 |
Introduction |
The genus Yersinia includes three species, which are
pathogenic for rodents and humans. Y. pestis is the etiological agent of plague, Y. pseudotuberculosis and Y. enterocolitica cause gastrointestinal syndromes, lymphadenitis, and
septicemia (1). Despite of different routes of infection,
these three species share the common capability to resist
the immune response of the host. This enables extracellular survival and proliferation of the bacteria in the host lymphoid tissue (1, 2). The three pathogenic Yersinia spp. harbor a common 70-kb virulence plasmid (pYV) that encodes the Yersinia Yop virulon, a sophisticated bacterial
system that mediates delivery of Yops (Yersinia outer proteins) inside eukaryotic cells by surface-bound bacteria (1,
3, 4). The delivered Yops disrupt key functions of the host
cell (1, 5). At least four Yops, the so-called effector Yops,
YopH, YopE, YopM, and YpkA (YopO in Y. enterocolitica) are translocated across the eukaryotic cell plasma membrane
(1). YopE disrupts the actin microfilament structure and
acts synergistically with the protein tyrosine phosphatase
YopH to inhibit phagocytosis and to suppress the oxidative
burst of professional phagocytes (6). YpkA/YopO displays serine/threonine kinase activity and is, like YopH,
supposed to interfere with host cell signaling pathways (11).
Export and translocation of effector Yops is mediated by a
virulence plasmid-encoded protein secretion system and
requires control by YopB, YopD, LcrV, and YopN (1).
Studies in the murine infection model provide evidence
that the Yersinia Yop virulon mediates suppression of the
TNF-
and IFN-
production in vivo (12). The cytokines
TNF-
and IFN-
play a central role in the inflammatory
response to bacterial infection. They are crucial in limiting the severity of Yersinia infection (13). Consequently,
inhibition of TNF-
and IFN-
synthesis enhances the
ability of Yersinia to multiply in the host (12, 13). Previous
studies in our laboratories revealed that Y. enterocolitica
promotes deactivation of mitogen-activated protein kinases
(MAPKs)1 in cultured macrophages (14). An important role
of MAPK cascades in the regulation of the macrophage
TNF-
production has been widely documented (15),
and our study suggests that Y. enterocolitica suppresses the
macrophage TNF-
production by shortening MAPK activities (14). In addition, we and others recently demonstrated that interaction of Yersinia with macrophages culminates in activation of the intrinsic macrophage cell death
program (19). Apoptosis as an innate cell suicide mechanism for removing unwanted cells from the multicellular
organism appears to play a role in some infectious diseases
(22). However, the mechanism by which Yersinia promotes
macrophage cell death is not clear yet.
In this study, we analyzed the impact of Y. enterocolitica
on activation of transcription factor NF-
B. The active
heterodimer p50/p65 form of NF-
B plays a central role in
immunological processes by controlling expression of a variety of genes involved in inflammatory responses (i.e.,
TNF-
, IL-1, IL-6, IL-8, GM-CSF; reference 23). Furthermore, there is increasing evidence that activation of
NF-
B provides cells with resistance to apoptosis induced
by different stimuli (24). NF-
B can be activated in
macrophages by exposure to LPS or inflammatory cytokines such as TNF-
or IL-1, viral infection, UV radiation,
and by other physiological and nonphysiological agonists
(24). In its inactive form, NF-
B is sequestered in the
cytoplasm in a complex with the inhibitory proteins I
B-
or I
B-
(23, 29). After stimulation by the different inducers, the I
B inhibitors get phosphorylated and degraded
through the ubiquitin-proteasome pathway, thereby releasing NF-
B heterodimer (23, 29). Free NF-
B translocates to the nucleus, where it binds to its target sequences
and activates transcription (23, 29). Duration of NF-
B activation has been found to depend on the activating stimuli,
which either degrade I
B-
and I
B-
(persistent NF-
B
activation), or only I
B-
(transient NF-
B activation) (30). Bacterial LPS induces persistent NF-
B activation by
degrading I
B-
as well as I
B-
in responsive cells (30).
Here, we report that Y. enterocolitica impairs activation of
NF-
B in murine J774A.1 and peritoneal macrophages and
in human epithelial HeLa cells. Our study implies a direct
link between the prevention of NF-
B activation and apoptotic cell death as well as TNF-
suppression in Yersinia-infected macrophages. Thus, interference of Yersinia with
macrophage NF-
B activation may crucially contribute to
subvert the host immune response and determine the outcome of Yersinia infection.
 |
Materials and Methods |
Bacterial Strains and Growth Conditions.
The bacterial strains
used in this study are listed in Table 1. Overnight cultures grown
at 26°C were diluted 1:20 in fresh Luria-Bertani broth and grown
for 2 h at 37°C as described previously (14, 19). The bacteria
were then washed once and resuspended in PBS at a concentration of 108 bacteria/ml. The desired bacterial concentration was
adjusted by measuring the optical density at 600 nm and checked
by plating serial dilutions of the samples on agar and counting
CFUs after incubation at 26°C for 20 h.
Construction of a Y. enterocolitica yopO/yopP Mutant Strain.
Two
PCR primers were deduced from the yopO/yopP homologous ypkA/
yopJ operon in Y. pseudotuberculosis (11) to amplify an internal fragment spanning from bp 223 to 1030. Primer Ypk-Mf GAGTGCATGCTGAGGGCTGATGAAAT and Ypk-Mr TATTGCATGCTTATCCTTAGTTTCTATTA harbor additional SphI
restriction sites at their 5' ends (underlined). Y. enterocolitica strain
WA-314, bearing the virulence plasmid pYVO8 (31), was used as
a template to amplify the PCR product of 815 bp. This PCR product was purified, cut with SphI, and ligated into the unique SphI
site of the suicide plasmid pGPCAT (32) resulting in pGPC-KM1.
Escherichia coli SM10 was used as host strain for transformation.
pGPC-KM1 was mobilized into strain WA-314 by conjugation
and inserted into pVYO8 by homologous recombination. Transconjugants harboring the cointegrate (pYVO8::pGPC-KM1) were selected by chloramphenicol and nalidixic acid resistance. The resulting clone WA-C(pYV-OP-1) was characterized by restriction enzyme analysis, and inability to produce YopO and YopP was
verified by SDS-PAGE.
Cell Culture and Preparation of Macrophages.
The murine macrophage-like cell line J774.A1 and the human epithelial HeLa cell
line were routinely grown in cell growth medium (RPMI 1640 medium supplemented with 10% heat inactivated fetal calf serum
and 5 mM L-glutamine; Life Technologies, Cergy, Pontoise, France) at 37°C and 5% CO2 in a humidified atmosphere. Elicited peritoneal macrophages were obtained from male 8-10-wk-old Swiss mice 4 d after intraperitoneal inoculation of 1.5 ml of
3% thioglycolate broth. Peritoneal exudate cells were washed and
cultured at 37°C in cell growth medium. After 2 h, nonadherent
cells were removed by repeated washing, and remanent macrophages were further incubated in cell growth medium at 37°C
and 5% CO2.
Stimulation of Cells.
Cells were either treated with bacteria,
with 10 µg/ml LPS from E. coli (Sigma Chemical Co., St. Louis,
MO), or with 20 ng/ml human TNF-
(National Institute for
Biological Standards and Control, Hertfordshire, UK) as indicated. Infections were performed at a multiplicity of infection
(MOI) of 50:1 for different periods of time as indicated. After infection, HeLa cells were centrifuged for 5 min at 400 g to facilitate contact between bacteria and cells. For incubation times >60
min (J774A.1 cells and peritoneal macrophages) or 90 min (HeLa
cells), bacteria were killed by the addition of gentamicin (100 µg/ml)
after 60 or 90 min of infection, respectively. In some experiments,
cells were pretreated with 10 µM of the proteasome inhibitor Z-Leu-Leu-leucinal (MG-132; Biomol Research Laboratories, Plymouth
Meeting, MA), the MAPK-ERK kinase 1 (MEK1) inhibitor
PD098059 (50 µM; New England Biolabs, Beverly, MA), or the
p38 (MAPK different from ERK or JNK) inhibitor SB203580 (10 µM; provided by J.C. Lee, SmithKline Beecham, King of Prussia,
PA) for 30 min before stimulation.
Preparation of Nuclear Extracts.
Nuclear proteins from cells treated
as indicated were extracted according to a modification of the
procedure described by Thieblemont et al. (33). In brief, cells
were washed with ice-cold PBS and lysed with hypotonic buffer
(5 mM Hepes, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM
DTT, 0.1 mM PMSF, 5 µg/ml leupeptin, 4 µg/ml aprotinin, 1 µg/ml pepstatin, 2 µg/ml antipain, and 1 µg/ml chymostatin).
The cells were left on ice for 20 min and subsequently centrifuged at 1,000 g. The nuclear pellets were resuspended in extraction buffer (20 mM Hepes, pH 7.9, 25% glycerol, 1 M NaCl, 1.5 mM MgCl2, 0.5 mM EDTA, 0.5 mM 1,4 dithiothreitol (DTT),
0.5 mM PMSF, 2 µg/ml leupeptin, 1.5 µg/ml aprotinin, 0.5 µg/
ml pepstatin, 1 µg/ml antipain, and 0.5 µg/ml chymostatin) and
incubated on ice for 30 min. The nuclear proteins in the supernatant were recovered after centrifugation at 16,000 g, quantified by using a protein assay kit (BioRad Labs, Munich, Germany), and stored in aliquots at
80°C.
Electrophoretic Mobility Shift Assays.
For the electrophoretic
mobility shift assays (EMSAs; reference 33), the NF-
B oligonucleotide probe (5'-ACAAGGGACTTTCCGCTGGGGACTTTCCAG-3'), synthesized by Eurobio (Les Ulis, France), was radiolabeled with
-[32P]ATP using T4 polynucleotide kinase
(Eurogentec, Serraing, Belgium). Nuclear proteins (10 µg) were
preincubated with 5 µg of salmon sperm DNA (GIBCO BRL,
Gaithersburg, MD) on ice for 15 min before addition of 2-5 ng
of the radiolabeled (50,000-100,000 cpm/ng) NF-
B oligonucleotide probe. The DNA-binding reactions were performed in
the presence of 25 mM Hepes, pH 7.9, 0.5 mM EDTA, 0.5 mM
DTT, and 5% glycerol for 30 min at room temperature (final volume: 20 µl). Competition studies were carried out with a 50-fold
molar excess of unlabeled oligonucleotides added to the reaction
mixtures before addition of radiolabeled oligonucleotides. For supershift assays, 1 µl of rabbit polyclonal IgG directed to the p65
NF-
B subunit (provided by J. Imbert, Institut National de la
Santé et de la Recherche Médicale [INSERM] U119, Marseille,
France; reference 34) was added to the extracts before incubation
with the labeled oligonucleotide probe. After incubation, the reaction products were analyzed by 6% PAGE using Tris-borate-EDTA running buffer (45 mM Tris-borate, pH 8.0, 10 mM
EDTA). The gels were dried and analyzed with a PhosphorImager (Molecular Dynamics, Bondoufle, France).
Western Immunoblot Assays.
Cytoplasmic extracts were prepared from 106 cells, treated, as indicated, by lysis in buffer containing 10 mM Tris, pH 8.0, 60 mM KCl, 1 mM EDTA, 0.5%
Nonidet P-40, 1 mM DTT, 1 mM PMSF, 1 mM benzamidin, 20 mM
-glycerophosphate, 5 mM p-nitrophenyl phosphate, and
0.1 mM Na3VO4. Proteins were separated by 10% SDS-PAGE, electrotransferred to polyvinylidene difluoride membrane, and blocked with 3% BSA. Immunostaining for I
B-
and I
B-
were performed with polyclonal rabbit anti-I
B-
and anti-I
B-
antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Immunoreactive bands were visualized by incubation with donkey
anti-rabbit antibodies conjugated to horseradish peroxidase (Amersham Corp., Arlington Heights, IL) using enhanced chemiluminescence reagents (New England Nuclear Life Science, Boston, MA).
Assessment of Apoptosis by Fluorescence Microscopy.
Apoptotic cells
were detected and quantified by an assay based on the detection
of phosphatidylserine exposed on the outer leaflet of apoptotic
cells as described previously (19). Cells treated as indicated were
stained with FITC-conjugated annexin V (Annexin-V-Fluos; Boehringer Mannheim GmbH, Mannheim, Germany), which binds
with high affinity to membrane-exposed phosphatidylserine. The
simultaneous application of the DNA stain propidium iodide (Sigma Chemical Co.) allowed discrimination of apoptotic from necrotic cells. The percentages of apoptotic cells were determined by counting a minimum of 100 cells/sample in a fluorescence microscope (DM IRB; Leica, Wetzlar, Germany). Results are expressed as mean percentages of apoptotic cells ± SD from three
independent experiments.
Quantitation of TNF-
Secretion.
For TNF-
quantitation,
J774A.1 cells and peritoneal macrophages were dispatched in
plastic culture plates (5 × 105/sample) and treated as indicated.
The cell culture supernatants were removed after a final 150-min
incubation, and the TNF-
cytokine levels in the supernatants
were evaluated by a cytotoxic assay performed with the TNF-
-
sensitive fibroblast cell line L929 as described previously (14). Experiments were performed in quadruplicate. Results are expressed
as mean percentages of picograms of TNF-
per milliliter ± SD
from one representative experiment out of three performed.
 |
Results |
Y. enterocolitica Inhibits Nuclear Translocation of NF-
B in
J774A.1 Macrophages.
To evaluate a role of NF-
B in the
macrophage response to Y. enterocolitica infection, we analyzed nuclear translocation of NF-
B in Y. enterocolitica-
infected J774A.1 macrophages by EMSA. J774A.1 cells
were either infected with virulence plasmid-cured (WA-C)
or with virulence plasmid-harboring wild-type (WA-314) yersiniae, or treated with LPS from E. coli. At different
time points after challenge, nuclear protein extracts were
assayed for NF-
B DNA-binding activities using a radiolabeled NF-
B-specific probe (33). As shown in Fig. 1 A,
strong radioactive DNA binding to nuclear proteins was
observed after 30 min when cells were treated with LPS or
virulence plasmid-cured Y. enterocolitica. Infection with
wild-type yersiniae for 30 min induced formation of a protein-DNA complex migrating at the same mobility, but
the DNA-binding activity of this complex was greatly reduced as compared to virulence plasmid-cured yersiniae or
to LPS. To examine the specificity of the DNA-binding
capability of the complexes generated by virulence plasmid-cured and -harboring yersiniae after 30 min, a 50-fold
molar excess of unlabeled NF-
B oligonucleotides was added for competition (Fig. 1 B). As expected, the unlabeled oligonucleotides prevented formation of radiolabeled
protein-DNA complexes. Incubation with an antibody directed to the p65 NF-
B subunit resulted in supershift of
these complexes, confirming their identities as transcription
factor NF-
B (Fig. 1 B). Translocation of NF-
B in response to treatment with virulence plasmid-cured strain
WA-C or with LPS was enhanced after 60 min and persisted at least up to 90 min (Fig. 1 A). In contrast, nuclear
extracts from cells infected for 60 and 90 min with wild-type Y. enterocolitica did not give rise to complex formation
anymore, indicating that the low nuclear translocation of
NF-
B induced by wild-type yersiniae within 30 min is
only short living and already completely abolished after 60 min. These data demonstrate that wild-type Y. enterocolitica suppresses translocation of NF-
B to the nucleus and, thus,
prevents prolonged NF-
B activation. In addition, infection of J774A.1 cells with wild-type Y. enterocolitica for 60 min inhibited activation of NF-
B in response to subsequent challenge with LPS from E. coli (data not shown), indicating that Yersinia infection actively suppresses the NF-
B signal induced by LPS.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 1.
Y. enterocolitica impairs activation of NF- B in
J774A.1 macrophages. (A) Kinetics of NF- B DNA-binding
activity in J774A.1 macrophages
treated with Y. enterocolitica and
LPS as detected by EMSA.
J774A.1 cells were untreated
(lane 1) or stimulated with LPS
(lane 2), with the virulence plasmid-cured Yersinia strain WA-C
(lane 3) or the virulent wild-type
strain WA-314 (lane 4). The
NF- B activities were determined after 30, 60, and 90 min
of stimulation. (B) Investigation
of the identity of NF- B by supershift assay with an antibody
directed against the p65 NF- B
subunit (p65 Ab), and by competition with a 50-fold molar excess of the unlabeled oligonucleotide (cold probe). Experiments
were performed with the NF- B
complexes obtained by infections
with strain WA-C and WA-314
after 30 min.
|
|
Y. enterocolitica Inhibits Prolonged Degradation of I
B-
and
I
B-
.
We examined the changes in cytoplasmic I
B-
(37 kD) and I
B-
(46 kD) protein levels of J774A.1 cells
to determine whether degradation of these inhibitory proteins correlates with the respective level of NF-
B activation. Immunoblotting analysis revealed that virulence plasmid-harboring yersiniae (WA-314) as well as virulence plasmid-cured yersiniae (WA-C) and LPS rapidly induced
phosphorylation and proteolysis of I
B-
within 10-30
min (Fig. 2). Phosphorylation of I
B-
resulted in an upward shift of I
B-
in the SDS-PAGE because of slower
electrophoretical mobility (35). I
B-
phosphorylation and
degradation occured even faster in case of infection with the wild-type strain WA-314 (Fig. 2, lane 4) as compared
to strain WA-C (Fig. 2, lane 3). This effect may be attributed to the presence of the virulence plasmid-encoded cell
adhesin YadA, since a yadA-negative mutant (36) revealed
a kinetic of I
B-
degradation similar to virulence plasmid-cured yersiniae (data not shown). This is also in line
with a faster increase of the oxidative burst of polymorphonuclear leukocytes infected with YadA-bearing yersiniae as
compared to leukocytes treated with yersiniae lacking
YadA (10). Fig. 2 shows that, after 45 min, newly synthesized I
B-
accumulated and increasing amounts of I
B-
reappeared in the immunoblot. However, only J774A.1
macrophages infected with wild-type strain WA-314 completely restored their I
B-
level within 60 min and no
phosphorylated forms of I
B-
could be detected anymore. In contrast, I
B-
in cells treated with LPS or with
strain WA-C remained phosphorylated and degraded to a
remarkable degree throughout the time investigated. The
results obtained for I
B-
were similar to those obtained
for I
B-
, although degradation of I
B-
in response to
treatment with LPS and both Yersinia strains was not as dramatic as for I
B-
and occurred later (30-45 min). However, also in the case of I
B-
, infection with strain WA-314 caused complete restoration of the cytoplasmic pool of
the inhibitory protein at time points when degradation of
I
B-
due to treatment with LPS or virulence plasmid-
cured yersiniae was still obvious (60-120 min). Thus, the
correlation between the lack of persistent I
B-
/I
B-
degradation and the inhibition of NF-
B translocation suggests that Y. enterocolitica suppresses NF-
B activation by preventing prolonged proteolysis of the inhibitory proteins.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 2.
Y. enterocolitica inhibits prolonged degradation of I B- and
I B- in J774A.1 macrophages. The kinetics of degradation of I B-
and I B- was determined in untreated J774A.1 macrophages (lane 1)
and in macrophages stimulated with LPS (lane 2), with the virulence plasmid-cured Yersinia strain WA-C (lane 3), and with the virulent wild-type
strain WA-314 (lane 4). The cytoplasmic lysates of stimulated J774A.1
cells were prepared at the time points indicated, subjected to SDS-PAGE,
and immunoblotted with polyclonal anti-I B- and anti-I B- antibodies, respectively.
|
|
Y. enterocolitica-mediated Inhibition of NF-
B Activation
Correlates with J774A.1 Cell Apoptosis and Suppression of
TNF-
Production.
Since NF-
B was reported to play a
central role in the regulation of apoptotic cell death and of
cytokine secretion (23), we wondered whether the inhibition of NF-
B translocation is related to Yersinia-induced
apoptosis and TNF-
suppression. We compared nuclear
translocation of active NF-
B in response to infection with
different Y. enterocolitica mutants (Fig. 3 A) with the capabilities of these strains to trigger J774A.1 cell apoptosis (Fig.
3 B) and to block TNF-
production (Fig. 3 C). TNF-
secretion in the culture supernatant was determined after
150 min, a time point when onset of J774A.1 cell apoptosis
due to infection with wild-type yersiniae starts to be detectable (19). Previously, we demonstrated that apoptosis
and TNF-
inhibition induced by Y. enterocolitica depend
on a functional Yop secretion system, but occur independently of the presence of the tyrosine phosphatase YopH
(14, 19). In line with these results, we now found that the
YopH secretion negative strain WA-C(pYV-7146) (sycH
mutant) prevented the translocation of NF-
B (Fig. 3, lane
4). On the contrary, strain WA-C(pYV-515), which is affected in the secretion of all Yops (lcrD mutant), exhibited a
strong NF-
B-binding activity (Fig. 3, lane 6) similar to
strain WA-C (Fig. 3, lane 2). These results show that also for the inhibition of NF-
B, a functional Yop secretion
system is required, but YopH appears to be dispensable.
Furthermore, we analyzed two Yersinia strains expressing only
a restricted repertoire of yop genes. Strain WA-C(pLCR)
secretes the translocator/regulator proteins YopD, YopB,
YopN, and LcrV. The second strain, referred to as WA-C(pLCR, pB8-23), additionally secretes YopH and YopE. These two Yops confer resistance to phagocytosis and suppression of the J774A.1 cell oxidative burst to Y. enterocolitica (14). Nevertheless, neither strain was efficiently inhibiting the translocation of NF-
B, nor promoting apoptosis or
TNF-
suppression. Fig. 3 also displays the results obtained
with a Y. enterocolitica mutant selectively affected in the expression of the serine/threonine kinase gene yopO and the
cotranscribed yopP. This mutant was remarkably impaired
in its ability to induce apoptosis (52 ± 15% apoptotic cells)
and to inhibit the TNF-
production (0.65 ± 0.04 ng
TNF-
/ml), as compared to the virulent wild-type strain
(90 ± 4% apoptotic cells, 0.14 ± 0.05 ng TNF-
/ml). Interestingly, this strain was also not as efficient as the wild-type strain to inhibit the translocation of NF-
B (intensity
of NF-
B DNA-binding activity of 12 for the yopO/yopP
mutant, and of 5 for the wild-type strain; Fig. 3). Thus, our
data point out a close correlation between the capability of
Y. enterocolitica to prevent activation of NF-
B, to trigger apoptosis, and to suppress the TNF-
production in J774A.1
macrophages. The caspase inhibitor ZVAD.fmk, which efficiently blocks execution of the Yersinia-induced apoptotic
program (19), did not interfere with TNF-
suppression
mediated by Yersinia (data not shown), indicating that TNF-
suppression is not a result of the apoptotic process.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 3.
Correlation between inhibition of the NF- B
response, and apoptosis and
TNF- suppression in J774A.1
cells infected with different Y. enterocolitica mutants. (A) J774A.1
cell NF- B activities. (B) Quantitation of J774A.1 cell apoptosis.
(C) Quantitation of J774A.1 cell
TNF- production. J774A.1
cells were either untreated (lane
1), or infected with the virulence
plasmid-cured strain WA-C
(lane 2), the virulent wild-type
strain WA-314 (lane 3), the
YopH secretion-negative strain
WA-C(pYV-7146) (lane 4), the
yopO/yopP mutant WA-C(pYV-OP-1) (lane 5), the Yop secretion-negative strain WA-C(pYV-515) (lane 6), strain WA-C(pLCR) secreting YopD, YopB, YopN, and
LcrV (lane 7), and strain WA-C(pLCR, pB8-23) secreting YopD, YopB,
YopN, LcrV, YopH, and YopE (lane 8). (A) The NF- B activities of
J774A.1 cells were determined 60 min after infection by EMSA and
quantified with a PhosphorImager. The radioactive intensities of the NF- B
DNA-binding activities are given below the respective NF- B signal.
This figure shows one experiment representative for three performed.
Only sections of the autoradiogram containing the protein-DNA complexes are shown. (B) Apoptosis of J774A.1 cells was assayed 4 h after onset of infection by staining the cells with fluorescein-conjugated annexin
V and propidium iodide, and counting apoptotic cells in a fluorescence
microscope. (C) The TNF- activities in the cell culture supernatants (dilution 1:40) were measured 150 min after the onset of infection, using a
cytotoxic assay performed with the TNF- -sensitive fibroblast cell line
L929.
|
|
Murine Peritoneal Macrophages Respond to Y. enterocolitica Infection as J774A.1 Cells.
To determine whether Y. enterocolitica interferes with the activation of NF-
B also in primary macrophages, we investigated the effects of Yersinia
infection on murine peritoneal macrophages. EMSAs revealed that virulent wild-type yersiniae impaired nuclear translocation of NF-
B in peritoneal macrophages within
90 min (Fig. 4 A). In contrast, virulence plasmid-cured
yersiniae induced an increasing NF-
B response, similar to
J774A.1 cells. Supershift experiments with the anti-p65 antibody identified the detected protein-DNA complexes as
NF-
B (data not shown). Analyzing the I
B-
and I
B-
protein levels, we found that I
B-
as well as I
B-
were
efficiently degraded upon infection with both Yersinia strains (Fig. 4 B). However, as in J774A.1 cells, substantial amounts of I
B-
and I
B-
were regenerated within 60-
90 min, specifically in macrophages infected with the wild-type strain. Additionally, apoptosis and inhibition of the
TNF-
production were found only in peritoneal macrophages treated with wild-type Y. enterocolitica, but not
with the virulence plasmid-cured strain (Table 2). Thus,
the effects observed on J774A.1 cells appear to hold true also
for primary peritoneal macrophages, validating J774A.1
cells as an appropriate infection model for analyzing Yersinia-macrophage interaction.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 4.
Y. enterocolitica impairs activation of NF- B in murine peritoneal macrophages. (A) Kinetics of NF- B DNA-binding activity. (B)
Kinetics of degradation of I B- and I B- . Murine peritoneal macrophages were untreated (lane 1) or stimulated with LPS (lane 2), with
the virulence plasmid-cured Yersinia strain WA-C (lane 3) or the virulent
wild-type strain WA-314 (lane 4). After 30, 60, and 90 min, (A) the NF- B activities were determined by EMSA and (B) the I B- and I B-
protein levels were determined in cytoplasmic lysates subjected to SDS-PAGE and immunoblotted with polyclonal anti-I B- and anti-I B-
antibodies, respectively.
|
|
View this table:
[in this window]
[in a new window]
|
Table 2
Wild-type Y. enterocoliticia Inhibits the TNF-
Production and Triggers Apoptosis in Murine Peritoneal Macrophages
|
|
Prevention of NF-
B Activation by Proteasome Inhibitor MG-132 Triggers Apoptosis in J774A.1 Cells Treated with Virulence
Plasmid-cured Yersiniae or LPS.
To confirm a possible relation between the blockage of NF-
B activation and the
onset of apoptosis, we sought a compound inhibiting efficiently and selectively the translocation of NF-
B. Since NF-
B translocation depends on the protease activity in
the proteasome, which degrades I
Bs (23, 29, 37), we used
the peptide Z-Leu-Leu-leucinal (MG-132), which specifically inhibits the proteasome pathway (37, 38). Pretreatment of J774A.1 cells with this compound substantially inhibited I
B-
degradation (data not shown) and NF-
B
activation due to infection with virulence plasmid-cured
yersiniae (Fig. 5, lane 3). Interestingly, after 4 h of incubation, >90% of the cells pretreated with MG-132 and infected with virulence plasmid-cured yersiniae underwent
apoptosis (Table 3). The same held true for J774A.1 cells
stimulated with LPS after pretreatment with MG-132. These results once again suggest a direct link between the
level of NF-
B activation and the readiness of J774A.1 cells
to undergo apoptotic cell death upon stimulation. When
we analyzed the impact of MG-132 on the TNF-
response, we found that the TNF-
production induced by
virulence plasmid-cured yersiniae and by LPS was completely abolished by pretreatment with MG-132 (Table 3).
These data imply a key role of NF-
B activity not only in
the prevention of apoptosis, but also in the regulation of
the TNF-
production.

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 5.
The NF- B response
induced by virulence plasmid-cured
Y. enterocolitica (WA-C) in J774A.1
cells is reduced by pretreatment with
the proteasome inhibitor MG-132,
but not by pretreatment with
SB203580 and PD098059. J774A.1
cells were untreated (lanes 1-2), pretreated for 30 min with either 10 µM
of the proteasome inhibitor MG-132
(lane 3), or a combination of the p38
inhibitor SB203580 (10 µM) and the MEK1 inhibitor PD098059 (50 µM; lane 4). Thereafter, cells were infected with the virulence plasmid-
cured Yersinia strain WA-C (lanes 2-4). After 45 min, NF- B activities
were analyzed by EMSA.
|
|
View this table:
[in this window]
[in a new window]
|
Table 3
Pretreatment with the Proteasome Inhibitor MG-132
Triggers Apoptosis and Suppresses the TNF- Production in J774A.1
Macrophages Stimulated by LPS or Virulence Plasmid-cured Y. enterocolitica (WA-C)
|
|
Y. enterocolitica-mediated Inhibition of NF-
B Promotes Apoptosis of HeLa Cells in Response to TNF-
.
In a previous
study, we demonstrated that Y. enterocolitica infection leads
to apoptosis selectively in macrophages, but not in epithelial HeLa cells (19). To reevaluate a possible role of NF-
B
in Yersinia-mediated apoptosis, we studied whether NF-
B activation was also affected in Y. enterocolitica-infected HeLa cells. Fig. 6 shows that the virulence plasmid-cured strain
WA-C (lane 6) induced substantial NF-
B-binding activity, but not as strong as treatment of HeLa cells with TNF-
(lane 4). Supershift assays with the anti-p65 subunit antibody identified the detected nuclear complexes as NF-
B
(Fig. 6, lanes 3, 5, and 7). In contrast, the virulent wild-type strain WA-314 (Fig. 6, lane 8) prevented nuclear
translocation of NF-
B. However, strain WA-314 did not induce HeLa cell apoptosis (Table 4). When we treated
HeLa cells either with strain WA-C or WA-314, and restimulated thereafter with TNF-
, strain WA-314 exclusively caused a marked decrease of the resulting NF-
B
signal (compare in Fig. 6 lane 1 with lanes 2 and 4). Strikingly, this mode of treatment led to apoptotic cell death of
62 ± 15% of the HeLa cell population after 6 h (Table 4).
Similarly, pretreatment of HeLa cells with the proteasome inhibitor MG-132 and subsequent stimulation with TNF-
strongly induced apoptosis, but not the addition of MG-132 alone. These results support previous studies that demonstrated that the fate of epithelial HeLa cells upon treatment with TNF-
depends on the ability of NF-
B to be
activated (28, 39). Y. enterocolitica, by inhibiting the activation of NF-
B, promotes apoptosis of HeLa cells in response to TNF-
.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 6.
Y. enterocolitica impairs activation of NF- B in epithelial
HeLa cells. Treatment of epithelial HeLa cells was performed in two
steps. During the first step, the HeLa cells were untreated (lanes 3, 4, and
9) or infected with either virulence plasmid-cured yersiniae (lanes 2, 5, and
6), or wild-type yersiniae (lanes 1, 7, and 8) for 90 min. Thereafter, half of
the samples were challenged with 20 µg/ml human TNF- (lanes 1-4)
for 30 min. Nuclear extracts were prepared after the first incubation step
(lanes 5-9) or after additional TNF- treatment (lanes 1-4), and analyzed
for NF- B DNA-binding activity by EMSA. Supershift assays with an antibody directed against the p65 NF- B subunit identified the detected
complexes as NF- B (lanes 3, 5, and 6).
|
|
View this table:
[in this window]
[in a new window]
|
Table 4
TNF- Triggers Apoptosis of Epithelial HeLa Cells after
Pretreatment with Wild-type Y. enterocolitica or the Proteasome
Inhibitor MG-132
|
|
Inhibitors of p38 MAPK (SB203580) and MAPK-ERK-kinase 1 (PD098059) Do Not Interfere with Yersinia-mediated
Apoptosis, but Cumulatively Block the TNF-
Production Induced
by Virulence Plasmid-cured Yersiniae.
In a previous study,
we found that Y. enterocolitica initially stimulates and subsequently deactivates the macrophage MAPKs extracellular
signal-regulated kinase (ERK)1/2, p38, and c-Jun NH2-terminal kinase (JNK) (14). There is increasing evidence that MAPK cascades serve to regulate cell proliferation and
cell death (40). To verify involvement of MAPKs in Yersinia-induced apoptosis of J774A.1 cells, we analyzed the effects of
two specific inhibitors of MAPK pathways. The compound
SB203580 specifically inhibits p38/CSBP kinase activities
(41), whereas PD098059 selectively blocks activation of the
ERK kinase MEK1, which in turn prevents activation of
ERK1/2 (42). There is no drug available yet to selectively
inhibit the JNK pathway. J774A.1 cells were pretreated with SB203580 and PD098059, and thereafter challenged
with yersiniae. Our experiments revealed that neither compound, alone or in combination, blocked J774A.1 cell apoptosis induced by wild-type yersiniae; in each case, 85-95%
of cells became apoptotic after 4 h of incubation. Thus,
neither the p38 nor the ERK1/2 MAPK pathways seem to
be crucially engaged in Yersinia-mediated apoptosis. In addition, we analyzed the impact of SB203580 and PD098059
on the J774A.1 cell TNF-
production. Table 5 shows that
both compounds substantially inhibited the TNF-
release
of J774A.1 cells in response to infection with virulence
plasmid-cured yersiniae. These effects seem to be cumulative, since addition of the two compounds together blocked the TNF-
production completely. However, under the
same experimental conditions, neither compound prevented
NF-
B activation due to infection with strain WA-C (Fig.
5, lane 4), which demonstrates that these inhibitors do not
exert their effects on TNF-
production via the NF-
B
signaling pathway. These results indicate that not only NF-
B, but also the p38 and ERK1/2 MAPK pathways, are
important regulators of the J774A.1 cell TNF-
production in response to bacterial infection.
View this table:
[in this window]
[in a new window]
|
Table 5
Inhibitors of p38 (SB203580) and MEK1
(PD098059) Cumulatively Inhibit the TNF- Production of
J774A.1 Macrophages Stimulated with Virulence Plasmid-cured Y. enterocolitica (WA-C).
|
|
 |
Discussion |
Pathogenic Yersinia spp. counteract host defense mechanisms by interfering with eukaryotic signal transduction
pathways. In this study, we investigated the impact of Y. enterocolitica on nuclear translocation of NF-
B, which is a
critical regulator of cytokine expression (23), but also plays
an intriguing role in promoting cell survival (24). Our
present data show that Y. enterocolitica strongly impairs activation of NF-
B in eukaryotic cells. In murine J774A.1
and peritoneal macrophages, wild-type Y. enterocolitica initially induced a weak NF-
B signal. This signal was completely abolished after 60 min in J774A.1 macrophages and
almost completely inhibited after 90 min in peritoneal
macrophages, respectively. In contrast, virulence plasmid-
cured yersiniae and LPS promoted persistent NF-
B activation for at least 90 min. Analysis of the cytoplasmic levels
of the inhibitory proteins I
B-
and I
B-
showed that
infection with wild-type yersiniae caused an initial degradation of I
B-
and I
B-
similar to nonvirulent yersiniae
and LPS. After 60-90 min, however, when NF-
B activity was inhibited, the cytoplasmic pools of I
B-
and I
B-
were already completely restored. On the contrary, cells
treated with virulence plasmid-cured yersiniae or with LPS
exhibited a substantial degree of phosphorylation and degradation of I
B-
and I
B-
throughout the time investigated. These results suggest that Y. enterocolitica impairs activation of NF-
B by preventing prolonged phosphorylation and degradation of I
B-
and I
B-
inhibitory proteins.
The fact that the suppression of the NF-
B activity occured after only 60-90 min of infection can be explained
by a delay necessary for Yersinia to exert its effects on the
host cell after host cell contact (1).
To substantiate a possible relation between NF-
B inhibition and induction of apoptosis and blockage of TNF-
production, we checked a set of genetically designed Y. enterocolitica mutants for these activities in J774A.1 cells. Indeed, we found a striking correlation between the abilities
of these strains to inhibit activation of NF-
B, to promote
apoptosis, and to suppress TNF-
production. The strains
capable of inhibiting translocation of NF-
B also efficiently
blocked TNF-
secretion and strongly induced apoptosis.
Conversely, the strains that elicited a strong NF-
B signal
were not able to trigger apoptosis, but generated a marked TNF-
response. The experiments on these strains showed
that inhibition of NF-
B is distinct from the effects mediated by YopH and YopE, but depends on a functional Yop
secretion system. This implies that indeed one or several secreted virulence factors are involved. Recently, the YopP
protein of Y. enterocolitica (YopJ in Y. pseudotuberculosis) was
reported to play a role in the promotion of macrophage apoptosis (20, 21). In this study, we analyzed a Y. enterocolitica
mutant affected in expression of the serine/threonine kinase gene yopO and the cotranscribed yopP. Indeed, this
yopO/yopP double mutant was markedly impaired in its
ability to induce apoptosis. Simultaneously, this mutant was
not as efficient as the wild-type strain to block the secretion
of TNF-
. And, most interestingly, the translocation of
NF-
B was also not as efficiently inhibited. Thus, our data suggest a direct link between activation of NF-
B and cell
survival/TNF-
production, or, conversely, inhibition of
NF-
B and subsequent cell death/TNF-
suppression in
Yersinia-infected macrophages. This coherence was further
confirmed by the finding that inhibition of NF-
B activation by compound MG-132, which selectively blocks the
proteasome pathway, triggered apoptosis and TNF-
suppression in J774A.1 cells treated either with LPS or with
nonvirulent yersiniae. These results suggest a dual function
of NF-
B in macrophages infected with nonvirulent yersiniae, which is prevention of cell death on the one hand,
and induction of TNF-
production on the other. Wild-type yersiniae, by counteracting the activation of NF-
B,
impair cell survival and suppress the macrophage TNF-
production.
The situation in epithelial HeLa cells appears different.
Our previous work showed that HeLa cells do not undergo
apoptotic cell death upon Yersinia infection, in contrast to
macrophages (19). Nevertheless, Yersinia-infected HeLa
cells are severely affected by the actin depolymerizing activity of YopE (19). This indicates that Yersinia also exerts
its effects on HeLa cells, but the response of HeLa cells apparently differs from that of macrophages. Our study demonstrated that wild-type Y. enterocolitica also blocked activation of NF-
B in HeLa cells without triggering apoptosis.
However, when HeLa cells were pretreated with wild-type yersiniae or with the proteasome inhibitor MG-132, subsequent stimulation with the cytokine TNF-
strongly
promoted HeLa cell apoptosis. In line with the fact that the
activity of NF-
B determines the fate of TNF-
-treated
HeLa cells (28, 39), infection with virulent yersiniae substantially suppressed the NF-
B response induced by TNF-
.
This signals the cell to undergo apoptosis.
An essential role of NF-
B in preventing cell death has
been demonstrated for different stimuli, such as TNF-
,
ionizing radiation, or the genotoxic agent daunorubicin
(24). Activation of NF-
B appears to provide protection against apoptotic killing induced by these stimuli (24-
26). TNF-
, which is the best studied agonist of this
group, simultaneously activates cytotoxic and death-preventing pathways. The balance between these two pathways determines the fate of the cell. The pathways that prevent cell death depend on protein synthesis, but not the
cytotoxic pathways (43). NF-
B functions to transcriptionally upregulate a gene or group of genes encoding proteins
that mediate cell survival, such as proteins of the IAP (inhibitor of apoptosis protein) family (44, 45). Y. enterocolitica
suppresses NF-
B activity, which in turn may affect expression of the genes that are necessary for cell survival. This leads to domination of death-inducing pathways and
rapid apoptosis. This concept exactly fits to our previous
finding that Yersinia triggers apoptosis at a level upstream or
apart from the actual core apoptotic program (caspase activities) activated by death-inducing pathways (19). Furthermore, this mechanism explains why Y. enterocolitica triggers
apoptosis not only in macrophages, but also in epithelial
HeLa cells, provided that the appropriate death signal
(TNF-
in our experiments) is present. Interestingly, LPS
alone appears to be sufficient to signal the macrophage to
undergo apoptosis if activation of NF-
B is blocked by the
proteasome inhibitor MG-132. Cell death under these
conditions is not mediated by traces of TNF-
secreted by
the macrophage, since increasing amounts of TNF-
-neutralizing antibodies added to the medium did not reduce
the rate of apoptosis (data not shown). This finding confirms that even during treatment with LPS, activation of
NF-
B is indispensable for cell survival.
The signaling pathways that induce programmed cell
death under conditions where NF-
B is inhibited are less
clear. Several lines of evidence indicate that MAPK modules are involved in the activation of apoptosis-inducing
pathways (46). The MAPK and NF-
B signaling systems represent two distinct but interactive signal transduction pathways (39, 51) and it may be possible that apoptosis
by Yersinia requires inhibition of NF-
B, as well as activation of MAPK cascades. Indeed, we found that Yersinia infection initially activates the macrophage MAPK pathways
p38, ERK, and JNK (14). Using drugs that are presently
available and selectively block MAPK activities (SB203580,
PD098059), we analyzed the role of p38 and ERK in Yersinia-macrophage interaction. Our experiments showed
that these drugs did not prevent cell death mediated by
wild-type Yersinia, which indicates that p38 and ERK are
at least not crucially implicated in Yersinia-induced apoptosis. On the other hand, these two compounds cumulatively
blocked the J774A.1 cell TNF-
production induced by
virulence plasmid-cured yersiniae without interfering with
activation of NF-
B. This proves that besides NF-
B, the
p38 and ERK MAPK pathways are also involved in
J774A.1 cell TNF-
production. Indeed, MAPK as well as
NF-
B signaling pathways play an important role in the
regulation of the macrophage TNF-
production, either at
the transcriptional (NF-
B, ERK, JNK) and/or posttranscriptional level (p38, JNK) (15, 52, 53). Activities of
these pathways contribute to TNF-
production rather additively than competitively, since maximal activation of the
TNF promotor requires at least two cis-acting regulatory
elements, such as NF-
B and c-Jun (52). In agreement with these findings, our results postulate that Y. enterocolitica blocks the macrophage TNF-
production in a bimodal
manner, by inhibiting both the MAPK as well as the NF-
B signaling pathways. The simultaneous affection of the
two signal transduction systems implies that Yersinia mediates blockage of common upstream activators, such as the
signaling cascades of the Ras superfamily of small G proteins, namely Cdc42, Rac-1, and Rho, which are implicated in activation of NF-
B (54), as well as of MAPK
modules (55). Studies addressing this question are presently
underway.
In summary, our study provides new insights into the
mechanisms by which Y. enterocolitica subverts eukaryotic
cells and modulates the immune response of the host. Y. enterocolitica interferes with the activation of transcription
factor NF-
B in eukaryotic cells. This strategy serves to
suppress the TNF-
production of macrophages and contributes to trigger macrophage cell death by apoptosis. Epithelial HeLa cells undergo apoptosis upon Yersinia infection
only when the cytokine TNF-
is present simultaneously. Since yersiniae block the TNF-
secretion in vivo, this
may indicate a strategy of Yersinia to focus apoptosis selectively towards macrophages, whereas nonphagocytic cells
escape programmed cell death due to Yersinia infection.
Address correspondence to K. Ruckdeschel, INSERM U431, Université Montpellier II, CC100, F-34095
Montpellier Cedex 05, France. Phone: 33-4-67-14-42-44; Fax: 33-4-67-14-33-38; E-mail: rouot{at}crit.univ-montp2.fr
Received for publication 23 October 1997 and in revised form 20 January 1998.
We thank Dr. J.C. Lee (SmithKline Beecham) for the gift of SB 203580 and Drs. Jacques Dornand, Astrid
Haeffner, François Hirsch, Brigitte Kahn-Perles, Jean Imbert, Christian Roy, and Marie-Luce Vignais for interesting discussions. We are grateful to Sophie Lotersztajn for her suggestion to use the MG-132 proteasome inhibitor.
This work was supported by grant ARC 6497 from the Association pour la Recherche contre le Cancer, by
grant CHRX-CT94-0451 of the Human Capital and Mobility Program from the European Union, by grant
SFB 217 from the Deutsche Forschungsgemeinschaft, and by the French-German exchange program PROCOPE. K. Ruckdeschel was supported by a postdoctoral fellowship from the Fondation pour la Recherche
Médicale and by the Bundesministerium für Forschung und Technologie. B. Rouot was supported by a fellowship from OECD (Biological Resource Management for Sustainable Agricultural Systems).
| 1.
|
Cornelis, G.R., and
H. Wolf-Watz.
1997.
The Yersinia Yop
virulon: a bacterial system for subverting eukaryotic cells.
Mol. Microbiol.
23:
861-867
[Medline].
|
| 2.
|
Simonet, M.,
S. Richard, and
P. Berche.
1990.
Electron microscopic evidence for in vivo extracellular localisation of
Yersinia pseudotuberculosis harboring the pYV plasmid.
Infect.
Immun.
58:
841-854
[Abstract/Free Full Text].
|
| 3.
|
Heesemann, J.,
U. Gross,
N. Schmidt, and
R. Laufs.
1986.
Immunochemical analysis of plasmid-encoded proteins released by enteropathogenic Yersinia sp. grown in calcium-deficient media.
Infect. Immun.
54:
561-567
[Abstract/Free Full Text].
|
| 4.
|
Straley, S.C.,
G.V. Plano,
E. Skrzypek, and
J.B. Bliska.
1993.
Yops of Yersinia spp. pathogenic for humans.
Infect. Immun.
61:
3105-3110
[Free Full Text].
|
| 5.
|
Bliska, J.B.,
J.E. Galán, and
S. Falkow.
1993.
Signal transduction in the mammalian cell during bacterial attachment and
entry.
Cell.
73:
903-920
[Medline].
|
| 6.
|
Rosqvist, R.,
I. Bölin, and
H. Wolf-Watz.
1988.
Inhibition
of phagocytosis in Yersinia pseudotuberculosis: a virulence plasmid-encoded ability involving the Yop2b protein.
Infect. Immun.
56:
2139-2143
[Abstract/Free Full Text].
|
| 7.
|
Rosqvist, R.,
A. Forsberg,
M. Rimpiläinen,
T. Bergman, and
H. Wolf-Watz.
1990.
The cytotoxic protein YopE of Yersinia
obstructs the primary host defence.
Mol. Microbiol.
4:
657-667
[Medline].
|
| 8.
|
Rosqvist, R.,
A. Forsberg, and
H. Wolf-Watz.
1991.
Intracellular targeting of the Yersinia YopE cytotoxin in mammalian cells induces actin microfilament disruption.
Infect. Immun.
59:
4562-4569
[Abstract/Free Full Text].
|
| 9.
|
Bliska, J.B., and
D.S. Black.
1995.
Inhibition of the Fc receptor-mediated oxidative burst in macrophages by the Yersinia
pseudotuberculosis tyrosine phosphatase.
Infect. Immun.
63:
681-685
[Abstract].
|
| 10.
|
Ruckdeschel, K.,
A. Roggenkamp,
S. Schubert, and
J. Heesemann.
1996.
Differential contribution of Yersinia enterocolitica
virulence factors to evasion of microbicidal action of neutrophils.
Infect. Immun.
64:
724-733
[Abstract].
|
| 11.
|
Galyov, E.E.,
S. Håkansson,
Å. Forsberg, and
H. Wolf-Watz.
1993.
A secreted protein kinase of Yersinia pseudotuberculosis is
an indispensable virulence determinant.
Nature.
361:
730-732
[Medline].
|
| 12.
|
Nakajima, R., and
R.R. Brubaker.
1993.
Association between
virulence of Yersinia pestis and suppression of gamma interferon and tumor necrosis factor alpha.
Infect. Immun.
61:
23-31
[Abstract/Free Full Text].
|
| 13.
|
Autenrieth, I.B., and
J. Heesemann.
1992.
In vivo neutralization of tumor necrosis factor alpha and interferon-gamma abrogates resistance to Yersinia enterocolitica in mice.
Med. Microbiol. Immunol.
181:
333-338
[Medline].
|
| 14.
|
Ruckdeschel, K.,
J. Machold,
A. Roggenkamp,
S. Schubert,
J. Pierre,
R. Zumbihl,
J.-P. Liautard,
J. Heesemann, and
B. Rouot.
1997.
Yersinia enterocolitica promotes deactivation of
macrophage mitogen-activated protein kinases extracellular
signal-regulated kinase-1/2, p38, and c-Jun NH2-terminal kinase: correlation with its inhibitory effect on tumor necrosis
factor production.
J. Biol. Chem.
272:
15920-15927
[Abstract/Free Full Text].
|
| 15.
|
Lee, J.C.,
J.T. Laydon,
P.C. McDonnell,
T.F. Gallagher,
S. Kumar,
D. Green,
D. McNulty,
M.J. Blumenthal,
J.R. Heys,
S.W. Landvatter, et al
.
1994.
A protein kinase involved in the
regulation of inflammatory cytokine biosynthesis.
Nature.
372:
739-746
[Medline].
|
| 16.
|
Trotta, R.,
P. Kanakaraj, and
B. Perussia.
1996.
Fc R-dependent mitogen-activated protein kinase activation in leukocytes: a common signal transduction event necessary for expression of TNF- and early activation genes.
J. Exp. Med.
184:
1027-1035
[Abstract/Free Full Text].
|
| 17.
|
Zheng, Z.M., and
S. Specter.
1996.
Dynamic production of
tumour necrosis factor- (TNF- ) messenger RNA, intracellular and extracellular TNF- by murine macrophages and
possible association with protein tyrosine phosphorylation of
STAT1 and ERK2 as early signal.
Immunology.
87:
544-550
[Medline].
|
| 18.
|
Rose, D.M.,
B.W. Winston,
E.D. Chan,
D.W.H. Riches,
P. Gerwins,
G.L. Johnson, and
P.M. Henson.
1997.
Fc receptor cross-linking activates p42, p38, and JNK/SAPK mitogen-activated protein kinases in murine macrophages: role for
p42 MAPK in Fc receptor-stimulated TNF- synthesis.
J.
Immunol.
158:
3433-3438
[Abstract].
|
| 19.
|
Ruckdeschel, K.,
A. Roggenkamp,
V. Lafont,
P. Mangeat,
J. Heesemann, and
B. Rouot.
1997.
Interaction of Yersinia enterocolitica with macrophages leads to macrophage cell death
through apoptosis.
Infect. Immun.
64:
4813-4821
.
|
| 20.
|
Monack, D.M.,
J. Mecsas,
N. Ghori, and
S. Falkow.
1997.
Yersinia signals macrophages to undergo apoptosis and YopJ is
necessary for this cell death.
Proc. Natl. Acad. Sci. USA.
94:
10385-10390
[Abstract/Free Full Text].
|
| 21.
|
Mills, S.D.,
A. Boland,
M.-P. Sory,
P.V.D. Smissen,
C. Kerbourch,
B.B. Finlay, and
G.R. Cornelis.
1997.
Yersinia enterocolitica induces apoptosis in macrophages by a process requiring functional type III secretion and translocation mechanisms
and involving YopP, presumably acting as an effector protein.
Proc. Natl. Acad. Sci. USA.
94:
12638-12643
[Abstract/Free Full Text].
|
| 22.
|
Zychlinsky, A., and
P. Sansonetti.
1997.
Apoptosis in bacterial pathogenesis.
J. Clin. Invest.
100:
493-495
[Medline].
|
| 23.
|
Baldwin, A.S. Jr..
1996.
The NF- B and I B proteins: new
discoveries and insights.
Annu. Rev. Immunol.
14:
649-681
[Medline].
|
| 24.
|
Beg, A.A., and
D. Baltimore.
1996.
An essential role for NF- B in preventing TNF- -induced cell death.
Science.
274:
782-784
[Abstract/Free Full Text].
|
| 25.
|
Wang, C.-Y.,
M.W. Mayo, and
A.S. Baldwin Jr..
1996.
TNF-
and cancer therapy-induced apoptosis: potentiation by inhibition of NF- B.
Science.
274:
784-787
[Abstract/Free Full Text].
|
| 26.
|
Van Antwerp, D.J.,
S.J. Martin,
T. Kafri,
D.R. Green, and
I.M. Vermat.
1996.
Suppression of TNF- -induced apoptosis by NF- B.
Science.
274:
787-789
[Abstract/Free Full Text].
|
| 27.
|
Wu, M.,
H. Lee,
R.E. Bellas,
S.L. Schauer,
M. Arsura,
D. Katz,
M.J. FitzGerald,
T.L. Rothstein,
D.H. Sherr, and
G.E. Sonenshein.
1996.
Inhibition of NF-kappaB/Rel induces apoptosis of murine B cells.
EMBO (Eur. Mol. Biol. Organ.) J.
15:
4682-4690
[Medline].
|
| 28.
|
Zong, W.-X.,
M. Farrell,
J. Bash, and
C. Gélinas.
1997.
v-Rel
prevents apoptosis in transformed lymphoid cells and blocks
TNF -induced cell death.
Oncogene.
15:
971-980
[Medline].
|
| 29.
|
Thanos, D., and
T. Maniatis.
1995.
NF- B: a lesson in family
values.
Cell.
80:
529-532
[Medline].
|
| 30.
|
Thompson, J.E.,
R.J. Phillips,
H. Erdjument-Bromage,
P. Tempst, and
S. Ghosh.
1995.
I B- regulates the persistent
response in a biphasic activation of NF- B.
Cell.
80:
573-582
[Medline].
|
| 31.
|
Heesemann, J..
1987.
Chromosomal-encoded siderophores
are required for mouse virulence of enteropathogenic Yersinia
species.
FEMS Microbiol. Lett.
48:
229-233
.
|
| 32.
|
Roggenkamp, A.,
S. Schubert,
C.A. Jacobi, and
J. Heesemann.
1996.
Dissection of the Yersinia enterocolitica virulence
plasmid pYVO8 into an operating unit and virulence genes
modules.
FEMS Microbiol. Lett.
134:
69-73
.
|
| 33.
|
Thieblemont, N.,
N. Haeffner-Cavaillon,
A. Haeffner,
B. Cholley,
L. Weiss, and
M.D. Kazatchkine.
1995.
Triggering
of complement receptors CR1 (CD35) and CR3 (CD11b/
CD18) induces nuclear translocation of NF- B (p50/65) in
human monocytes and enhances viral replication in HIV-infected monocytic cells.
J. Immunol.
155:
4861-4867
[Abstract].
|
| 34.
|
Kahn-Perlès, B.,
C. Lipcey,
P. Lécine,
D. Olive, and
J. Imbert.
1997.
Temporal and subunit-specific modulations of the
Rel/NF- B transcription factors through CD28 costimulation.
J. Biol. Chem.
272:
21774-21783
[Abstract/Free Full Text].
|
| 35.
|
Lee, F.S.,
J. Hagler,
Z.J. Chen, and
T. Maniatis.
1997.
Activation of the I B kinase complex by MEKK1, a kinase of
the JNK pathway.
Cell.
88:
213-222
[Medline].
|
| 36.
|
Roggenkamp, A.,
H.-R. Neuberger,
A. Flügel,
T. Schmoll, and
J. Heesemann.
1995.
Substitution of two histidine residues in YadA protein of Yersinia enterocolitica abrogates collagen binding, cell adherence and mouse virulence.
Mol. Microbiol.
16:
1207-1219
[Medline].
|
| 37.
|
Palombella, V.J.,
O.J. Rando,
A.L. Goldberg, and
T. Maniatis.
1994.
The ubiquitin-proteasome pathway is required for
processing the NF- B1 precurser protein and the activation
of NF- B.
Cell.
78:
773-785
[Medline].
|
| 38.
| Rock, K.L., C. Gramm, L. Rothstein, K. Clark, R. Stein, L. Dick, D. Hwang, and A.L. Goldberg. Inhibitors of the proteasome block the degradation of most cell proteins and the
generation of peptides presented on MHC class I molecules.
Cell. 78:761-771.
|
| 39.
|
Liu, Z.,
H. Hsu,
D.V. Goeddel, and
M. Karin.
1996.
Dissection of TNF receptor 1 effector functions: JNK activation is
not linked to apoptosis while NF- B activation prevents cell
death.
Cell.
87:
565-576
[Medline].
|
| 40.
|
Anderson, P..
1997.
Kinase cascades regulating entry into apoptosis.
Microbiol. Mol. Biol. Rev.
61:
33-46
.
[Abstract] |
| 41.
|
Lee, J.C., and
P.R. Young.
1996.
Role of CSBP/p38/RK
stress response kinase in LPS and cytokine signaling mechanisms.
J. Leukocyte Biol.
59:
152-157
[Abstract].
|
| 42.
|
Dudley, D.T.,
L. Pang,
S.J. Decker,
A.J. Bridges, and
A.R. Saltiel.
1995.
A synthetic inhibitor of the mitogen-activated
protein kinase cascade.
Proc. Natl. Acad. Sci. USA.
92:
7686-7689
[Abstract/Free Full Text].
|
| 43.
|
Wallach, D..
1997.
Cell death induction by TNF: a matter of
self control.
Trends Biochem. Sci.
22:
107-109
[Medline].
|
| 44.
|
Chu, Z.-L.,
T.A. McKinsey,
L. Liu,
J.J. Gentry,
M.H. Malim, and
D.W. Ballard.
1997.
Suppression of tumor necrosis factor-induced cell death by inhibitor of apoptosis c-IAP2 is under NF- B control.
Proc. Natl. Acad. Sci. USA.
94:
10057-10062
[Abstract/Free Full Text].
|
| 45.
|
You, M.,
P.-T. Ku,
R. Hrdlickova, and
H.R. Bose Jr..
1997.
ch-IAP1, a member of the inhibitor-of-apoptosis protein
family, is a mediator of the antiapoptotic activity of the v-Rel
oncoprotein.
Mol. Cell. Biol.
17:
7328-7341
[Abstract].
|
| 46.
|
Xia, Z.,
M. Dickens,
J. Raingeaud,
R.J. Davis, and
M.E. Greenberg.
1995.
Opposing effects of ERK and JNK-p38
MAP kinases on apoptosis.
Science.
270:
1326-1331
[Abstract/Free Full Text].
|
| 47.
|
Verheij, M.,
R. Bose,
X.H. Lin,
B. Yao,
W.D. Jarvis,
S. Grant,
M.J. Birrer,
E. Szabo,
L.I. Zon,
J.M. Kyriakis, et al
.
1996.
Requirement for ceramide-initiated SAPK/JNK signalling in stress-induced apoptosis.
Nature.
380:
75-79
[Medline].
|
| 48.
|
Chen, Y.-R.,
Y. Wang,
D. Templeton,
R.J. Davis, and
T.-H. Tan.
1996.
The role of c-Jun N-terminal kinase (JNK) in apoptosis induced by ultraviolet C and radiation: duration of
JNK activation may determine cell death and proliferation.
J.
Biol. Chem.
271:
31929-31936
[Abstract/Free Full Text].
|
| 49.
|
Goillot, E.,
J. Raingeaud,
A. Ranger,
R.I. Tepper,
R.J. Davis,
E. Harlow, and
I. Sanchez.
1997.
Mitogen-activated protein
kinase-mediated Fas apoptotic signaling pathway.
Proc. Natl.
Acad. Sci. USA.
94:
3302-3307
[Abstract/Free Full Text].
|
| 50.
|
Schwenger, P.,
P. Bellosta,
I. Vietor,
C. Basilico,
E.Y. Skolnik, and
J. Vilcek.
1997.
Sodium salicylate induces apoptosis via
p38 mitogen-activated protein kinase but inhibits tumor necrosis factor-induced c-Jun N-terminal kinase/stress-activated
kinase activation.
Proc. Natl. Acad. Sci. USA.
94:
2869-2873
[Abstract/Free Full Text].
|
| 51.
|
Song, H.Y.,
C.H. Régenier,
C.J. Kirsching,
D.V. Goeddel, and
M. Rothe.
1997.
Tumor necrosis factor (TNF)-mediated kinase
cascades: bifurcation of nuclear factor- B and c-jun N-terminal kinase (JNK/SAPK) pathways at TNF receptor-associated factor 2.
Proc. Natl. Acad. Sci. USA.
94:
9792-9796
[Abstract/Free Full Text].
|
| 52.
|
Yao, J.,
N. Mackman,
T.S. Edgington, and
S.-T. Fan.
1997.
Lipopolysaccharide induction of the tumor necrosis factor-
promotor in human monocytic cells: regulation by Egr-1, c-Jun,
and NF- B transcription factors.
J. Biol. Chem.
272:
17795-17801
[Abstract/Free Full Text].
|
| 53.
|
Swantek, J.L.,
M.H. Cobb, and
T.D. Geppert.
1997.
Jun
N-terminal kinase/stress-activated protein kinase (JNK/SAPK)
is required for lipopolysaccharide stimulation of tumor necrosis factor alpha (TNF- ) translation: glucocorticoids inhibit
TNF- translation by blocking JNK/SAPK.
Mol. Cell. Biol.
17:
6274-6282
[Abstract].
|
| 54.
|
Perona, R.,
S. Montaner,
L. Saniger,
I. Sánchez-Pérez,
R. Bravo, and
J.C. Lacal.
1996.
Activation of the nuclear factor- B by
Rho, CDC42, and Rac-1 proteins.
Genes Dev.
11:
463-475
[Abstract/Free Full Text].
|
| 55.
|
Symons, M..
1996.
Rho family GTPases: the cytoskeleton and
beyond.
Trends Biochem. Sci.
21:
178-181
[Medline].
|