|
|
|
|
|
|
|
||
Articles |
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Naive CD4+ T cells develop into either of two major subsets of Ths that produce distinct sets of cytokines. Th1s generally produce IFN-
IL-4 is the major determinant of the differentiation of antigen-stimulated naive cluster of differentiation (CD)14+ T cells into Th2s (5–8). IL-4 mediates its functions through binding to and stimulation of the IL-4R. The IL-4R consists of the IL-4R
Mice deficient in IL-4R
Th1s and Th2s differ from one another in several important respects. For example, Th1s not only fail to produce IL-4 when stimulated, but cannot support the transcription of transfected reporter genes under the control of the IL-4 promoter (36–39). It has recently been demonstrated that they fail to express c-maf, a transcription factor that binds to the IL-4 promoter (40). Transfection of Th1 lines with c-maf allows them to transcribe reporter genes under the control of the IL-4 promoter. This transcription is further enhanced by the cotransfection of the cDNA for NIP-45, a protein that interacts with nuclear factor of activated T cells (41). Furthermore, Th1s fail to express GATA-3, which is expressed in naive and in Th2s (42). GATA-3 transgenic mice primed under Th1 conditions (in the absence of IL-4) can develop into cells capable of inducing IL-4 messenger RNA (mRNA), indicating an important role for GATA-3 in the differentiation of naive cells into Th2s.
What is particularly striking is that Th1s not only fail to produce IL-4 upon challenge, but they fail to develop into IL-4–producing cells even if they are restimulated with antigen in the presence of IL-4 (43–45). These are conditions that cause the development of naive T cells into IL-4 producers. Thus, Th1s have lost the ability to induce IL-4– producing capacity. In addition, it has been reported that long-term lines of Th1s are incapable of growth in response to IL-4 despite the fact that Th1 and Th2 lines display essentially equal capacity to bind IL-4 with high affinity (46). It has been reported that these lines differ in their sensitivity to IL-1 and it has been suggested that this explains their differential sensitivity to IL-4 as a growth stimulus (47).
We wished to examine the possibility that the inability of Th1s to respond to IL-4 with the induction of IL-4–producing activity might reflect an insensitivity of these cells to IL-4. Here we show that while Th1s express amounts of IL-4R comparable to Th2s, they lose their capacity to phosphorylate Stat6 as they differentiate and that such loss is correlated with the inability of these cells to upregulate CD30 in response to IL-4 and to develop into IL-4 producers. Furthermore, we demonstrate that the level of expression of IRS-2, a principal regulator of IL-4–mediated growth, is enhanced upon development of naive cells into Th2s but not Th1s; this enhancement does not occur in cells from Stat6-deficient mice. In differentiated Th1s, IL-4 does not enhance expression of IRS-2. These results indicate that a defect in the activation of Stat6 in Th1s can explain many of the phenotypic properties of these cells.
Immunoprecipitation and Western Blot Analysis.
Reverse Transcriptase PCR.
Flow Cytometry Analysis and ELISA.
, IL-2, and TNF-
, whereas Th2s produce IL-4, IL-5, IL-10, and IL-13 (1). The polarization of responses to Th1 or Th2 dominance often determines resistance or susceptibility of hosts to infections and the degree of tissue damage in many autoimmune diseases (2–4). chain, which binds IL-4 with high affinity (9, 10), and the common gamma chain (c) (11, 12), shared by the receptors for IL-2, IL-7, IL-9, and IL-15 (11–15). Upon interaction with IL-4, the IL-4R and c-associated kinases, Janus kinase (JAK)-1 and JAK-3, are activated (16–18). Both JAK-1 and JAK-3 play critical roles in IL-4 function. Cell lines expressing JAK-1 mutations fail to phosphorylate insulin receptor substrate (IRS)-1/2) and Stat6, two of the major substrates phosphorylated in normal cells in response to IL-4 (19, 20). T cells from JAK-3–deficient mice show similar defects (21–23). chain (24) or in Stat6 (25–27), the major regulator of IL-4–mediated gene activation (28), fail to generate Th2s in vitro and show a marked diminution in the development of IL-4–producing CD4+ T cells in response to infection with Nippostrongylus brasiliensis (24, 26). Furthermore, Stat6 activation has been mainly implicated in the regulation of IL-4–mediated gene activation. Thus, Stat6-deficient mice fail to upregulate class II MHC molecules, CD23, and Thy1 in mouse B cells, and fail to support class switching to IgE. The major regulators of IL-4–mediated growth are the phosphotyrosine binding domain substrates IRS-1/IRS-2 and Shc, whose phosphorylation is determined by a domain in the IL-4 receptor distinct from that responsible for Stat6 activation (19, 29–34). However, thymocytes and B cells from Stat6-deficient mice also display diminished uptake of [3H] thymidine in response to IL-4–dependent stimuli (25–27). This may indicate a possible role for Stat6 in growth regulation; alternatively, a principal role of Stat6 may be the induction of factors that are critical in transmitting growth-inducing signals. Indeed, the IL-4R chain is itself upregulated by IL-4 (9, 35).
Materials and Methods
Top
Abstract
Materials and Methods
Results
Discussion
References
Animals and Cell Cultures.
B10.A mice were obtained from Jackson Laboratory (Bar Harbor, ME). Mice transgenic for TCR- and -β chains encoding a receptor specific for pigeon cytochrome C peptide 88–104 in association with the IEk class II MHC molecule were maintained in our animal quarters. Lymph node cells were depleted of CD8+ cells, B220+ cells, and IAk+ cells by negative selection using magnetic beads. The purified CD4+ cells were then centrifuged on a discontinuous 50, 60, and 70% Percoll gradient. Cells with a density of >70% were collected and used for priming (7). Primary stimulation of TCR transgenic cells was carried out by culturing 106 naive CD4+ T cells in the presence of 107 irradiated T cell–depleted spleen cells from B10.A, 1 µM pigeon cytochrome C peptide (prepared by National Institute of Allergy and Infectious Diseases Biologic Resources Branch) and IL-2 (10 U/ml) for 7 d. For differentiation of Th1s, monoclonal anti–IL-4 antibody (11B11; 10 µg/ml) and IL-12 (10 ng/ml) were also added to the culture; for the differentiation of Th2s, IL-4 (0.5 ng/ml) and anti–IL-12 antibody (R&D Systems, Inc., Minneapolis, MN) were added. In some instances, the priming culture was repeated one or two times. T and B cell–depleted APCs were prepared from splenocytes by depleting Thy 1.2 and B220 positive cells using the magnetic bead method. Stat6 knockout mice and littermate controls were provided by Dr. James Ihle (St. Jude Children's Research Hospital, Memphis, TN). These (129 x C57BL/6) mice were backcrossed to normal C57BL/6 mice.
Th1s or Th2s were washed with HBSS twice, recultured with 10 U/ml rIL-2 overnight, and then deprived of serum and cytokines for 2 h. Cells (5 x 106 ml) were stimulated with 5 ng/ml of IL-4 in complete RMPI at room temperature for 12 min. The reaction was stopped with cold PBS containing 100 µM Na3 VO4. Cells were then lysed with 0.5 ml lysis buffer (50 mM Hepes, 0.5% Nonidet P-40, 5 mM EDTA, 50 mM NaCl, 10 mM Na pyrophosphate, and 50 mM NaF) freshly supplemented with 1 mM Na3 VO4, 1 mM PMSF, and 10 µg/ml aprotinin, leupeptin, and pepstatin. Lysates were incubated with 5–10 µl antibody for 2 h on ice. Immune complexes were precipitated with protein G agarose beads (Pierce Chemical Co., Rockford, IL), eluted with SDS-PAGE loading buffer, separated in a 7.5% acrylamide gel, and transferred onto Immobilon-P membranes (Millipore, Bedford, MA), which were probed with specific antibodies (17) and visualized with an enhanced chemiluminescent detection system (Pierce Chemical Co.). Anti-Stat6 antibody was provided by Dr. James Ihle (St. Jude Children's Research Hospital, Memphis, TN), anti–JAK-3 by Dr. John O'Shea (National Institutes of Health, Bethesda, MD), and anti–IRS-2 antibody and anti–phosphotyrosine (4G10) were purchased from Upstate Biotechnology Inc. (Lake Placid, NY)
TCR transgenic Th2s were washed extensively at the end of the priming culture and recultured in IL-2 supplemented complete medium for 14 d until these cells had become small and round shaped. These well-"rested" cells (106) were then either unstimulated or stimulated with 2 x 105 irradiated T and B cell–depleted APCs, IL-2, and cytochrome C peptide with or without IL-4 (0.5 ng/ml) for 6 or 22 h. Total RNA were prepared by the guanidinium method and reverse transcribed into cDNA. PCRs were performed using IRS-2 primers (forward: TGGTGAGGCAGGTACCCGTCT; reverse: TCTGCACGGATGACCTTAGCA; reference 48) and actin primers (forward: GATGACGATATCGCTGCGCTG; reverse: GTACGACCAGAGGCATACAGG). Amplification was performed (geneAmp PCR system 9600; Perkin-Elmer Corp., Foster City, CA). The cycling conditions were 94°C for 15 s, 59°C for 15 s, and 72°C for 30 s for 35 cycles, followed by extension at 72°C for 5 min. PCR products were analyzed by electrophoresis in a 2% agarose gel.
For IL-4R staining, cells were incubated with 10% goat serum for 5 min to block nonspecific binding. M1 anti–IL-4R monoclonal antibody or a rat isotype control (Genzyme, Cambridge, MA) were added to the cells and incubated for 20 min in FACS® buffer (Becton Dickinson, Mountain View, CA; PBS/3% fetal calf serum/0.1% sodium azide). Cells then were washed with FACS® buffer. FITC-labeled goat Fab' fragment against rat IgG (Southern Biotechnology Associates, Birmingham, AL) were added to stained cells for 20 min. For CD30 staining, cells were first blocked with 10 µl of 2.4G2 rat anti–mouse FcRII/III ascitic fluid for 5 min before staining with PE-labeled monoclonal antibody against mouse CD30 (PharMingen, San Diego, CA) for 20 min in FACS® buffer. The stained cells were washed twice with FACS® buffer and analyzed in a FACScan®. IL-4 and IFN- production were measured using commercial ELISA detection kits (Endogen, Woburn, MA).
Results
Top
Abstract
Materials and Methods
Results
Discussion
References
Th1 Cells Display a Marked Diminution in IL-4–induced Stat6 and JAK-3 Phosphorylation.
We prepared dense CD4+ T cells from mice transgenic for TCR- and -β chains specific for a cytochrome C peptide in association with IEk (7). These cells were primed in vitro by culturing for two rounds of 7 d each with T cell–depleted spleen cells from B10.A mice together with 1 µM cytochrome C peptide and IL-2. To generate Th1s, we added monoclonal anti– IL-4 antibody and IL-12; to generate Th2s, we added IL-4 and anti–IL-12 antibody. Extracts prepared from Th2s that had been stimulated with IL-4 for 12 min were immunoprecipitated with anti-Stat6. When analyzed by SDS-PAGE and Western blotting with antiphosphotyrosine, we observed striking tyrosine phosphorylation of Stat6. By contrast, immunoprecipitates of extracts from IL-4–stimulated Th1s showed no detectable Stat6 phosphorylation. Western blots with anti-Stat6 antibody revealed comparable amounts of Stat6 in both Th1s and Th2s (Fig. 1 A).
|
IL-4–induced phosphorylation of JAK-3 was also diminished in "two-round" primed Th1s (Fig. 1 A). The relative degree of phosphorylation of JAK-3 in Th1s was reduced by 
3.7-fold compared to Th2s. The amount of JAK-3 protein in Th1s was no different than the amount in comparably primed Th2s. The diminution in IL-4–induced JAK-3 phosphorylation in Th1s did not reflect a generalized inactivation of this kinase or of the c chain in Th1s since IL-2 caused striking phosphorylation of JAK-3 in these cells (Fig. 1 A). This is particularly important since IL-2 signaling, like IL-4 signaling, uses both JAK-1 and JAK-3.
Th1s and Th2s Have Comparable Numbers of IL-4Rs.
The defect that Th1s show in IL-4–induced signaling could not be explained by the failure of these cells to express IL-4Rs. Two-round–primed Th1s and Th2s from transgenic donors displayed comparable numbers of IL-4Rs as demonstrated by flow cytometric analysis with the anti–mouse IL-4R antibody M1; the specificity and high affinity binding of IL-4 was established by the capacity of IL-4 (1.1 x 10–10M) to inhibit binding by both cell types (Fig. 2 A). Indeed, in four independent experiments, the relative degree of expression of IL-4Rs by Th1s was 1.01 ± 0.14 that of Th2s (Fig. 2 B). In contrast to naive T cells, IL-4 does not further upregulate IL-4R expression in recently primed Th1s or Th2s (data not shown).
|
|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
c chain. In light of the recent discovery of a new family of cytokine-induced JAK/STAT inhibitors (50–53), it is conceivable that during the development of Th1s one or more such inhibitors are induced and prevent JAK-3/Stat6–dependent IL-4–mediated signaling in these cells. However, we have not observed any difference in levels of expression of mRNA for SOCS 2 (suppressor of cytokine signaling 2) in Th1s and Th2s; we could not detect expression of SOCS 1 or 3 in Th1s or Th2s, although we could detect these mRNAs in bone marrow cells treated with IFN- and IL-3 for 1 h (Huang, H., unpublished data). It is also striking that IL-4 regulates the level of expression of IRS-2 in recently differentiated Ths. Naive T cells display very low levels of IRS-2 protein and mRNA. Initial stimulation with antigen and APC causes a transient induction of IRS-2, which is only sustained in the presence of IL-4. Thus, Th1s that have been stimulated through two rounds of priming display little or no IRS-2, whereas Th2s that have been primed for two rounds show substantial amounts of IRS-2 and vigorous phosphorylation in response to IL-4 stimulation.
The diminished sensitivity of Th1s to IL-4–mediated signaling may explain the failure of upregulation of IRS-2 in these cells. The regulation of IRS-2 expression by IL-4 and particularly the failure of Stat6 knockout cells to show such a response might also explain the diminished IL-4– stimulated growth of thymocytes from Stat6-deficient mice (25–27). These cells should fail to respond to IL-4 with enhanced expression of IRS-2 and IL-4Rs, since both are controlled by the IL-4/Stat6 signaling pathway; low levels of both IL-4R and IRS-2 might then limit IL-4 induced growth.
Kubo et al. (54) have recently reported that a Th1 T cell clone and a hybridoma with a Th1 phenotype failed to phosphorylate Stat6 in response to IL-4. Thus, the lack of IL-4–mediated signaling by Th1 cells is likely to be a very stable property of these cells. Kubo et al. (53) argue that Th1s fail to secrete IL-4 because of a silencer element located 3' of exon 4 of the IL-4 gene that contains a Stat6-binding site. They further argue that Stat6 binding to this site inactivates the silencer element and thus allows IL-4 to be made in response to phorbol ester and ionomycin stimulation. Thus, the failure of Th1s to produce IL-4 is explained by the lack of activated Stat6 in these cells, whereas the capacity of Th2s to secrete IL-4 depends upon the activation of Stat6 and the consequent blocking of silencer function. Although this concept has attractive features, our previous results (55) have shown that once naive T cells have been differentiated into Th2s, IL-4 is no longer required for the production of IL-4 or other Th2 cytokines by these cells. Thus, Th2s stimulated with antigen and APC produce IL-4 mRNA in the presence of neutralizing concentrations of anti–IL-4 or anti–IL-4R antibody. Furthermore, IL-4 does not enhance IL-4 production by these cells even when limiting concentrations of antigen are used for stimulation. Finally, Th2s prepared from IL-4 knockout mice produce normal amounts of IL-13 mRNA in response to stimulation with anti-CD3; IL-4 does not enhance production of IL-13 by these differentiated Th2s.
Our results, indicating a failure of recently differentiated Th1s to phosphorylate Stat6, and those of Kubo et al. (53) describing absent Stat6 phosphorylation in a Th1 clone and a Th1 hybridoma, contrast with results that have been described showing that extracts from IL-4–stimulated Th1s can form complexes with a gamma-activated sequence (GAS) element as detected by electrophoretic mobility shift analysis (EMSA). Szabo et al. (56) and Lederer et al. (57) observed an IL-4–inducible EMSA in cultures that had been differentiated in the Th1 direction for one round of stimulation; cells from such cultures retained the capacity to develop IL-4–producing activity if cultured for an additional 4–7 d with antigen and IL-4. Indeed, it was subsequently demonstrated that cells that had been primed in the Th1 direction for several rounds lost the capacity to develop into IL-4–producing cells (43), consistent with our observation that IL-4–induced phosphorylation of Stat6 is often not extinguished until cells have undergone two rounds of Th1 priming. Pernis et al. (58) reported that in a Th1 clone (AE.7), IL-4 induced a factor (then designated STF–IL-4) that formed a complex with the GAS element from FcR1. The significance of this finding remains to be evaluated further. This could be explained by differences among individual long-term Th1-like clones and recently differentiated Th1s. Alternatively, the IL-4R may retain some signaling properties in Th1s that nonetheless do not allow full activation of Stat6. Indeed, EMSA often reveals that IL-4 induces multiple bands containing the GAS element, only one of which is supershifted by anti–Stat6 antibody.
Understanding the molecular basis of the diminished sensitivity of IL-4Rs in well-differentiated Th1s might provide interesting targets for the development of agents that could reverse the polarity of these cells. Such agents could be important in the development of strategies for treatment of tissue damaging autoimmunity or to reverse inappropriate responses to certain pathogenic agents.
|
Acknowledgments |
|---|
Submitted: 8 December 1997
1 Abbreviations used in this paper:
c, common gamma chain; CD, cluster of differentiation; EMSA, electrophoretic mobility shift assay; GAS, gamma-activated sequence; IRS, insulin receptor substrate; JAK, Janus kinase; mRNA, messenger RNA. 
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
1 Paul WE & Seder RA. Lymphocyte responses and cytokines, Cell, 1994, 76, 241–251.[Medline]
2 Abbas AK, Murphy KM & Sher A. Functional diversity of helper T lymphocytes, Nature, 1996, 383, 787–793.[Medline]
3 Romagnani S. Th1 and Th2 in human diseases, Clin Immunol Immunopathol, 1996, 80, 225–235.[Medline]
4 Reiner SL & Locksley RM. The regulation of immunity to Leishmania major. , Annu Rev Immunol, 1995, 13, 151–177.[Medline]
5 Le Gros G, Ben-Sasson SZ, Seder R, Finkelman FD & Paul WE. Generation of interleukin 4 (IL-4)–producing cells in vivo and in vitro: IL-2 and IL-4 are required for in vitro generation of IL-4–producing cells, J Exp Med, 1990, 172, 921–929.
6 Swain SL, Weinberg AD, English M & Huston G. IL-4 directs the development of Th2-like helper effectors, J Immunol, 1990, 145, 3796–3806.[Abstract]
7 Seder RA, Paul WE, Davis MM, Fazekas de St B, Groth & Groth B. The presence of interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4+T cells from T cell receptor transgenic mice, J Exp Med, 1992, 176, 1091–1098.
8 Hsieh CS, Heimberger AB, Gold JS, O'Garra A & Murphy KM. Differential regulation of T helper phenotype development by interleukins 4 and 10 in an β T-cell-receptor transgenic system, Proc Natl Acad Sci USA, 1992, 89, 6065–6069.
9 Ohara J & Paul WE. Receptors for B-cell stimulatory factor–1 expressed on cells of haematopoietic lineage, Nature, 1987, 325, 537–540.[Medline]
10 Park LS, Friend D, Sassenfeld HM & Urdal DL. Characterization of the human B cell stimulatory factor 1 receptor, J Exp Med, 1987, 166, 476–488.
11 Russell SM, Keegan AD, Harada N, Nakamura Y, Noguchi M, Leland P, Friedmann MC, Miyajima A, Puri RK, Paul WE & Leonard WJ. Interleukin-2 receptor chain: a functional component of the interleukin-4 receptor, Science, 1993, 262, 1880–1883.
12 Kondo M, Takeshita T, Ishii N, Nakamura M, Watanabe S, Arai K & Sugamura K. Sharing of the interleukin-2 (IL-2) receptor chain between receptors for IL-2 and IL-4, Science, 1993, 262, 1874–1877.
13 Noguchi M, Nakamura Y, Russell SM, Ziegler SF, Tsang M, Cao X & Leonard WJ. Interleukin-2 receptor chain: a functional component of the interleukin-7 receptor, Science, 1993, 262, 1877–1880.
14 Kimura Y, Takeshita T, Kondo M, Ishii N, Nakamura M, Van Snick J & Sugamura K. Sharing of the IL-2 receptor chain with the functional IL-9 receptor complex, Int Immunol, 1995, 7, 115–120.
15 Giri JG, Ahdieh M, Eisenman J, Shanebeck K, Grabstein K, Kumaki S, Namen A, Park LS, Cosman D & Anderson D. Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15, EMBO (Eur Mol Biol Organ) J, 1994, 13, 2822–2830.[Medline]
16 Ihle JN. The Janus protein tyrosine kinase family and its role in cytokine signaling, Adv Immunol, 1995, 60, 1–35.[Medline]
17 Johnston JA, Kawamura M, Kirken RA, Chen YQ, Blake TB, Shibuya K, Ortaldo JR, McVicar DW & O'Shea JJ. Phosphorylation and activation of the Jak-3 Janus kinase in response to interleukin-2, Nature, 1994, 370, 151–153.[Medline]
18 Witthuhn BA, Silvennoinen O, Miura O, Lai KS, Cwik C, Liu ET & Ihle JN. Involvement of the Jak-3 Janus kinase in signalling by interleukins 2 and 4 in lymphoid and myeloid cells, Nature, 1994, 370, 153–157.[Medline]
19 Wang LM, Keegan AD, Paul WE, Heidaran MA, Gutkind JS & Pierce JH. IL-4 activates a distinct signal transduction cascade from IL-3 in factor-dependent myeloid cells, EMBO (Eur Mol Biol Organ) J, 1992, 11, 4899–4908.[Medline]
20 Chen XH, Patel BK, Wang LM, Frankel M, Ellmore N, Flavell RA, LaRochelle WJ & Pierce JH. Jak1 expression is required for mediating interleukin-4–induced tyrosine phosphorylation of insulin receptor substrate and Stat6 signaling molecules, J Biol Chem, 1997, 272, 6556–6560.
21 Nosaka T, Van Deursen JM, Tripp RA, Thierfelder WE, Witthuhn BA, McMickle AP, Doherty PC, Grosveld GC & Ihle JN. Defective lymphoid development in mice lacking Jak3, Science, 1995, 270, 800–802.
22 Park SY, Saijo K, Takahashi T, Osawa M, Arase H, Hirayama N, Miyake K, Nakauchi H, Shirasawa T & Saito T. Developmental defects of lymphoid cells in Jak3 kinase–deficient mice, Immunity, 1995, 3, 771–782.[Medline]
23 Thomis DC, Gurniak CB, Tivol E, Sharpe AH & Berg LJ. Defects in B lymphocyte maturation and T lymphocyte activation in mice lacking Jak3, Science, 1995, 270, 794–797.
24 Noben-Trauth N, Shultz L, Brombacher F, Urban J, Gu H & Paul WE. An IL-4–independent pathway for CD4+T cell IL-4 production is revealed in interleukin receptor deficient mice, Proc Natl Acad Sci USA, 1997, 94, 10838–10843.
25 Kaplan MH, Schindler U, Smiley ST & Grusby MJ. Stat6 is required for mediating responses to IL-4 and for development of Th2 cells, Immunity, 1996, 4, 313–319.[Medline]
26 Takeda K, Tanaka T, Shi W, Matsumoto M, Minami M, Kashiwamura S, Nakanishi K, Yoshida N, Kishimoto T & Akira S. Essential role of Stat6 in IL-4 signalling, Nature, 1996, 380, 627–630.[Medline]
27 Shimoda K, van Deursen J, Sangster MY, Sarawar SR, Carson RT, Tripp RA, Chu C, Quelle FW, Nosaka T, Vignali DA et al.. Lack of IL-4–induced Th2 response and IgE class switching in mice with disrupted Stat6 gene, Nature, 1996, 380, 630–633.[Medline]
28 Hou J, Schindler U, Henzel WJ, Ho TC, Brasseur M & McKnight SL. An interleukin-4–induced transcription factor: IL-4 Stat, Science, 1994, 265, 1701–1706.
29 Keegan AD, Nelms K, White M, Wang LM, Pierce JH & Paul WE. An IL-4 receptor region containing an insulin receptor motif is important for IL-4–mediated IRS-1 phosphorylation and cell growth, Cell, 1994, 76, 811–820.[Medline]
30 Keegan AD & Paul WE. Multichain immune recognition receptors: similarities in structure and signaling pathways, Immunol Today, 1992, 13, 63–68.[Medline]
31 Pernis A, Witthuhn B, Keegan AD, Nelms K, Garfein E, Ihle JN, Paul WE, Pierce JH & Rothman P. Interleukin 4 signals through two related pathways, Proc Natl Acad Sci USA, 1995, 92, 7971–7975.
32 Quelle FW, Shimoda K, Thierfelder W, Fischer C, Kim A, Ruben SM, Cleveland JL, Pierce JH, Keegan AD, Nelms K & Ihle JN. Cloning of murine Stat6 and human Stat6, Stat proteins that are tyrosine phosphorylated in responses to IL-4 and IL-3 but are not required for mitogenesis, Mol Cell Biol, 1995, 15, 3336–3343.[Abstract]
33 Ryan JJ, McReynolds LJ, Keegan A, Wang LH, Garfein E, Rothman P, Nelms K & Paul WE. Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor, Immunity, 1996, 4, 123–132.[Medline]
34 Wang HY, Paul WE & Keegan AD. IL-4 function can be transferred to the IL-2 receptor by tyrosine containing sequences found in the IL-4 receptor chain, Immunity, 1996, 4, 113–121.[Medline]
35 Kotanides H & Reich NC. Interleukin-4–induced STAT6 recognizes and activates a target site in the promoter of the interleukin-4 receptor gene, J Biol Chem, 1996, 271, 25555–25561.
36 Todd MD, Grusby MJ, Lederer JA, Lacy E, Lichtman AH & Glimcher LH. Transcription of the interleukin 4 gene is regulated by multiple promoter elements, J Exp Med, 1993, 177, 1663–1674.
37 Bruhn KW, Nelms K, Boulay JL, Paul WE & Lenardo MJ. Molecular dissection of the mouse interleukin-4 promoter, Proc Natl Acad Sci USA, 1993, 90, 9707–9711.
38 Szabo SJ, Gold JS, Murphy TL & Murphy KM. Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc, Mol Cell Biol, 1993, 13, 4793–4805.
39 Tara D, Weiss DL & Brown MA. Characterization of the constitutive and inducible components of a T cell IL-4 activation responsive element, J Immunol, 1995, 154, 4592–4602.[Abstract]
40 Ho IC, Hodge MR, Rooney JW & Glimcher LH. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4, Cell, 1996, 85, 973–983.[Medline]
41 Hodge MR, Chun HJ, Rengarajan J, Alt A, Lieberson R & Glimcher LH. NF-AT-driven interleukin-4 transcription potentiated by NIP45, Science, 1996, 274, 1903–1905.
42 Zheng W & Flavell RA. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells, Cell, 1997, 89, 587–596.[Medline]
43 Murphy E, Shibuya K, Hosken N, Openshaw P, Maino V, Davis K, Murphy K & O'Garra A. Reversibility of T helper 1 and 2 populations is lost after long-term stimulation, J Exp Med, 1996, 183, 901–913.
44 Sornasse T, Larenas PV, Davis KA, deVries J & Yssel H. Differentiation and stability of T helper 1 and 2 cells derived from naive human neonatal CD4+T cells, analyzed at the single-cell level, J Exp Med, 1996, 184, 473–483.
45 Hu LJ, Huang H, Ryan J & Paul WE. In differentiated CD4+ T cells, interleukin 4 production is cytokine-autonomous, whereas interferon gamma production is cytokine-dependent, Proc Natl Acad Sci USA, 1997, 94, 3189–3194.
46 Kurt JE, Hamberg S, Ohara J, Paul WE & Abbas AK. Heterogeneity of helper/inducer T lymphocytes. I. Lymphokine production and lymphokine responsiveness, J Exp Med, 1987, 166, 1774–1787.
47 Lichtman AH, Chin J, Schmidt JA & Abbas AK. Role of interleukin 1 in the activation of T lymphocytes, Proc Natl Acad Sci USA, 1988, 85, 9699–9703.
48 Zamorano J, Wang HY, Wang LM, Pierce JH & Keegan AD. IL-4 protects cells from apoptosis via the insulin receptor substrate pathway and a second independent signaling pathway, J Immunol, 1996, 157, 4926–4934.[Abstract]
49 Nakamura T, Lee RK, Nam SY, Al-Ramadi BK, Koni PA, Bottomly K, Podack ER & Flavell RA. Reciprocal regulation of CD30 expression on CD4+T cells by IL-4 and IFN-, J Immunol, 1997, 158, 2090–2098.[Abstract]
50 Yoshimura A, Ohkubo T, Kiguchi T, Jenkins NA, Gilbert DJ, Copeland NG, Hara T & Miyajima A. A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin 3 and erythropoietin receptors, EMBO (Eur Mol Biol Organ) J, 1995, 14, 2816–2826.[Medline]
51 Endo TA, Masuhara M, Yokouchi M, Suzuki R, Sakamoto H, Mitsui K, Matsumoto A, Tanimura S, Ohtsubo M, Misawa H et al.. A new protein containing an SH2 domain that inhibits JAK kinases, Nature, 1997, 387, 921–924.[Medline]
52 Naka T, Narazaki M, Hirata M, Matsumoto T, Minamoto S, Aono A, Nishimoto N, Kajita T, Taga T, Yoshizaki K, Akira S & Kishimoto T. Structure and function of a new STAT-induced STAT inhibitor, Nature, 1997, 387, 924–929.[Medline]
53 Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA & Hilton DJ. A family of cytokine-inducible inhibitors of signalling, Nature, 1997, 387, 917–921.[Medline]
54 Kubo M, Ransom J, Webb D, Hashimoto Y, Tada T & Nakayama T. T-cell subset-specific expression of the IL-4 gene is regulated by a silencer element and STAT6, EMBO (Eur Mol Biol Organ) J, 1997, 16, 4007–4020.[Medline]
55 Huang H, Hu-Li J, Chen H, Ben-Sasson SZ & Paul WE. IL-4 and IL-13 production in differentiated Th2 cells is not IL-4 dependent, J Immunol, 1997, 159, 3731–3738.[Abstract]
56 Szabo SJ, Jacobson NG, Dighe AS, Gubler U & Murphy KM. Developmental commitment to the Th2 lineage by extinction of IL-12 signaling, Immunity, 1995, 2, 665–675.[Medline]
57 Lederer J A, Perez VL, DesRoches L, Kim SM, Abbas AK & Lichtman AH. Cytokine transcriptional events during helper T cell subset differentiation, J Exp Med, 1996, 184, 397–406.
58 Pernis A, Gupta S, Gollob KJ, Garfein E, Coffman R, Schindler C & Rothman P. Lack of interferon receptor β chain and the prevention of interferon signaling in TH1 cells, Science, 1995, 269, 245–247.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
