|
||
By
§
§
From the * Department of Immunology, University of Birmingham Medical School, Birmingham B15 2TT
United Kingdom; the The respective production of specific immunoglobulin (Ig)G2a or IgG1 within 5 d of primary
immunization with Swiss type mouse mammary tumor virus [MMTV(SW)] or haptenated
protein provides a model for the development of T helper 1 (Th1) and Th2 responses. The antibody-producing cells arise from cognate T cell B cell interaction, revealed by the respective
induction of C The addition of killed Bordetella pertussis to the hapten-protein induces nonhapten-specific
IgG2a and IgG1 plasma cells, whereas the anti-hapten response continues to be IgG1 dominated. This indicates that a Th2 response to hapten-protein can proceed in a node where there
is substantial Th1 activity.
After infection with pathogens such as Leishmania, Listeria, mycobacteria, or helminths, the T cell response is
strongly polarized into either Th1 or Th2 type cytokine secretion; in other responses, however, T cells producing
mixed patterns of cytokines are observed (for review see
references 1). In mice, IFN- Ig isotype switching is heralded by the production of
switch (germline) transcripts of the CH region. These start
from an I exon upstream of the appropriate switch region
and proceed into the constant region (for review see reference 17). It has been shown that expression of switch transcripts in vivo is essential for Ig class switching (18),
although this is not necessarily sufficient (23).
In a previous study the sites of immunoglobulin class
switching were assessed during secondary immune responses to hapten-protein conjugates in the spleen (24).
Within 12 h of secondary challenge, antigen-specific memory B cells migrate to the T zones, interact with memory T
cells, and start to produce C Recently, we have described the primary lymph node
response of BALB/c mice to footpad injection with either
haptenated protein (4-hydroxy-3-nitrophenyl)acetyl chicken
Mice and Immunizations.
Ludwig Institute for Cancer Research,
![]()
Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
2a and C
1 switch transcript production, on the third day after immunization. T cell proliferation and upregulation of mRNA for interferon
in response to MMTV(SW)
and interleukin 4 in response to haptenated protein also starts during this day. It follows that
there is minimal delay in these responses between T cell priming and the onset of cognate interaction between T and B cells leading to class switching and exponential growth. The Th1 or
Th2 profile is at least partially established at the time of the first cognate T cell interaction with
B cells in the T zone.
![]()
Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
and IL-4 are characteristic
of secretions in Th1 and Th2 responses, respectively (5).
IL-4 classically induces sequential switching to IgG1 and
then to IgE (6), whereas IFN-
is associated with
switching to IgG2a (9). The relative amounts of the different antibody isotypes is governed by signals that control Ig
class switch recombination (10, 11). During T cell-dependent antibody responses, switching is heavily dependent
upon CD40 ligation (12). Although sustained CD40
ligation in vitro has been reported to induce class switching by itself (16), cytokines influence extent of switching and the class of antibody produced (5).
1 switch transcript. Although
these transcripts have also been shown to be produced during the germinal center reaction (25), our studies indicate that the amount of C
1 switch transcript recovered per antigen-specific germinal center B cell is <1% of that during
the cognate interaction between T and B cells in the T
zone (24).
globulin (NP-CGG)1 or Swiss type mouse mammary tumor virus [MMTV(SW)] (26). MMTV(SW) induces both
a polyclonal and envelope-specific superantigen-dependent antibody response (27, for review see reference 28). Superantigen-specific T cells start to show signs of activation
within 65 h of virus injection (29). T cell proliferation also
starts on the third day after immunization in the response to
NP-CGG; in both responses this proliferation occurs first
in association with interdigitating dendritic cells. This is
followed, with minimal delay, by cognate interaction of T
cells with B cells and subsequent exponential growth of B
cells in the medullary cords (26). Ig class switching in the
MMTV(SW) response is predominantly to IgG2a (30, 31); similar early IgG2a production has been seen in response to
other viruses (32). In contrast, switching in the response to
NP-CGG and similar hapten-protein conjugates is mainly
to IgG1 (33). In this study the stage of lymphocyte activation is compared with the relative amounts of C
1 and
C
2a switch transcript and IL-4 and IFN-
mRNA produced
in lymph nodes during the responses to MMTV(SW) and
NP-CGG. The findings confirm the earlier observation that Th2 cytokine profiles are established at an early stage
during immune responses to protein antigens (36). This
study indicates that Th1 and Th2 cytokine profiles start to
be established during T cell priming and that immunoglobulin class switching starts when virgin B cells that have
taken up antigen make cognate interaction with primed T
cells in the outer T zone.
![]()
Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Tissue Preparation.
Mice were killed by CO2 asphyxiation and draining popliteal lymph nodes and spleens were removed. The lymph nodes were put on aluminum foil in a defined orientation, embedded in OCT compound (Miles Inc., Kankakee, IL), and frozen by sequential dipping in liquid N2. Spleens were put on aluminum foil and snap-frozen by sequential dipping in liquid N2. Tissues were stored in sealed polythene bags at -70°C until use. 5-µm cryostat sections of the tissue were mounted on four-spot glass slides for immunohistology. After cutting the first eight sections, which were used for immunohistology, one 5-µm section of spleen or three 24-µm sections of lymph node were cut, placed in a polypropylene microfuge tube, and stored at -70°C for mRNA extraction. The glass-mounted sections were air dried for 1 h and then fixed in acetone at 4°C for 20 min. They were again dried for 10 min before sealing in polythene bags and were stored at -20°C until used.Immunohistological Staining.
Immunohistological reagents and staining was as described earlier (26). Tissue sections were triple stained for CD3 with IgD and BrdU, double stained for MHC II or syndecan-1 together with BrdU, or double stained for NP-specific cells together with IgM, IgG1, or IgG2a. Additional antibodies used were rat mAbs anti-IgM (LO-MM-9), anti-IgG1 (LO-MG1-2), and anti-IgG2a (LO-MG2a-3; all from Serotec Ltd., Kidlington, Oxford, UK). The primary rat antibodies were detected using biotinylated rabbit anti-rat Ig (Dako Ltd., High Wycombe, UK). NP-binding cells were detected with NP conjugated to sheep anti-human IL-2 IgG (The Binding Site, Birmingham, UK). This antiserum does not react unspecifically with cells of unimmunized mouse lymph nodes (see Fig. 5) or lymph nodes immunized with an unrelated antigen (data not shown). Sheep IgG was detected using biotinylated rabbit anti-goat Ig (Dako Ltd.).
|
areas within the IgD+ follicles as described in Toellner et al. (24).
Semiquantitative Reverse Transcriptase-PCR.
Lymph node sections were allocated random numbers before cDNA preparation and PCR to avoid systematic errors or bias. cDNA from tissues was prepared as previously described (24). cDNAs were diluted to 100 µl with H2O and stored at 4°C. Mouse
-actin-specific primer sequences were obtained from Stratagene (Cambridge,
UK). IL-4- and IFN-
-specific primers were as described by
Svetic et al. (37). Other intron-spanning primers were designed
using OLIGO version 5.0 (National Biosciences, Plymouth,
MA). C
1 switch transcript-specific primers were (CCTCCTAGACAAGCACAGGCATGTAGA) and (ACCATGGAGTTAGTTTGGGCAGCAG) specific for the first exon of C
1 switch
transcript and the first exon of C
1 constant region (these data are
available from GenBank/EMBL/DDBJ under accession numbers
M12389 and J00453). Primers specific for C
2a switch transcript
were (GTGCCTACCTGCAGCCTGGGAT) located in exon 1 upstream of the first splice site of the C
2a switch transcript (39) and (CACTGACCACCCGGAGAGTACTGTTG) located in
the C
2a constant region (these data are available from GenBank/EMBL/DDBJ under accession number J00470). Primers
were synthesized by Life Technologies (Paisley, UK).
To quantitate cDNAs by Southern blot analysis, ~10 fewer
cycles than would be required to detect the PCR product using
ethidium bromide gels were done, this was determined in preliminary experiments. For each cDNA sample three amplifications at
different cycle numbers were made to improve precision and
check that amplification was logarithmic in the range of cycle
numbers used. PCR was performed with 2 µl cDNA template in
20 µl vol. For amplification of
-actin and C
1 switch transcript
0.1 µl Taq-Polymerase (Promega Corp., Madison, WI) per reaction was mixed with TaqStart antibody (CLONTECH Laboratories, Inc., Palo Alto, CA) 1:1 5 min before use. All other cDNAs
were amplified using 0.1 µl AmpliTaq Gold (Perkin Elmer, Langen, Germany) per reaction. Buffers were used as supplied with the enzymes, plus 1 µM of each primer, 200 µM of each dNTP
and 2.0 mM MgCl2 for C
1 switch transcript, 2.75 mM MgCl2
for C
2a switch transcript, or 1.5 mM MgCl2 for the other cDNAs.
The reaction mix was overlaid with one drop of mineral oil
(Sigma Chemical Co., Poole, England). The three PCRs were
performed in 0.2-ml 96-well polypropylene plates in the three
blocks of a Touch Down thermal cycler (Hybaid, Middlesex,
UK). Cycling was done with an initial denaturation step of 2 min
for Taq-Polymerase or 9 min for AmpliTaq Gold, followed by 30 s
at 94°C, 30 s at annealing temperature (60°C for
-actin, 65°C
for switch transcripts, and 50°C for cytokine mRNA) and 2 min
plus 2 s for every cycle at 72°C (3 min for C
2a switch transcript). Cycle numbers were 16 ± 2 for
-actin, 24 ± 2 for both
switch transcript, 28 ± 2 for IL-4 mRNA and 31 ± 2 for IFN-
mRNA. The PCR product was separated on a 1.5% agarose gel
and transferred onto a prewetted Hybond-N+ membrane (Amersham International, Little Chalfont, UK) by capillary transfer
under alkaline conditions (40). The membrane was hybridized with a 32P-labeled purified PCR product from an earlier PCR as
a probe as described earlier (24) and imaged using a PhosphorImager (Molecular Dynamics, Kent, UK).
Using the ImageQuant software (Molecular Dynamics) a grid
was laid over the PCR bands, with individual fields covering the central 50% of a band. The signal in each field was calculated and
these figures transferred to a spreadsheet software to sort the randomized figures to the correct order. The average of the three
PCRs with different cycle number for each gene was taken and
divided by the average of the three corresponding
-actin PCRs.
These values are equivalent to the relative amount of mRNA for
a gene per cell. This was multiplied with the section area, determined by microscopy on adjacent sections using the point counting technique (41), to give the mRNA amount per section.
PCR specific for
-actin, C
1 switch transcript, IL-4, and
IFN-
mRNA resulted in single bands and PCR for C
2a switch
transcript in three bands of the expected size (39). Identity of the
PCR products was confirmed by DNA sequencing (Alta Biosciences, Birmingham, UK), using the PCR primers as sequencing primers. The data were controlled for any signs of saturation
of the PCR reaction between different cycle numbers. This was
done by plotting PCR data from the three PCRs for a particular
gene and checking for variations in the efficiency of the PCR
amplification over different cycle numbers in samples containing
a high amount of target cDNA with samples having low content
of target cDNA. The amplification was shown to be logarithmic
within the range of cycle numbers used.
| |
Results |
|---|
|
|
|---|
The background level of T and B cell proliferation in popliteal lymph nodes from the isolator bred and maintained mice studied was low (Figs. 1 A and 2). The onset of T cell priming in the popliteal lymph node response to footpad injection with MMTV(SW) or NP-CGG was assessed by the time when T cell proliferation was first noted in the T zone. The data shown in Fig. 2 confirm our previously published observation (26) that in the response to MMTV(SW) and to alum-precipitated NP-CGG given with B. pertussis T cell proliferation starts during the third day after immunization. In that paper flow cytometry studies of lymph node cells in the response to MMTV showed some 60,000 CD4+ T cells in cell cycle per lymph node on day 3 and twice this on day 5. After this there was a dramatic fall in the number of proliferating cells. In the NP-CGG response 20,000 CD4+ T cells were in cell cycle on day 3 and 60,000 on day 5. After this T cell proliferation stopped in the T zone but some continued in germinal centers. This switch from T zone to follicular T cell proliferation, which coincides with the onset of antibody production, is documented in detail in Gulbranson-Judge et al. (42). In the absence of B. pertussis the start of the T cell response to NP-CGG was more variable (Fig. 2); strong T cell proliferation was present in 2 out of 5 animals after 3 d, it was well established in all animals by 5 d.
|
|
|
Very few plasma cells or plasmablasts (Figs. 1 A and 3) were present in the popliteal lymph nodes of nonimmunized control mice. In all responses local plasma cell production was associated with exponential growth of antigen-specific B blasts in the medullary cords. These blasts were most apparent 5 d after immunization (Fig. 3); at this stage the commitment of B cells to differentiation to plasma cells was already apparent by their expression of syndecan-1 and specific IgM and IgG antibody is detectable in the serum (26). By 8 d many of these cells had come out of cell cycle and had become fully differentiated plasma cells, which filled the distended medullary cords (Fig. 1 B). Again the response in animals immunized with protein without adjuvant was slightly delayed (Fig. 3).
|
The response to MMTV(SW) is associated with a bias to IgG2a production with four to fives times more IgG2a than IgG1 plasma cells (Fig. 4). In the response to NP-CGG alone switching was almost exclusively to IgG1 (Fig. 4). When B. pertussis was added to NP-CGG the amount of IgG1 increased and substantial numbers of IgG2a were produced (Fig. 4). Control immunizations with B. pertussis alone showed relatively little IgG1 production, but numbers of IgG2a plasma cells equivalent to those seen in mice immunized with NP-CGG with B. pertussis (Fig. 4). Whereas 23-60% of the NP-specific cells were IgG1+ on d 5 of the response to NP-CGG with B. pertussis, only 0.2- 1.8% of the NP-specific cells had switched to IgG2a (Table 1). By day 8 the respective ranges were 80-95% for IgG1 and 0.4-10.6% for IgG2a (Fig. 1, C and D). Thus, factors inducing non-NP-specific plasma cells to switch to IgG2a were only affecting small numbers of the NP-specific cells activated in the same node.
|
In the response to NP-CGG, antigen-specific B cells and plasma cells were detected and the relative numbers of IgG and IgM NP-specific plasma cells were assessed (Fig. 5). By day 5 up to 40% of the cells containing NP-specific antibody had switched in the responses to NP-CGG with or without B. pertussis. There was a further increase in the number of switched NP-specific plasma cells with 95% of these being switched in the response with B. pertussis.
Switch Transcript Production, Like T Cell Proliferation, Starts During the Third Day After Immunization. Semiquantitative
values for the amount of C
1 switch transcript and C
2a
produced in mouse popliteal lymph nodes at intervals after
immunization are shown in Fig. 6. Switch transcripts were already easily detectable 3 d after primary immunization
and correspond to the immunoglobulin isotype profile of
plasmablasts that are seen two days later (Fig. 4). At this
stage, in the response to NP-CGG plus B. pertussis, NP-specific B cells were identifiable in the T zone. These
amounted to <10 cells per section (Fig. 5). The number of
nonswitched NP-specific cells increased ~50-fold over the
next 2 d through exponential growth in the medullary cords. This growth is reflected in the appearance and increase in proliferating syndecan+ cells. These increase some
20-fold between day 3 and 5 in the response to NP-CGG
with B. pertussis (Fig. 3 and reference 26). Importantly the
level of C
1 or C
2a switch transcripts less than doubles
over that period (Fig. 6), indicating that the main production of switch transcripts is at the time of cognate B cell T
cell interaction as opposed to the period of B cell growth in
the medullary cords. Three of the five mice given alum-precipitated NP-CGG without B. pertussis did not show T
cell proliferation 72 h after immunization; C
1 switch
transcript in these mice was at background levels. On the
other hand, in the two mice where T cell proliferation in
the T zone had started switch transcript production was apparent. A consistent finding is that switch transcript levels
only rise above background levels in nodes where T cell
proliferation has already started. Equally no mice were
found where T cell proliferation had started in the absence
of detectable switch transcript levels. These two processes
evidently start well within 24 h of each other.
|
IL-4 message was
upregulated from the day T cell proliferation was first
noted in nodes draining the site of immunization with
alum-precipitated NP-CGG with or without B. pertussis
(Fig. 7). By contrast IL-4 message increased later and to a
lesser extent in the nodes draining the site of MMTV(SW)
injection. This correlated with relatively modest production of C
1 switch transcript in this response.
|
The upregulation of IFN-
message was less impressive
than that for IL-4. Nevertheless significant elevation of
IFN-
message occurred in the responses associated with
switching to IgG2a, MMTV(SW) and NP-CGG with B. pertussis. By contrast in the response to NP-CGG alone
where IgG2a plasma cells did not appear IFN-
message
levels remained in the control range. The time of upregulation of cytokine message is sufficiently early in the response
to be consistent with the concept that Ig class switching is
induced by cognate T cell interaction in the T zone and is
influenced by the production of these cytokines at that
stage.
Developing germinal centers were identifiable by day 5 in the NP-CGG responses but their development was delayed by some days in the MMTV(SW) response (Fig. 8). In all groups the germinal center size at d 16 was similar to or greater than that at d 8. The onset of switch transcript production antedates germinal center formation and the time when centrocytes are selected in germinal centers. Nevertheless the persistence of switch transcripts through day 16 suggests that there is continued switching in germinal centers.
|
Footpad immunization with B. pertussis alone induced C
2a switch transcripts (Fig. 6) and
IFN-
mRNA (Fig. 7) at the times and levels comparable
to those induced by immunization with NP-CGG plus B. pertussis. Mice immunized with B. pertussis alone showed some increase in C
1 switch transcript levels and IL-4
mRNA levels on d 5, but no significant increase above
background of either of these on d 3 (Fig. 6 and 7).
Spleens taken 3 and 5 d after footpad immunization with
MMTV(SW) and NP-CGG with B. pertussis were analyzed
for NP-specific cells, switch transcripts, and cytokine
mRNA. NP-specific cells B cell numbers in the spleen did
not increase above the extremely low levels seen in nonimmunized mice and were also not found in the popliteal
lymph node draining the site of MMTV(SW) injection (data not shown). Levels of C
1 and C
2a switch transcript
and IFN-
and IL-4 message from the d 3 and 5 spleens of
these isolator reared mice remained in the range seen in
nonimmunized mice (data not shown).
| |
Discussion |
|---|
|
|
|---|
The time when the Th1 and Th2 cytokine profiles, respectively, start to develop in response to MMTV(SW) and
NP-CGG has been determined by assessing the time when
IL-4 and IFN-
message increases in primary immune responses. This occurs during the third day after immunization when T cells first start to proliferate in association with
interdigitating dendritic cells (26). Cognate interaction between T and B cells leading to B cell growth and the production of switch transcripts occurs on the same day, presumably shortly after the onset of T cell priming. The
functional significance of the switch transcripts observed is
indicated by the development of switched plasmablasts by
day 5 after immunization. In the response to NP-CGG it is
theoretically possible that T cell priming started before the
onset of a detectable increase in T cell proliferation. This
could apply if the number of antigen-reactive T cells initially was very low. This reservation does not apply to the
response to MMTV(SW) where 10% of T cells are superantigen-reactive through their expression of V
6 (26). The
availability of so many antigen-specific T cells allows the
timing of the onset of the priming process to be predicted
with confidence.
The different switch transcript and cytokine profiles that
appear during the responses to MMTV(SW), NP-CGG
with B. pertussis and NP-CGG alone indicate that Th1 and
Th2 characteristics start to develop as T cells are primed or
very shortly after this. These observations indicate that Th1
or Th2 characteristics can be exhibited by cells that have
not gone through an uncommitted Th0 phase of proliferation with the production of both IL-4 and IFN-
(43, 44).
The Th cells functioning early in the primary response may
undergo subsequent alteration, but as the Th1 and Th2 cytokines are self-reinforcing (44) the initial pattern is likely
to have an important impact on the way a response becomes established.
Studies of the primary responses in lymph nodes to KLH
have reported the early development of Th2 cells. Upregulation of IL-4 mRNA was noted on the third day after immunization and IL-4 producing cells could be cultured
from this time (36, 37). In a recent study, Nakamura et al.
(45) reported that naïve T cells cultured with Con A initially upregulate both IFN-
and IL-4 message, but when
IL-4 is present in the culture the IL-4 message was selectively retained while the IFN-
message is lost within 48 h.
The converse is the case when IL-12 is added to cultures.
The move to IL-4 production has been associated with
continued expression of the transcription factor GATA-3
while this is not expressed in Th1 cells (46). It would be of
interest to assess the expression of this transcription factor
in T cells proliferating in the T zone on the third day of the
test responses analyzed in this study.
The early differentiation of Th1 and Th2 characteristics
raises the possibility that this behavior initially is established by signals delivered by the interdigitating dendritic cells in the T zone and that their precursor Langerhans cells in turn
acquire the ability to deliver these signals in the site where
they are induced to take up and process antigen. Thus, tissue Langerhans cells are induced to take up and process antigen following local tissue injury (47); LPS, IL-1, and
TNF-
induce this behavior and the migration of the activated cells to lymphoid tissues (48, 49). The perturbation
that leads to the activation of Langerhans cells may also induce local cytokine production that influences the way differentiation to interdigitating dendritic cells occurs. Mast
cells may release IL-4 after mechanical disruption or C3a- or IgE-induced degranulation, CGG might have induced
complement fixation and IFN-
may be released by a
range of cells including NK cells.
De Smedt et al. (50) found that interdigitating dendritic
cells induced to differentiate from Langerhans cells in the
presence of IL-10 failed to prime T cells to differentiate
into Th2 cells. Differential CD80 and CD86 induction during
Langerhans cell maturation has been described under the
influence of Th1 and Th2 cytokines (51). Both CD80 and
CD86 were found to be upregulated in the presence of IL-4;
CD80 was seen to be downregulated by IL-10 or IFN-
and
CD86 expression reduced by IL-10 but not IFN-
. The level
of IL-12 produced and released by IDC may also be influenced by the conditions of Langerhans cell activation (52).
Cells other than interdigitating dendritic cells that might
influence the very early differentiation of Th cells in primary responses include bystander CD4 or CD8 T cells, NK
cells, NK1.1 T cells, B cells, macrophages, or mast cells. In
the response to Leishmania major V
4V
8-expressing CD4
T cells produce large amounts of IL-4 within 90 min of injection of LACK protein or after infection in susceptible
but not resistant mice (53). Staphylococcal enterotoxin superantigens have been found to activate CD8 T cells expressing the appropriate V
despite the association of the superantigen with MHC class II molecules (54, 55). This
stimulation would be likely to induce IFN-
release, but in
MMTV(SW) infection the superantigen has not been seen
to activate V
6-expressing CD8 T cells (28, 29).
The finding that B. pertussis induces a substantial level of switching to IgG2a without markedly deviating the overwhelming IgG1 predominance of the response to NP-CGG suggests that bystander effects were, at best, small in this study. This observation may reflect a very short range effect of cytokines. Cytokines have been shown to be preferentially released at the site of contact between T and B cells during cognate interactions. In this situation there is likely to be a highly selective influence on the cell that is recognized specifically (56, 57). It will be important in future studies to attempt to visualize cytokine protein production and release in vivo in relation to cognate T cell B cell interactions. Although this is possible in intact cell conjugates formed in vitro it remains a technical challenge to reproduce these studies consistently in tissue sections.
NK1.1 T cell (58, 59) and NK cell (60) activity in lymph nodes is generally low, but even rare cells could have a marked effect locally. Mast cells in lymph nodes are generally confined to the medulla. In this study no direct information about the cells that are producing cytokine message is available. Although this is a technically difficult area of investigation, information is required about the cytokines that are produced in the series of microenvironments that provide the theater for immune responses: (a) the site of immunization, (b) the T zone during T cell priming, (c) at the edge of the T zone during cognate interaction between T and B cells, and (d) in follicles and extrafollicular sites of exponential B cell growth and differentiation.
Class Switching During Primary Cognate Interaction between T Cells and B Cells.When the numbers of antigen-specific B cells found in lymph node sections are compared to
the amount of switch transcript in adjacent sections, it is
seen that C
switch transcript levels per cell are greatest
while B cells undergo their first cognate interaction with T
cells in the T zone on day 3 after immunization. This correlates with findings from studies in vitro, where signals from T cells like CD40 ligation on B cells can induce Ig
class switching efficiently (15, 61). It is also similar to findings in secondary immune responses, where the highest
amount of switch transcript per antigen-specific B cell is
found during the first cognate interaction in the T zone
(24). Switching during cognate interaction in the T zone
inevitably has a major impact on the Ig classes and subclasses produced during a primary or secondary immune
response because these B cells subsequently undergo exponential growth both within and outside follicles (24, 62, 63).
Ig class switching has also been shown to occur in germinal centers (25). Continued switch transcript production at 16 d in the primary responses reported here is likely to be occurring as centrocytes are selected in germinal centers (25). There is also less switch transcript found on day 16 in the MMTV(SW) response where germinal centers are much smaller and the increase of switching to IgG1 in this response occurs as germinal centers are formed. Although the number of antigen-specific cells in germinal centers at day 16 is much greater than the number present in the lymph nodes 3 d after immunization, the amount of switch transcript recovered at these two times is comparable. B cells of human tonsil undergoing T-B interaction in the T zone have not been isolated and there is no information about whether they undergo switch recombination (25). The impact of switching in centrocytes may be lower, as B cells that have been positively selected in germinal centers are only likely to undergo further proliferation if they are reactivated by antigen.
Ig class switching has also been reported to occur in sites of inflammation. This is exemplified by switching to IgE in the nasal mucosa in patients with allergic rhinitis (64). Switching to IgE is likely to be a secondary switching event after previous switch to IgG1 (6).
In a previous study of the primary splenic response to intraperitoneal NP-CGG (24), markedly lower levels of
switch transcript production were detected per unit
amount of
-actin than in the primary lymph node response. This may reflect in part a higher proportion of cells
involved with class switching in lymph nodes, which lack
the large red pulp component of the spleen. Ig class switching in the spleen is occurring later after primary immunization with NP-CGG (63) than in lymph nodes. The slower
rate of T cell priming that occurs in the spleen (65) compared to lymph nodes (66) may be associated with a lower
number of cognate T cell B cell interactions occurring at
any one time.
It is perhaps surprising that there is little change in the level of switch transcript production between days 3, 5, and 8 after immunization, for there is massive exponential growth of B cells in the medullary cords and follicles during this period and Ig class switching has been associated to B cell proliferation (10, 67, 68). New antigen-specific virgin B cells are likely to continue to arrive in the node for several days after immunization. Some of these will be derived from recirculating cells arriving from distant lymphoid tissues (69) and others will be newly produced virgin B cells (70). These cells are likely to make cognate interaction with primed T cells in the node draining the site of immunization. The rate of these cognate interactions might be expected to be relatively constant in the first 5 d after immunization until sufficient amounts of antibody are produced to bind free antigen. Most of the switching observed during this period may be occurring in B cells during these cognate interactions rather than in their proliferating progeny. This tentative conclusion suggests that the dual signals provided by CD40 ligation and cytokines are delivered by the interacting primed T cell. Other cytokines produced by the responding B cells and adjacent interdigitating dendritic cells may also contribute, but cytokine influence during the subsequent growth phase of the B cells may have a relatively small effect on Ig class switching.
| |
Footnotes |
|---|
Address correspondence to Kai-Michael Toellner, Department of Immunology, University of Birmingham Medical School, Birmingham B15 2TT, United Kingdom. Phone: 44 121 414 6970; Fax: 44 121 414 3599; E-mail: k.m.toellner{at}bham.ac.uk
Received for publication 28 October 1997 and in revised form 23 January 1998.
1 Abbreviations used in this paper: BrdU, 5-bromo-2'-deoxyuridine; CGG, chicken
globulin; MMTV(SW), Swiss type mouse mammary tumor virus; NP, (4-hydroxy-3-nitrophenyl)acetyl.
The authors wish to thank Peter Lane and Dagmar Scheel-Toellner for critical reading of the manuscript and helpful discussions.
| |
References |
|---|
|
|
|---|
| 1. | Kelso, A.. 1995. Th1 and Th2 subsets: paradigms lost? Immunol. Today. 16: 374-379 [Medline]. |
| 2. | Abbas, A.K., K.M. Murphy, and A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature. 383: 787-793 [Medline]. |
| 3. | Romagnani, S.. 1997. The Th1/Th2 paradigm. Immunol. Today. 18: 263-266 [Medline]. |
| 4. | Kaufmann, S.H.. 1993. Immunity to intracellular bacteria. Annu. Rev. Immunol. 11: 129-163 [Medline]. |
| 5. | Mosmann, T.R., H. Cherwinski, M.W. Bond, M.A. Giedlin, and R.L. Coffman. 1986. 2 types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136: 2348-2357 [Abstract]. |
| 6. | Sideras, P., S. Bergstedt-Lindqvist, and E. Severinson. 1985. Partial biochemical characterization of IgG1-inducing factor. Eur. J. Immunol. 15: 593-598 [Medline]. |
| 7. |
Vitetta, E.S.,
J. Ohara,
C.D. Myers,
J.E. Layton,
P.H. Krammer, and
W.E. Paul.
1985.
Serological, biochemical, and
functional identity of B cell-stimulatory factor-I and B cell
differentiation factor for IgG1.
J. Exp. Med.
162:
1726-1731
|
| 8. |
Coffman, R.L., and
J. Carty.
1986.
A T cell activity that enhances polyclonal IgE production and its inhibition by interferon- .
J. Immunol.
136:
949-954
[Abstract].
|
| 9. |
Snapper, C.M., and
W.E. Paul.
1987.
Interferon- and B-cell
stimulatory factor-I reciprocally regulate Ig isotype production.
Science.
236:
944-947
|
| 10. | Snapper, C.M., and F.D. Finkelmann. 1993. Immunoglobulin class switching. In Fundamental Immunology. W.E. Paul, editor. Raven Press, Ltd., New York. 837-863. |
| 11. | Stavnezer, J.. 1996. Antibody class switching. Adv. Immunol. 61: 79-146 [Medline]. |
| 12. | Kawabe, T., T. Naka, K. Yoshida, T. Tanaka, H. Fujiwara, S. Suematsu, N. Yoshida, T. Kishimoto, and H. Kikutani. 1994. The immune responses in CD40-deficient mice: impaired immunoglobulin class switching and germinal center formation. Immunity. 1: 167-178 [Medline]. |
| 13. | Xu, J., T.M. Foy, J.D. Laman, E.A. Elliott, J.J. Dunn, T.J. Waldschmidt, J. Elsemore, R.J. Noelle, and R.A. Flavell. 1994. Mice deficient for the CD40 ligand. Immunity. 1: 423-431 [Medline]. |
| 14. |
Renshaw, B.R.,
W.C. Fanslow III,
R.J. Armitage,
K.A. Campbell,
D. Liggitt,
B. Wright,
B.L. Davison, and
C.R. Maliszewski.
1994.
Humoral immune responses in CD40
ligand-deficient mice.
J. Exp. Med.
180:
1889-1900
|
| 15. | Ferlin, W.G., E. Severinson, L. Strom, A.W. Heath, R.L. Coffman, D.A. Ferrick, and M.C. Howard. 1996. CD40 signaling induces interleukin-4-independent IgE switching in vivo. Eur. J. Immunol. 26: 2911-2915 [Medline]. |
| 16. | Jumper, M.D., J.B. Splawski, P.E. Lipsky, and K. Meek. 1994. Ligation of CD40 induces sterile transcripts of multiple Ig H chain isotypes in human B cells. J. Immunol. 152: 438-445 [Abstract]. |
| 17. | Coffman, R.L., D.A. Lebman, and P. Rothman. 1993. Mechanism and regulation of immunoglobulin isotype switching. Adv. Immunol. 54: 229-270 [Medline]. |
| 18. | Bottaro, A., R. Lansford, L.X. Xu, J. Zhang, P. Rothman, and F.W. Alt. 1994. S-region transcription per se promotes basal IgE class switch recombination but additional factors regulate the efficiency of the process. EMBO (Eur. Mol. Biol. Organ.) J. 13: 665-674 [Medline]. |
| 19. |
Harriman, G.R.,
A. Bradley,
S. Das,
P. Rogersfani, and
A.C. Davis.
1996.
IgA class switch in I exon deficient mice role
of germline transcription in class switch recombination.
J.
Clin. Invest.
97:
477-485
[Medline].
|
| 20. | Jung, S., K. Rajewsky, and A. Radbruch. 1993. Shutdown of class switch recombination by deletion of a switch region control element. Science. 259: 984-987 [Abstract]. |
| 21. |
Lorenz, M.,
S. Jung, and
A. Radbruch.
1995.
Switch transcripts in immunoglobulin class switching.
Science.
267:
1825-1828
|
| 22. |
Zhang, J.,
A. Bottaro,
S. Li,
V. Stewart, and
F.W. Alt.
1993.
A selective defect in IgG2b switching as a result of targeted
mutation of the I 2b promoter and exon.
EMBO (Eur. Mol.
Biol. Organ.) J.
12:
3529-3537
[Medline].
|
| 23. | Snapper, C.M., K.B. Marcu, and P. Zelazowski. 1997. The immunoglobulin class switch: beyond "accessibility". Immunity. 6: 217-223 [Medline]. |
| 24. |
Toellner, K.M.,
A. Gulbranson-Judge,
D.R. Taylor,
D.M.Y. Sze, and
I.C.M. MacLennan.
1996.
Immunoglobulin switch
transcript production in vivo related to the site and time of
antigen-specific B cell activation.
J. Exp. Med.
183:
2303-2312
|
| 25. | Liu, Y.J., F. Malisan, O. Debouteiller, C. Guret, S. Lebecque, J. Banchereau, F.C. Mills, E.E. Max, and H. Martinez-Valdez. 1996. Within germinal centers, isotype switching of immunoglobulin genes occurs after the onset of somatic mutation. Immunity. 4: 241-250 [Medline]. |
| 26. |
Luther, S.A.,
A. Gulbranson-Judge,
H. Acha-Orbea, and
I.C.M. MacLennan.
1997.
Viral superantigen drives extrafollicular and follicular B cell differentiation leading to virus-specific antibody production.
J. Exp. Med.
185:
551-562
|
| 27. |
Luther, S.A.,
I. Maillard,
F. Luthi,
L. Scarpellino,
H. Diggelmann, and
H. Acha-Orbea.
1997.
Early neutralizing antibody
response against mouse mammary tumor virus critical role
of viral infection and superantigen-reactive T cells.
J. Immunol.
159:
2807-2814
[Abstract].
|
| 28. | Luther, S.A., and H. Acha-Orbea. 1997. Mouse mammary tumor virus: immunological interplays between virus and host. Adv. Immunol. 65: 139-243 [Medline]. |
| 29. | Ardavin, C., F. Luthi, M. Andersson, L. Scarpellino, P. Martin, H. Diggelmann, and H. Acha-Orbea. 1997. Retrovirus-induced target cell activation in the early phases of infection: the mouse mammary tumor virus model. J. Virol. 71: 7295-7299 [Abstract]. |
| 30. |
Held, W.,
A.N. Shakhov,
S. Izui,
G.A. Waanders,
L. Scarpellino,
H.R. MacDonald, and
H. Acha-Orbea.
1993.
Superantigen-reactive CD4+ T cells are required to stimulate B cells
after infection with mouse mammary tumor virus.
J. Exp.
Med.
177:
359-366
|
| 31. |
Luther, S.,
A.N. Shakhov,
I. Xenarios,
S. Haga,
S. Imai, and
H. Acha-Orbea.
1994.
New infectious mammary tumor virus superantigen with V specificity identical to Staphylococcal
enterotoxin b (SEB).
Eur. J. Immunol.
24:
1757-1764
[Medline].
|
| 32. |
Caton, A.J.,
J.R. Swartzentruber,
A.L. Kuhl,
S.R. Carding, and
S.E. Stark.
1996.
Activation and negative selection of
functionally distinct subsets of antibody-secreting cells by influenza hemagglutinin as a viral and a neo-self antigen.
J.
Exp. Med.
183:
13-26
|
| 33. | Jack, R.S., T. Imanishi-Kari, and K. Rajewsky. 1977. Idiotypic analysis of the response of C57BL/6 mice to the (4-hydroxy-3-nitrophenyl)acetyl group. Eur. J. Immunol. 7: 559-565 [Medline]. |
| 34. |
Perlmutter, R.M.,
D. Hansburg,
D.E. Briles,
R.A. Nicolotti, and
J.M. Davie.
1978.
Subclass restriction of murine anti-carbohydrate antibodies.
J. Immunol.
121:
566-572
|
| 35. |
Esser, C., and
A. Radbruch.
1990.
Immunoglobulin class
switching molecular and cellular analysis.
Annu. Rev. Immunol.
8:
717-735
[Medline].
|
| 36. |
Kelso, A.,
P. Groves,
A.B. Troutt, and
M.H. Pech.
1994.
Rapid establishment of a stable IL-4/IFN- production profile in the antigen-specific CD4+ T cell response to protein
immunization.
Int. Immunol.
6:
1515-1523
|
| 37. | Svetic, A., F.D. Finkelman, Y.C. Jian, C.W. Dieffenbach, D.E. Scott, K.F. McCarthy, A.D. Steinberg, and W.C. Gause. 1991. Cytokine gene expression after in vivo primary immunization with goat antibody to mouse IgD antibody. J. Immunol. 147: 2391-2397 [Abstract]. |
| 38. | Wallace, P.M., J.N. Rodgers, G.M. Leytze, J.S. Johnson, and P.S. Linsley. 1995. Induction and reversal of long-lived specific unresponsiveness to a T-dependent antigen following CTLA4Ig treatment. J. Immunol. 154: 5885-5895 [Abstract]. |
| 39. |
Collins, J.T., and
W.A. Dunnick.
1993.
Germline transcripts
of the murine immunoglobulin 2a gene structure and induction by IFN- .
Int. Immunol.
5:
885-891
|
| 40. | Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 9.45-9.46. |
| 41. | Weibel, E.R.. 1963. Principles and methods for the morphometric study of the lung and other organs. Lab. Invest. 12: 131-155 [Medline]. |
| 42. | Gulbranson-Judge, A., and I. MacLennan. 1996. Sequential antigen-specific growth of T cells in the T zones and follicles in response to pigeon cytochrome c. Eur. J. Immunol. 26: 1830-1837 [Medline]. |
| 43. |
Kamogawa, Y.,
L.A. Minasi,
S.R. Carding,
K. Bottomly, and
R.A. Flavell.
1993.
The relationship of IL-4- and IFN- -producing T cells studied by lineage ablation of IL-4-producing cells.
Cell.
75:
985-995
[Medline].
|
| 44. |
Mosmann, T.R., and
S. Sad.
1996.
The expanding universe
of T cell subsets Th1, Th2 and more.
Immunol. Today.
17:
138-146
[Medline].
|
| 45. |
Nakamura, T.,
Y. Kamogawa,
K. Bottomly, and
R.A. Flavell.
1997.
Polarization of IL-4- and IFN- -producing
CD4+ T cells following activation of naive CD4+ T cells.
J.
Immunol.
158:
1085-1094
[Abstract].
|
| 46. | Zheng, W., and R.A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell. 89: 587-596 [Medline]. |
| 47. | Matzinger, P.. 1994. Tolerance, danger, and the extended family. Annu. Rev. Immunol. 12: 991-1045 [Medline]. |
| 48. | Cella, M., A. Engering, V. Pinet, J. Pieters, and A. Lanzavecchia. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature. 388: 782-787 [Medline]. |
| 49. |
Roake, J.A.,
A.S. Rao,
P.J. Morris,
C.P. Larsen,
D.F. Hankins, and
J.M. Austyn.
1995.
Dendritic cell loss from
nonlymphoid tissues after systemic administration of lipopolysaccharide, tumor necrosis factor, and interleukin 1.
J.
Exp. Med.
181:
2237-2247
|
| 50. | De Smedt, T., M. Van Mechelen, G. De Becker, J. Urbain, O. Leo, and M. Moser. 1997. Effect of interleukin-10 on dendritic cell maturation and function. Eur. J. Immunol. 27: 1229-1235 [Medline]. |
| 51. | Kawamura, T., and M. Furue. 1995. Comparative analysis of B7-1 and B7-2 expression in Langerhans cells: differential regulation by T helper type 1 and T helper type 2 cytokines. Eur. J. Immunol. 25: 1913-1917 [Medline]. |
| 52. |
Heufler, C.,
F. Koch,
U. Stanzl,
G. Topar,
M. Wysocka,
G. Trinchieri,
A. Enk,
R.M. Steinman,
N. Romani, and
G. Schuler.
1996.
Interleukin-12 is produced by dendritic cells
and mediates T helper 1 development as well as interferon-
production by T helper 1 cells.
Eur. J. Immunol.
26:
659-668
[Medline].
|
| 53. |
Launois, P.,
I. Maillard,
S. Pingel,
K.G. Swihart,
I. Xenarios,
H. Acha-Orbea,
H. Diggelmann,
R.M. Locksley,
H.R. MacDonald, and
J.A. Louis.
1997.
IL-4 rapidly produced by
V 4 V 8 CD4+ T cells instructs Th2 development and susceptibility to Leishmania major in BALB/c mice.
Immunity.
6:
541-549
[Medline].
|
| 54. | Herrmann, T., S. Baschieri, R.K. Lees, and H.R. MacDonald. 1992. In vivo responses of CD4+ and CD8+ cells to bacterial superantigens. Eur. J. Immunol. 22: 1935-1938 [Medline]. |
| 55. | Gonzalo, J.A., I. Moreno de Alboran, J.E. Ales-Martinez, C. Martinez, and G. Kroemer. 1992. Expansion and clonal deletion of peripheral T cells induced by bacterial superantigen is independent of the interleukin-2 pathway. Eur. J. Immunol. 22: 1007-1011 [Medline]. |
| 56. |
Kupfer, A.,
T.R. Mosmann, and
H. Kupfer.
1991.
Polarized
expression of cytokines in cell conjugates of helper T cells
and splenic B cells.
Proc. Natl. Acad. Sci. USA.
88:
775-779
|
| 57. |
Kupfer, H.,
C.R. Monks, and
A. Kupfer.
1994.
Small splenic
B cells that bind to antigen-specific T helper (Th) cells and
face the site of cytokine production in the Th cells selectively
proliferate: immunofluorescence microscopic studies of Th-B
antigen-presenting cell interactions.
J. Exp. Med.
179:
1507-1515
|
| 58. |
Arase, H.,
N. Arase, and
T. Saito.
1996.
Interferon- production by natural killer (NK) cells and NK1.1+ T cells
upon NKR-P1 cross-linking.
J. Exp. Med.
183:
2391-2396
|
| 59. | Bendelac, A., M.N. Rivera, S.H. Park, and J.H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15: 535-562 [Medline]. |
| 60. | Ortaldo, J.R., and R.B. Herberman. 1984. Heterogeneity of natural killer cells. Annu. Rev. Immunol. 2: 359-394 [Medline]. |
| 61. |
Warren, W.D., and
M.T. Berton.
1995.
Induction of germ-line 1 and Ig gene expression in murine B cells IL-4 and
the CD40 ligand-CD40 interaction provide distinct but synergistic signals.
J. Immunol.
155:
5637-5646
[Abstract].
|
| 62. | Liu, Y.J., J. Zhang, P.J.L. Lane, E.Y.T. Chan, and I.C.M. MacLennan. 1991. Sites of specific B cell activation in primary and secondary responses to T-cell-dependent and T-cell- independent antigens. Eur. J. Immunol. 21: 2951-2962 [Medline]. |
| 63. |
Jacob, J.,
R. Kassir, and
G. Kelsoe.
1991.
In situ studies of the
primary immune response to (4-hydroxy-3-nitrophenyl)acetyl.
I. The architecture and dynamics of responding cell populations.
J. Exp. Med.
173:
1165-1175
|
| 64. | Durham, S.R., H.J. Gould, and Q.A. Hamid. 1997. Local IgE production in nasal allergy. Int. Arch. Allergy Immunol. 113: 128-130 [Medline]. |
| 65. | Berek, C., G.M. Griffiths, and C. Milstein. 1985. Molecular events during maturation of the immune-response to oxazolone. Nature. 316: 412-418 [Medline]. |
| 66. | Kallberg, E., D. Gray, and T. Leanderson. 1994. Kinetics of somatic mutation in lymph node germinal centres. Scand. J. Immunol. 40: 469-480 [Medline]. |
| 67. |
Lundgren, M.,
L. Strom,
L.O. Bergquist,
S. Skog,
T. Heiden,
J. Stavnezer, and
E. Severinson.
1995.
Cell-cycle regulation
of immunoglobulin class switch recombination and germ-line
transcription potential role of Ets family members.
Eur. J. Immunol.
25:
2042-2051
[Medline].
|
| 68. |
Hodgkin, P.D.,
J.H. Lee, and
A.B. Lyons.
1996.
B cell differentiation and isotype switching is related to division cycle
number.
J. Exp. Med.
184:
277-281
|
| 69. | Nieuwenhuis, P., and W.L. Ford. 1976. Comparative migration of B- and T-lymphocytes in the rat spleen and lymph nodes. Cell. Immunol. 23: 254-267 [Medline]. |
| 70. | Lortan, J.E., C.A. Roobottom, S. Oldfield, and I.C.M. MacLennan. 1987. Newly produced virgin B cells migrate to secondary lymphoid organs but their capacity to enter follicles is restricted. Eur. J. Immunol. 17: 1311-1316 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|