.
(2005). X-Linked Inhibitor of Apoptosis Protein Expression Level in Colorectal Cancer Is Regulated by Hepatocyte Growth Factor/C-Met Pathway via Akt Signaling. Clin. Cancer Res.
11: 7621-7628
[Abstract]
[Full Text]
-
Chen, G., Bhojani, M. S., Heaford, A. C., Chang, D. C., Laxman, B., Thomas, D. G., Griffin, L. B., Yu, J., Coppola, J. M., Giordano, T. J., Lin, L., Adams, D., Orringer, M. B., Ross, B. D., Beer, D. G., Rehemtulla, A.
(2005). Phosphorylated FADD induces NF-{kappa}B, perturbs cell cycle, and is associated with poor outcome in lung adenocarcinomas. Proc. Natl. Acad. Sci. USA
102: 12507-12512
[Abstract]
[Full Text]
-
Dai, Y., Rahmani, M., Dent, P., Grant, S.
(2005). Blockade of Histone Deacetylase Inhibitor-Induced RelA/p65 Acetylation and NF-{kappa}B Activation Potentiates Apoptosis in Leukemia Cells through a Process Mediated by Oxidative Damage, XIAP Downregulation, and c-Jun N-Terminal Kinase 1 Activation. Mol. Cell. Biol.
25: 5429-5444
[Abstract]
[Full Text]
-
Lesne, S., Gabriel, C., Nelson, D. A., White, E., MacKenzie, E. T., Vivien, D., Buisson, A.
(2005). Akt-dependent Expression of NAIP-1 Protects Neurons against Amyloid-{beta} Toxicity. J. Biol. Chem.
280: 24941-24947
[Abstract]
[Full Text]
-
Ichikawa, H., Takada, Y., Murakami, A., Aggarwal, B. B.
(2005). Identification of a Novel Blocker of I{kappa}B{alpha} Kinase That Enhances Cellular Apoptosis and Inhibits Cellular Invasion through Suppression of NF-{kappa}B-Regulated Gene Products. J. Immunol.
174: 7383-7392
[Abstract]
[Full Text]
-
Yang, P., Wiser, J. L., Peairs, J. J., Ebright, J. N., Zavodni, Z. J., Bowes Rickman, C., Jaffe, G. J.
(2005). Human RPE Expression of Cell Survival Factors. IOVS
46: 1755-1764
[Abstract]
[Full Text]
-
Hu, Z., Sayeed, M. M.
(2005). Activation of PI3-kinase/PKB contributes to delay in neutrophil apoptosis after thermal injury. Am. J. Physiol. Cell Physiol.
288: C1171-C1178
[Abstract]
[Full Text]
-
Takada, Y., Kobayashi, Y., Aggarwal, B. B.
(2005). Evodiamine Abolishes Constitutive and Inducible NF-{kappa}B Activation by Inhibiting I{kappa}B{alpha} Kinase Activation, Thereby Suppressing NF-{kappa}B-regulated Antiapoptotic and Metastatic Gene Expression, Up-regulating Apoptosis, and Inhibiting Invasion. J. Biol. Chem.
280: 17203-17212
[Abstract]
[Full Text]
-
Conze, D. B., Albert, L., Ferrick, D. A., Goeddel, D. V., Yeh, W.-C., Mak, T., Ashwell, J. D.
(2005). Posttranscriptional Downregulation of c-IAP2 by the Ubiquitin Protein Ligase c-IAP1 In Vivo. Mol. Cell. Biol.
25: 3348-3356
[Abstract]
[Full Text]
-
Ma, Z., Otsuyama, K.-i., Liu, S., Abroun, S., Ishikawa, H., Tsuyama, N., Obata, M., Li, F.-J., Zheng, X., Maki, Y., Miyamoto, K., Kawano, M. M.
(2005). Baicalein, a component of Scutellaria radix from Huang-Lian-Jie-Du-Tang (HLJDT), leads to suppression of proliferation and induction of apoptosis in human myeloma cells. Blood
105: 3312-3318
[Abstract]
[Full Text]
-
Li, W., Simarro, M., Kedersha, N., Anderson, P.
(2004). FAST Is a Survival Protein That Senses Mitochondrial Stress and Modulates TIA-1-Regulated Changes in Protein Expression. Mol. Cell. Biol.
24: 10718-10732
[Abstract]
[Full Text]
-
Gu, L., Zhu, N., Findley, H. W., Woods, W. G., Zhou, M.
(2004). Identification and Characterization of the IKK{alpha} Promoter: POSITIVE AND NEGATIVE REGULATION BY ETS-1 AND p53, RESPECTIVELY. J. Biol. Chem.
279: 52141-52149
[Abstract]
[Full Text]
-
Guo, R., Wang, Y., Minto, A. W., Quigg, R. J., Cunningham, P. N.
(2004). Acute Renal Failure in Endotoxemia is Dependent on Caspase Activation. J. Am. Soc. Nephrol.
15: 3093-3102
[Abstract]
[Full Text]
-
Mabuchi, S., Ohmichi, M., Nishio, Y., Hayasaka, T., Kimura, A., Ohta, T., Kawagoe, J., Takahashi, K., Yada-Hashimoto, N., Seino-Noda, H., Sakata, M., Motoyama, T., Kurachi, H., Testa, J. R., Tasaka, K., Murata, Y.
(2004). Inhibition of Inhibitor of Nuclear Factor-{kappa}B Phosphorylation Increases the Efficacy of Paclitaxel in in Vitro and in Vivo Ovarian Cancer Models. Clin. Cancer Res.
10: 7645-7654
[Abstract]
[Full Text]
-
Shishodia, S., Aggarwal, B. B.
(2004). Guggulsterone Inhibits NF-{kappa}B and I{kappa}B{alpha} Kinase Activation, Suppresses Expression of Anti-apoptotic Gene Products, and Enhances Apoptosis. J. Biol. Chem.
279: 47148-47158
[Abstract]
[Full Text]
-
Papa, S., Zazzeroni, F., Pham, C. G., Bubici, C., Franzoso, G.
(2004). Linking JNK signaling to NF-{kappa}B: a key to survival. J. Cell Sci.
117: 5197-5208
[Abstract]
[Full Text]
-
Starenki, D. V., Namba, H., Saenko, V. A., Ohtsuru, A., Maeda, S., Umezawa, K., Yamashita, S.
(2004). Induction of Thyroid Cancer Cell Apoptosis by a Novel Nuclear Factor {kappa}B Inhibitor, Dehydroxymethylepoxyquinomicin. Clin. Cancer Res.
10: 6821-6829
[Abstract]
[Full Text]
-
Plenchette, S., Cathelin, S., Rebe, C., Launay, S., Ladoire, S., Sordet, O., Ponnelle, T., Debili, N., Phan, T.-H., Padua, R.-A., Dubrez-Daloz, L., Solary, E.
(2004). Translocation of the inhibitor of apoptosis protein c-IAP1 from the nucleus to the Golgi in hematopoietic cells undergoing differentiation: a nuclear export signal-mediated event. Blood
104: 2035-2043
[Abstract]
[Full Text]
-
Kroismayr, R., Baranyi, U., Stehlik, C., Dorfleutner, A., Binder, B. R., Lipp, J.
(2004). HERC5, a HECT E3 ubiquitin ligase tightly regulated in LPS activated endothelial cells. J. Cell Sci.
117: 4749-4756
[Abstract]
[Full Text]
-
Hideshima, T., Bergsagel, P. L., Kuehl, W. M., Anderson, K. C.
(2004). Advances in biology of multiple myeloma: clinical applications. Blood
104: 607-618
[Abstract]
[Full Text]
-
Birbach, A., Bailey, S. T., Ghosh, S., Schmid, J. A.
(2004). Cytosolic, nuclear and nucleolar localization signals determine subcellular distribution and activity of the NF-{kappa}B inducing kinase NIK. J. Cell Sci.
117: 3615-3624
[Abstract]
[Full Text]
-
Yang, P., McKay, B. S., Allen, J. B., Jaffe, G. J.
(2004). Effect of NF-{kappa}B Inhibition on TNF-{alpha}-Induced Apoptosis in Human RPE Cells. IOVS
45: 2438-2446
[Abstract]
[Full Text]
-
Deeb, D., Jiang, H., Gao, X., Hafner, M. S., Wong, H., Divine, G., Chapman, R. A., Dulchavsky, S. A., Gautam, S. C.
(2004). Curcumin sensitizes prostate cancer cells to tumor necrosis factor-related apoptosis-inducing ligand/Apo2L by inhibiting nuclear factor-{kappa}B through suppression of I{kappa}B{alpha} phosphorylation. Molecular Cancer Therapeutics
3: 803-812
[Abstract]
[Full Text]
-
Pushkarev, V. M., Starenki, D. V., Saenko, V. A., Namba, H., Kurebayashi, J., Tronko, M. D., Yamashita, S.
(2004). Molecular Mechanisms of the Effects of Low Concentrations of Taxol in Anaplastic Thyroid Cancer Cells. Endocrinology
145: 3143-3152
[Abstract]
[Full Text]
-
Reed, J. C., Doctor, K. S., Godzik, A.
(2004). The Domains of Apoptosis: A Genomics Perspective. Sci Signal
2004: re9-re9
[Abstract]
[Full Text]
-
Takada, Y., Khuri, F. R., Aggarwal, B. B.
(2004). Protein Farnesyltransferase Inhibitor (SCH 66336) Abolishes NF-{kappa}B Activation Induced by Various Carcinogens and Inflammatory Stimuli Leading to Suppression of NF-{kappa}B-regulated Gene Expression and Up-regulation of Apoptosis. J. Biol. Chem.
279: 26287-26299
[Abstract]
[Full Text]
-
Lamkanfi, M., Kalai, M., Saelens, X., Declercq, W., Vandenabeele, P.
(2004). Caspase-1 Activates Nuclear Factor of the {kappa}-Enhancer in B Cells Independently of Its Enzymatic Activity. J. Biol. Chem.
279: 24785-24793
[Abstract]
[Full Text]
-
Mabuchi, S., Ohmichi, M., Nishio, Y., Hayasaka, T., Kimura, A., Ohta, T., Saito, M., Kawagoe, J., Takahashi, K., Yada-Hashimoto, N., Sakata, M., Motoyama, T., Kurachi, H., Tasaka, K., Murata, Y.
(2004). Inhibition of NF{kappa}B Increases the Efficacy of Cisplatin in in Vitro and in Vivo Ovarian Cancer Models. J. Biol. Chem.
279: 23477-23485
[Abstract]
[Full Text]
-
Zou, T., Rao, J. N., Guo, X., Liu, L., Zhang, H. M., Strauch, E. D., Bass, B. L., Wang, J.-Y.
(2004). NF-{kappa}B-mediated IAP expression induces resistance of intestinal epithelial cells to apoptosis after polyamine depletion. Am. J. Physiol. Cell Physiol.
286: C1009-C1018
[Abstract]
[Full Text]
-
Benoit, V., Chariot, A., Delacroix, L., Deregowski, V., Jacobs, N., Merville, M.-P., Bours, V.
(2004). Caspase-8-Dependent HER-2 Cleavage in Response to Tumor Necrosis Factor {alpha} Stimulation Is Counteracted by Nuclear Factor {kappa}B through c-FLIP-L Expression. Cancer Res.
64: 2684-2691
[Abstract]
[Full Text]
-
Papakonstanti, E. A., Stournaras, C.
(2004). Tumor Necrosis Factor-{alpha} Promotes Survival of Opossum Kidney Cells via Cdc42-induced Phospholipase C-{gamma}1 Activation and Actin Filament Redistribution. Mol. Biol. Cell
15: 1273-1286
[Abstract]
[Full Text]
-
Monaco, C., Paleolog, E.
(2004). Nuclear factor {kappa}B: a potential therapeutic target in atherosclerosis and thrombosis. Cardiovasc Res
61: 671-682
[Abstract]
[Full Text]
-
Vasudevan, K. M., Gurumurthy, S., Rangnekar, V. M.
(2004). Suppression of PTEN Expression by NF-{kappa}B Prevents Apoptosis. Mol. Cell. Biol.
24: 1007-1021
[Abstract]
[Full Text]
-
Kaiser, W. J., Kaufman, J. L., Offermann, M. K.
(2004). IFN-{alpha} Sensitizes Human Umbilical Vein Endothelial Cells to Apoptosis Induced by Double-Stranded RNA. J. Immunol.
172: 1699-1710
[Abstract]
[Full Text]
-
Mistry, P., Deacon, K., Mistry, S., Blank, J., Patel, R.
(2004). NF-{kappa}B Promotes Survival during Mitotic Cell Cycle Arrest. J. Biol. Chem.
279: 1482-1490
[Abstract]
[Full Text]
-
Mohapatra, S., Chu, B., Wei, S., Djeu, J., Epling-Burnette, P. K., Loughran, T., Jove, R., Pledger, W. J.
(2003). Roscovitine Inhibits STAT5 Activity and Induces Apoptosis in the Human Leukemia Virus Type 1-Transformed Cell Line MT-2. Cancer Res.
63: 8523-8530
[Abstract]
[Full Text]
-
Carter, B. Z., Kornblau, S. M., Tsao, T., Wang, R.-Y., Schober, W. D., Milella, M., Sung, H.-G., Reed, J. C., Andreeff, M.
(2003). Caspase-independent cell death in AML: caspase inhibition in vitro with pan-caspase inhibitors or in vivo by XIAP or Survivin does not affect cell survival or prognosis. Blood
102: 4179-4186
[Abstract]
[Full Text]
-
Warke, R. V., Xhaja, K., Martin, K. J., Fournier, M. F., Shaw, S. K., Brizuela, N., de Bosch, N., Lapointe, D., Ennis, F. A., Rothman, A. L., Bosch, I.
(2003). Dengue Virus Induces Novel Changes in Gene Expression of Human Umbilical Vein Endothelial Cells. J. Virol.
77: 11822-11832
[Abstract]
[Full Text]
-
Payne, T. M., Molestina, R. E., Sinai, A. P.
(2003). Inhibition of caspase activation and a requirement for NF-{kappa}B function in the Toxoplasma gondii-mediated blockade of host apoptosis. J. Cell Sci.
116: 4345-4358
[Abstract]
[Full Text]
-
Krajewska, M., Krajewski, S., Banares, S., Huang, X., Turner, B., Bubendorf, L., Kallioniemi, O.-P., Shabaik, A., Vitiello, A., Peehl, D., Gao, G.-J., Reed, J. C.
(2003). Elevated Expression of Inhibitor of Apoptosis Proteins in Prostate Cancer. Clin. Cancer Res.
9: 4914-4925
[Abstract]
[Full Text]
-
Ka, H., Hunt, J. S.
(2003). Temporal and Spatial Patterns of Expression of Inhibitors of Apoptosis in Human Placentas. Am. J. Pathol.
163: 413-422
[Abstract]
[Full Text]
-
Kuenzi, P., Schneider, P., Dobbelaere, D. A. E.
(2003). Theileria parva-Transformed T Cells Show Enhanced Resistance to Fas/Fas Ligand-Induced Apoptosis. J. Immunol.
171: 1224-1231
[Abstract]
[Full Text]
-
Kashkar, H., Haefs, C., Shin, H., Hamilton-Dutoit, S. J., Salvesen, G. S., Kronke, M., Jurgensmeier, J. M.
(2003). XIAP-mediated Caspase Inhibition in Hodgkin's Lymphoma-derived B Cells. JEM
198: 341-347
[Abstract]
[Full Text]
-
Bannerman, D. D., Goldblum, S. E.
(2003). Mechanisms of bacterial lipopolysaccharide-induced endothelial apoptosis. Am. J. Physiol. Lung Cell. Mol. Physiol.
284: L899-L914
[Abstract]
[Full Text]
-
Edelstein, L. C., Lagos, L., Simmons, M., Tirumalai, H., Gelinas, C.
(2003). NF-{kappa}B-Dependent Assembly of an Enhanceosome-Like Complex on the Promoter Region of Apoptosis Inhibitor Bfl-1/A1. Mol. Cell. Biol.
23: 2749-2761
[Abstract]
[Full Text]
-
Rayet, B., Fan, Y., Gelinas, C.
(2003). Mutations in the v-Rel Transactivation Domain Indicate Altered Phosphorylation and Identify a Subset of NF-{kappa}B-Regulated Cell Death Inhibitors Important for v-Rel Transforming Activity. Mol. Cell. Biol.
23: 1520-1533
[Abstract]
[Full Text]
-
Bayon, Y., Ortiz, M. A., Lopez-Hernandez, F. J., Gao, F., Karin, M., Pfahl, M., Piedrafita, F. J.
(2003). Inhibition of I{kappa}B Kinase by a New Class of Retinoid-Related Anticancer Agents That Induce Apoptosis. Mol. Cell. Biol.
23: 1061-1074
[Abstract]
[Full Text]
-
Xiao, C. W., Yan, X., Li, Y., Reddy, S. A. G., Tsang, B. K.
(2003). Resistance of Human Ovarian Cancer Cells to Tumor Necrosis Factor {alpha} Is a Consequence of Nuclear Factor {kappa}B-Mediated Induction of Fas-Associated Death Domain-Like Interleukin-1{beta}-Converting Enzyme-Like Inhibitory Protein. Endocrinology
144: 623-630
[Abstract]
[Full Text]
-
Lavon, I., Pikarsky, E., Gutkovich, E., Goldberg, I., Bar, J., Oren, M., Ben-Neriah, Y.
(2003). Nuclear Factor-{kappa}B Protects the Liver against Genotoxic Stress and Functions Independently of p53. Cancer Res.
63: 25-30
[Abstract]
[Full Text]
-
Scaife, C. L., Kuang, J., Wills, J. C., Trowbridge, D. B., Gray, P., Manning, B. M., Eichwald, E. J., Daynes, R. A., Kuwada, S. K.
(2002). Nuclear Factor {kappa}B Inhibitors Induce Adhesion-dependent Colon Cancer Apoptosis: Implications for Metastasis. Cancer Res.
62: 6870-6878
[Abstract]
[Full Text]
-
Poulaki, V., Mitsiades, C. S., Joussen, A. M., Lappas, A., Kirchhof, B., Mitsiades, N.
(2002). Constitutive Nuclear Factor-{kappa}B Activity Is Crucial for Human Retinoblastoma Cell Viability. Am. J. Pathol.
161: 2229-2240
[Abstract]
[Full Text]
-
Munzert, G., Kirchner, D., Stobbe, H., Bergmann, L., Schmid, R. M., Dohner, H., Heimpel, H.
(2002). Tumor necrosis factor receptor-associated factor 1 gene overexpression in B-cell chronic lymphocytic leukemia: analysis of NF-kappa B/Rel-regulated inhibitors of apoptosis. Blood
100: 3749-3756
[Abstract]
[Full Text]
-
Arnt, C. R., Chiorean, M. V., Heldebrant, M. P., Gores, G. J., Kaufmann, S. H.
(2002). Synthetic Smac/DIABLO Peptides Enhance the Effects of Chemotherapeutic Agents by Binding XIAP and cIAP1 in Situ. J. Biol. Chem.
277: 44236-44243
[Abstract]
[Full Text]
-
Qin, Y., Camoretti-Mercado, B., Blokh, L., Long, C. G., Ko, F. D., Hamann, K. J.
(2002). Fas Resistance of Leukemic Eosinophils Is Due to Activation of NF-{kappa}B by Fas Ligation. J. Immunol.
169: 3536-3544
[Abstract]
[Full Text]
-
Yin, K.-j., Chen, S.-D., Lee, J.-M., Xu, J., Hsu, C. Y.
(2002). ATM Gene Regulates Oxygen-Glucose Deprivation-Induced Nuclear Factor-{kappa}B DNA-Binding Activity and Downstream Apoptotic Cascade in Mouse Cerebrovascular Endothelial Cells. Stroke
33: 2471-2477
[Abstract]
[Full Text]
-
You, Z., Madrid, L. V., Saims, D., Sedivy, J., Wang, C.-Y.
(2002). c-Myc Sensitizes Cells to Tumor Necrosis Factor-mediated Apoptosis by Inhibiting Nuclear Factor kappa B Transactivation. J. Biol. Chem.
277: 36671-36677
[Abstract]
[Full Text]
-
Hull, C., McLean, G., Wong, F., Duriez, P. J., Karsan, A.
(2002). Lipopolysaccharide Signals an Endothelial Apoptosis Pathway Through TNF Receptor-Associated Factor 6-Mediated Activation of c-Jun NH2-Terminal Kinase. J. Immunol.
169: 2611-2618
[Abstract]
[Full Text]
-
Mori, N., Yamada, Y., Ikeda, S., Yamasaki, Y., Tsukasaki, K., Tanaka, Y., Tomonaga, M., Yamamoto, N., Fujii, M.
(2002). Bay 11-7082 inhibits transcription factor NF-kappa B and induces apoptosis of HTLV-I-infected T-cell lines and primary adult T-cell leukemia cells. Blood
100: 1828-1834
[Abstract]
[Full Text]
-
Poulaki, V., Mitsiades, C. S., Kotoula, V., Tseleni-Balafouta, S., Ashkenazi, A., Koutras, D. A., Mitsiades, N.
(2002). Regulation of Apo2L/Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Induced Apoptosis in Thyroid Carcinoma Cells. Am. J. Pathol.
161: 643-654
[Abstract]
[Full Text]
-
Wang, Y., Chan, S., Tsang, B. K.
(2002). Involvement of Inhibitory Nuclear Factor-{kappa}B (NF{kappa}B)-Independent NF{kappa}B Activation in the Gonadotropic Regulation of X-Linked Inhibitor of Apoptosis Expression during Ovarian Follicular Development in Vitro. Endocrinology
143: 2732-2740
[Abstract]
[Full Text]
-
Ferreira, C. G., Epping, M., Kruyt, F. A. E., Giaccone, G.
(2002). Apoptosis: Target of Cancer Therapy. Clin. Cancer Res.
8: 2024-2034
[Abstract]
[Full Text]
-
Werner, A. B., de Vries, E., Tait, S. W. G., Bontjer, I., Borst, J.
(2002). Bcl-2 Family Member Bfl-1/A1 Sequesters Truncated Bid to Inhibit Its Collaboration with Pro-apoptotic Bak or Bax. J. Biol. Chem.
277: 22781-22788
[Abstract]
[Full Text]
-
Sugita, S., Kohno, T., Yamamoto, K., Imaizumi, Y., Nakajima, H., Ishimaru, T., Matsuyama, T.
(2002). Induction of Macrophage-Inflammatory Protein-3{alpha} Gene Expression by TNF-Dependent NF-{kappa}B Activation. J. Immunol.
168: 5621-5628
[Abstract]
[Full Text]