Human cytomegalovirus (HCMV) is a ubiquitous herpesvirus that is able to persist for decades
in its host. HCMV has evolved protean countermeasures for anti-HCMV cellular immunity
that facilitate establishment of persistence. Recently it has been shown that HCMV inhibits interferon 
(IFN-)-stimulated MHC class II expression, but the mechanism for this effect is
unknown. IFN- signal transduction (Jak/Stat pathway) and class II transactivator (CIITA) are
required components for IFN--stimulated MHC class II expression. In this study, we demonstrate that both a clinical isolate and a laboratory strain of HCMV inhibit inducible MHC class
II expression at the cell surface and at RNA level in human endothelial cells and fibroblasts. Moreover, reverse transcriptase polymerase chain reaction and Northern blot analyses demonstrate that neither CIITA nor interferon regulatory factor 1 are upregulated in infected cells.
Electrophoretic mobility shift assays reveal a defect in IFN- signal transduction, which was
shown by immunoprecipitation to be associated with a striking decrease in Janus kinase 1 (Jak1)
levels. Proteasome inhibitor studies with carboxybenzyl-leucyl-leucyl-leucine vinyl sulfone
suggest an HCMV-associated enhancement of Jak1 protein degradation. This is the first report
of a mechanism for the HCMV-mediated disruption of inducible MHC class II expression and
a direct virus-associated alteration in Janus kinase levels. These findings are yet another example
of the diverse mechanisms by which HCMV avoids immunosurveillance and establishes persistence.
 |
Introduction |
Human cytomegalovirus (HCMV),1 a ubiquitous betaherpesvirus, causes extensive morbidity and mortality
in neonatal and immunocompromised patients. In these individuals, the majority of HCMV-associated disease is the
result of the spread of latent or persistent virus acquired before immunosuppression (1, 2). Therefore, understanding the
means by which the virus avoids clearance by the immune
system is critical for a complete model of pathogenesis.
The primacy of cell-mediated immunosurveillance in
controlling HCMV infection is established by the prominence of HCMV disease in individuals with impaired cellular immunity (i.e., AIDS patients and transplant recipients) (1, 2). Although cell-mediated immunity can protect
from disease, it rarely clears the virus from the host. Consistent with this ability to persist, HCMV has evolved multiple mechanisms for escape from cellular immune responses. HCMV-infected cells are resistant to NK cell lysis through
surface expression of an MHC class I-like molecule (3, 4),
and HCMV escapes CD8+ T lymphocyte immunosurveillance by decreasing MHC class I expression through the
action of three independent HCMV glycoproteins (5).
Although NK cells and CD8+ T lymphocytes have been
classically shown to be important in controlling HCMV infection, recent in vivo studies have demonstrated an expanded role for CD4+ T lymphocytes in control of replication and clearance of the virus (11). Moreover, the
profound decrease in CD4+ T lymphocytes in AIDS patients frequently results in HCMV pneumonia and retinitis
(1, 2).
CD4+ T lymphocytes recognize antigens presented in
the context of MHC class II molecules, highly polymorphic heterodimers consisting of an 
and 
chain. MHC
class II molecules are expressed constitutively on B cells,
monocytes, dendritic cells, and thymic epithelial cells,
whereas IFN- is the most potent inducer of MHC class II expression in many other cell types, including endothelial
cells (ECs) and fibroblasts (14).
MHC class II expression is controlled predominantly at
the level of transcription (14). IFN- induces MHC class II
expression by activating the Jak/Stat pathway and upregulating class II transactivator (CIITA). CIITA is believed to
activate transcription by interacting with ubiquitous DNA
binding proteins at MHC class II promoters (14). In the
IFN- signal transduction (Jak/Stat) pathway, IFN- binds
to extracellular heterodimeric receptor subunits IFN-R1 and IFN-R2, which are associated intracellularly with the
Janus kinases (Jaks) Jak1 and Jak2, respectively (19, 20).
The binding initiates phosphorylation of tyrosine residues
in Jak1, Jak2, and the cytoplasmic tail of IFN-R1 (21).
Each phosphorylated IFN-R1 chain becomes a docking
site for a member of the family of signal transducers and activators of transcription (Stat), Stat1 (19, 20). After docking at the receptor, Stat1 is phosphorylated by the Jaks
and forms a homodimer known as IFN- activation factor
(GAF) (19, 25, 26). GAF migrates to the nucleus where it
binds the IFN- activation sequence (GAS) elements present in the promoters of IFN--inducible genes (19).
As with NK cell responses and CD8+ T cell immunosurveillance, there is accumulating evidence that HCMV has
evolved a means of escaping CD4+ T cell immunosurveillance as well. HCMV-infected alveolar type II pneumocytes in patients with HCMV pneumonia do not express MHC class II molecules in vivo (27). In vitro studies
demonstrate that IFN- induction of MHC class II expression is impaired in HCMV-infected ECs and fibroblasts
(28). However, the mechanism by which HCMV inhibits IFN--induced MHC class II expression is unknown.
In this study, we investigated IFN--induced MHC
class II expression in HCMV-infected human ECs and fibroblasts. We show that HCMV disrupts IFN- induction
of MHC class II expression by inhibiting the Jak/Stat pathway, a phenomenon associated with decreased Jak1 protein.
| |
Materials and Methods |
Cells.
Human umbilical vein endothelial cells were isolated
from vessels and propagated as previously described (28). ECs
were infected with HCMV strain VHL/E (31). HCMV-infected
ECs were generated by a dispersion method which yields a culture of >95% infected ECs (28). Human embryonic lung fibroblasts (MRC-5), passages 22-35, were cultured in Eagle's minimal essential medium supplemented with 10% fetal bovine serum
(GIBCO BRL, Gaithersburg, MD) at 37°C in a 5% CO2 incubator. HCMV Towne strain was propagated in MRC-5 at low
multiplicity of infection (MOI) with aliquots frozen at 
80°C
and titer determined as described elsewhere (32). In all experiments, Towne HCMV was incubated (MOI: 3) with fibroblasts for 2 h at 37°C and free virus was washed off (time 0). To inhibit HCMV late gene expression, cells were infected with Towne in
the presence of 2 mM phosphonoacetic acid (PFA; Sigma Chemical Co., St. Louis, MO) and 0.6 mM Ganciclovir (GCV; Roche
Labs, Nutley, NJ).
Flow Cytometry.
Cells were harvested with 0.005% trypsin/0.01%
EDTA, stained with FITC-labeled HLA-DR antibody (Genclone,
Plymouth Meeting, PA) or an isotypic IgG1-FITC conjugate
(Becton Dickinson), and analyzed by flow cytometry on an EPICS
Profile II flow cytometer (Coulter Corp., Hialeah, FL) (27, 28).
Northern Blot Analysis.
10 µg of total cytoplasmic RNA, isolated by guanidium thiocyanate extraction and cesium chloride
centrifugation, was separated on a 1.4% agarose/0.22 M formaldehyde gel and transferred to nylon membranes (Hybond-N;
Amersham Corp., Arlington Heights, IL). For Jak1 detection
only, mRNA from 30 × 106 fibroblasts was isolated (Invitrogen
Corp., Carlsbad, CA) and fractionated as above. Random priming (DecaPrime II Kit; Ambion Inc., Austin, TX) of glyceraldehyde phosphate dehydrogenase (GAPDH) and HLA-DR
probes was performed (28). PCR labeling was used for interferon
regulatory factor (IRF) 1, glycoprotein (g)B, immediate early 1 (IE1), and Jak1 probes. In brief, 50 ng of full-length human IRF-1,
gB, IE1, or Jak1 was incubated in a 50-µl PCR reaction containing
IRF-1 primers (IRF-1 sense: 5
CTTCCCTCTTCCACTCGGAGTC 3; IRF-1 antisense: 5 CTGGTCTTTCACCTCCTCGATATCT 3); gB primers (gB sense: 5 CACCAAGTACCCCTATCGCGT 3; gB antisense: 5 TTGTACGAGTTGAATTCGCGC 3); IE1 primers (33); Jak1 primers (Jak1 sense:
5 GAAACTTTGACAAAACATTACGGTGC 3; Jak1 antisense:
5 TCCTTCTTGAGGATCCGATCG 3); dNTP-dCTP; and 700 nM -P32-dCTP (Amersham Corp.). Reaction products were
purified from unincorporated isotope via a Mini Spin G-50 column (Worthington Biochemical Corp., Freehold, NJ), melted,
hybridized, and detected as previously described (28). After hybridization overnight at 42°C, the final wash was carried out at
56°C with 0.2 × SSC and 0.1% SDS for 30 min. Autoradiography was performed with BioMAX MS film (Eastman Kodak Co.,
Rochester, NY) at 80°C for 4-8 h.
Reverse Transcriptase PCR.
10 µg of cytoplasmic RNA was
treated with 10 U RNase-free DNase (Stratagene Inc., La Jolla,
CA) for 30 min at 37°C followed by phenol/chloroform extraction and ethanol precipitation at 80°C. Samples were reverse
transcribed (RT; GIBCO BRL), and one 5-µg aliquot for each
sample served as a no-RT control to control for genomic contamination in subsequent PCR reactions. After heating at 94°C
for 3 min the reaction mixture was cycled 30 times: 1 min at
94°C; 2 min at 60°C; 3 min at 72°C; and a final 10 min elongation step at 72°C. PCR reactions were performed with -actin (540-bp PCR product), CIITA (680-bp PCR product), and
HLA-DR primers (273-bp PCR product) and products were
analyzed on ethidium bromide-stained 2% agarose gels. All PCR
products were cloned into pCRII vector (Invitrogen Corp.) and
sequenced by the dideoxy chain termination method. Primer sets are
as follows: CIITA primers: previously published primers CIITA-2
and CIITA-3 (34); -actin sense primer: 5 GTGGGGCGCCCCAGGCACCA 3; -Actin antisense: 5 CTCCTTAATGTCACGCACGATTTC 3; HLA-DR sense: 5 AAAGCGCTCCAACTATACTCCGA 3; HLA-DR antisense: 5 ACCCTGCAGTCGTAAACGTCC 3.
Electrophoretic Mobility Shift Assay.
Nuclear extracts were prepared by a modification of Dignam et al. (35). 3 µg of nuclear extract was combined with 1 µl of 5× binding buffer, 0.8 µl of poly
(dI-dC), and 1 µl of 32P-labeled IRF-1 GAS element (5 GATCGATTTCCCCGAAATCATG 3) probe (21). The reaction was
incubated at room temperature for 20 min and resolved on a 6%
nondissociating polyacrylamide gel. For controls, 1 µl (100 ng) of
100× cold GAS element probe, 1 µg of Stat1 mAb (Santa Cruz
Biotechnology, Santa Cruz, CA), or 1 µg of IgG1 (DAKO
Corp., Carpinteria, CA) was added to the binding reaction before
the addition of radiolabeled probe for competition and supershift
assays, respectively.
Immunoprecipitation and Western Blot Analysis.
Immunoprecipitation (IP) was performed as previously described (21, 23). For
Stat1, 6 × 106 cells per treatment were lysed in IP lysis buffer
consisting of 1% Triton X-100, 0.15 M NaCl, 50 mM Tris (pH
8.0), 50 mM NaF, 5 mM sodium pyrophosphate, 1 mM PMSF, 1 mM orthovanadate, and 5 µg/ml each of pepstatin, leupeptin,
and aprotinin. Stat1 Ab was added to postnuclear lysates and incubated at 4°C overnight. For Jak1, Jak2, and IFN-R1 IP, 12 × 106 cells per treatment were solubilized in IP lysis buffer. For Jak1
and Jak2, 10 µg of rabbit Ig and protein A-Sepharose (Pharmacia Biotech, Piscataway, NJ) were added to postnuclear lysates and incubated at 4°C overnight. Fresh phosphotyrosine, protease inhibitors, and primary antibodies were added to the precleared lysate, followed by another overnight incubation at 4°C. Immune
complexes were collected with an excess of protein A-Sepharose
(Jak1, Jak2) or protein G-Sepharose (Stat1, IFN-R1) and fractionated under reducing conditions on 7.5% SDS-PAGE (Stat1,
Jak1, and Jak2) or 12% SDS-PAGE (IFN-R1). Equal volumes
of lysates from an equal number of cells were resolved by SDS-PAGE.
For proteasome inhibitor experiments, carboxybenzyl-leucyl-leucyl-leucine vinyl sulfone (Z-L3VS; gift of Hidde Ploegh, MIT, Cambridge, MA) was used as previously described (36). Cells at
48 h after infection were incubated with 50 µM Z-L3VS for 12 h
and lysed for IP. Control cells were treated with an equivalent amount of solvent (DMSO) without Z-L3VS.
Western blot analyses of IP experiments and standard Western
analyses were as follows: Westerns were performed with primary antibodies (1:1,000) Jak1, Jak2, Stat1, and IFN-R1, followed by 1:3,000 anti-rabbit horseradish peroxidase-conjugated IgG
(Santa Cruz Biotechnology) or horseradish peroxidase-conjugated protein (Bio-Rad Laboratories, Hercules, CA), and were
developed using Ultrachemiluminescence (Pierce Chemical Co.,
Rockford, IL). For the standard Western lysates (see Fig. 5 C),
ECs were lysed in 5% SDS, 0.5 M Tris HCl (pH 6.8), 0.5 mM
EDTA, and protease inhibitors. After centrifugation at 15,000 rpm for 15 min, equal volumes of supernatant from an equivalent
number of cells were fractionated by SDS-PAGE and Western
blot analysis was performed as described above.
View larger version (37K):
[in this window]
[in a new window]
View larger version (45K):
[in this window]
[in a new window]
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 5.
IFN--stimulated Jak/Stat signal transduction is inhibited by HCMV. Fibroblasts at 72 h after infection were treated with IFN-, solubilized in a 1% Triton X-100 lysis buffer, and IPs were performed. Immunoprecipitates were divided in half for Western blot analysis of phosphotyrosine
immunoreactivity (A) or Western blot detection of the immunoprecipitated protein (B). (A) IFN- stimulates phosphorylation of Stat1, IFN-R1,
Jak2, and Jak1 in noninfected cells (lane 2), but none of these proteins are phosphorylated in HCMV-infected cells (lane 4). (B) There is an equivalent
amount of Stat1, IFN-R1, and Jak2 protein in noninfected and HCMV-infected cells, but Jak1 protein is decreased in HCMV-infected cells. (C)
Standard SDS lysates from ECs were fractionated by SDS-PAGE and analyzed by Western blot analysis. Jak1 protein is decreased in HCMV-infected cells
in contrast to Stat1.
|
|
| |
Results |
HCMV Inhibits IFN--induced MHC Class II Expression.
We used human ECs and fibroblasts to investigate
the effect of HCMV on IFN--stimulated MHC class II
expression. ECs and fibroblasts are infected by HCMV in
vivo and require IFN- stimulation to upregulate MHC
class II expression (14, 15, 37, 38). We infected ECs with an
EC-tropic clinical isolate, VHL/E, and fibroblasts were infected with a common laboratory strain of HCMV (Towne).
Our previous studies showed that IFN- stimulation of
HCMV-infected ECs did not induce MHC class II expression at the cell surface, in the cytoplasm, or at the RNA
level (28). In this study, our analysis of HCMV-infected fibroblasts yielded similar results. Flow cytometry analysis of
HLA-DR surface expression demonstrated that IFN-
treatment induced MHC class II expression in noninfected
but not in HCMV-infected fibroblasts (Fig. 1 A). UV-inactivated HCMV did not inhibit MHC class II surface
expression, demonstrating that inhibition of IFN--induced
MHC class II expression was dependent upon virus replication (Fig. 1 A). Northern blot analyses of IFN--stimulated
MHC class II RNA expression revealed that noninfected
cells treated with IFN- accumulated HLA-DR mRNA,
whereas HCMV-infected cells did not (Fig. 1 B). Therefore, our findings in fibroblasts paralleled our previous observations in ECs. That is, HCMV inhibits IFN--stimulated MHC class II surface expression and the accumulation
of HLA-DR RNA.
View larger version (50K):
[in this window]
[in a new window]
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1.
IFN--stimulated MHC class II expression is inhibited in
HCMV-infected cells. (A) IFN- does not induce HLA-DR surface expression in HCMV-infected fibroblasts. Shown is a bar graph displaying the mean fluorescent intensity (MFI) of HLA-DR surface expression in
noninfected, sham-infected (inoculated with UV-inactivated HCMV),
and HCMV-infected fibroblasts. Beginning at 12 h after infection, cells
were treated with 200 U/ml IFN- for 72 h. The mean value of three independent experiments is displayed with error bars representing the SEM.
(B) IFN- treatment does not upregulate HLA-DR RNA in HCMV-infected cells. IFN- treatment was identical to that in A. A Northern
analysis is displayed in which IFN--stimulated HLA-DR RNA expression was compared with glyceraldehyde phosphate dehydrogenase
(GAPDH) expression in fibroblasts.
|
|
HCMV Inhibits IFN--induced CIITA Expression.
We
hypothesized that one of two known levels of transcriptional control of MHC class II expression, either the Jak/
Stat pathway or CIITA expression, was nonfunctional
given the lack of IFN--stimulated MHC class II RNA
upregulation in HCMV-infected cells. CIITA, an IFN--induced transcription factor, is required for activation of
MHC class II promoters and transcription of class II genes
(16). We determined the expression of CIITA in HCMV-infected ECs and fibroblasts by RT-PCR. Noninfected
cells treated with IFN- expressed CIITA and HLA-DR
mRNA, whereas HCMV-infected IFN--treated cells did
not (Fig. 2). We next investigated the expression of IRF-1,
an IFN--stimulated gene that plays a central role in regulating MHC class I and II expression in vivo, to determine if HCMV infection globally blocked IFN--stimulated
gene expression (39). IRF-1 RNA was upregulated by
IFN- treatment in noninfected cells but not in HCMV-infected cells (Fig. 3). These data suggested that there was a
general disruption of IFN--stimulated gene expression in
HCMV-infected ECs and fibroblasts.
View larger version (59K):
[in this window]
[in a new window]
View larger version (70K):
[in this window]
[in a new window]
|
Fig. 2.
HCMV abrogates IFN--stimulated CIITA expression.
IFN- treatment was as described for Fig. 1 A. RT-PCR analysis of CIITA expression in noninfected and HCMV-infected fibroblasts (A) and ECs
(B) reveals that IFN--stimulated CIITA expression is inhibited in
HCMV-infected cells.
|
|
HCMV Inhibits IFN--stimulated MHC Class II Expression by Inhibiting IFN- Signal Transduction (Jak/Stat Pathway).
We analyzed IFN--stimulated GAF induction to
determine if HCMV disables inducible MHC class II expression at the level of the Jak/Stat pathway. IFN- induces
GAF, a homodimer of phosphorylated Stat1 proteins, which
binds GAS elements in the promoters of IFN--stimulated
genes and activates transcription (19). IFN--stimulated GAF induction was assayed using electrophoretic mobility
shift assay (EMSA) with the GAS element of the IRF-1
promoter as probe. IFN- induced GAF in noninfected
cells, but not in HCMV-infected fibroblasts and ECs (Fig.
4). The specificity of our probe was verified by supershift
analysis, in which Stat1 antibody, but not an isotypic
IgG1 control, supershifted the GAF-GAS complex. Furthermore, GAF-GAS complex formation was inhibited by
100× GAS competitor (Fig. 4).
View larger version (37K):
[in this window]
[in a new window]
View larger version (41K):
[in this window]
[in a new window]
|
Fig. 4.
IFN--stimulated GAF
formation is inhibited in HCMV-infected cells. At 72 h after infection,
noninfected and HCMV-infected (A)
fibroblasts and (B) ECs were treated
with 200 U/ml IFN- for 30 min and
then nuclear extracts were recovered.
EMSA binding reactions were performed as described in Materials and
Methods. For controls, 100× GAS element competitor, Stat1 Ab, or IgG1 was added to the binding reaction before the addition of radiolabeled probe.
The supershifted GAF-GAS band is
denoted by *. IFN--stimulated GAF
formation is inhibited in infected fibroblasts (A, lane 4) and ECs (B, lane 4).
|
|
The formation of GAF is ultimately dependent on the
upstream signaling events of the IFN- signal transduction
system (Jak/Stat pathway). Stat1, IFN-R1, Jak1, and
Jak2 are phosphorylated on tyrosine residues when IFN-
binds its receptor. We investigated the integrity of this signal transduction pathway by immunoprecipitation. Noninfected and HCMV-infected fibroblasts were treated with
IFN- for 30 min and Stat1, IFN-R1, Jak2, and Jak1
were immunoprecipitated from whole cell lysates. Each
immunoprecipitate was split in half before Western analyses
of phosphotyrosine (Fig. 5 A) or Stat1, IFN-R1, Jak2,
or Jak1 (Fig. 5 B) immunoreactivities. IFN- stimulated tyrosine phosphorylation of Stat1, IFN-R1, Jak2, and Jak1
in noninfected cells, but none of these proteins were phosphorylated in infected cells (Fig. 5 A). Western analyses of
the immunoprecipitated proteins revealed that Stat1,
IFN-R1, and Jak2 were equivalently expressed in noninfected and HCMV-infected cells, whereas there was a dramatic decrease of Jak1 protein in infected cells (Fig. 5 B).
These IP experiments in fibroblasts demonstrated a decrease of Jak1 protein in HCMV-infected cells. To rule out
the possibility that our antibody was cross-reacting with a
protein immunoprecipitated from HCMV-infected cells,
we analyzed Jak1 expression by standard Western analysis
of whole cell lysates. No Jak1 was detected in infected fibroblasts (data not shown). These findings were also extended to HCMV-infected ECs, which had no detectable
Jak1 protein in contrast to Stat1 (Fig. 5 C).
We performed a Northern blot analysis to determine if
the decrease in Jak1 protein in infected cells correlated with
a change in steady state mRNA. The levels of Jak1 mRNA
were equivalent in noninfected and HCMV-infected fibroblasts (Fig. 6), which suggested that JAK-1 was decreased
by a posttranscriptional mechanism.
View larger version (36K):
[in this window]
[in a new window]
|
Fig. 6.
Jak1 protein is decreased by a posttranscriptional
mechanism. mRNA was isolated
from equal numbers of noninfected and HCMV-infected fibroblasts at 72 h after infection, a
time when there is no detectable Jak1 protein. Jak1 mRNA is not
decreased in HCMV-infected
cells despite the decrease of Jak1
protein at this time point.
|
|
Recent investigations have demonstrated that the posttranscriptional decrease in MHC class I heavy chains in infected cells was mediated by the proteasome, a multicatalytic proteolytic complex (5, 6, 36). We tested whether
HCMV targeted Jak1 for degradation by a similar mechanism using the proteasome inhibitor Z-L3VS, which covalently inhibits the trypsin-like, chymotrypsin-like, and
peptidyl-glutamyl peptidase activities of the proteasome
(36). Noninfected fibroblasts and HCMV-infected fibroblasts were treated either with solvent alone (DMSO) or
Z-L3VS for 12 h, and Jak1 was immunoprecipitated. By
Western analysis, Z-L3VS treatment increased the steady
state levels of the Jak1 protein in HCMV-infected fibroblasts (Fig. 7). The specificity of this finding was confirmed by the absence of Jak1 immunoreactivity in the presence of
a blocking peptide. These results suggest that the posttranscriptional decrease of Jak1 protein in infected cells was
mediated by a degradative process involving the proteasome.
View larger version (13K):
[in this window]
[in a new window]
|
Fig. 7.
Jak1 is degraded in infected cells. Noninfected and HCMV-infected fibroblasts at 48 h after infection were treated with solvent (DMSO) or Z-L3VS for 12 h. After Z-L3VS treatment, equal numbers of
cells were lysed and Jak1 was immunoprecipitated. There is an increase in
steady state levels of Jak1 protein in HCMV-infected cells treated with
Z-L3VS (lane 4).
|
|
HCMV Immediate-early or Early Genes Inhibit Inducible
MHC Class II Expression.
HCMV has the second largest
genome of the herpesvirus family, encoding >200 proteins
that are expressed in a temporal fashion, e.g., immediate-early (IE), early (E), and late (L). We examined the role of
late genes in inhibiting IFN--stimulated MHC class II expression using phosphonoformic acid (PFA) and GCV, inhibitors of HCMV DNA polymerase. HCMV infection in
the presence of PFA/GCV inhibited the L gene product
gB, without inhibiting IE1 gene expression (Fig. 8 A).
IFN--stimulated GAF formation was inhibited in the presence of these inhibitors (Fig. 8 B). This finding was
consistent with the hypothesis that HCMV IE and/or E
genes, but not L genes, inhibit IFN--stimulated signal
transduction and MHC class II expression.
View larger version (22K):
[in this window]
[in a new window]
View larger version (50K):
[in this window]
[in a new window]
|
Fig. 8.
HCMV IE and/or E genes, but not L genes, inhibit IFN-
signaling. (A) Northern analysis shows that PFA and GCV treatment inhibits the expression of an L gene, gB, but not IE gene expression in HCMV-infected fibroblasts. (B) At 72 h after infection, HCMV-infected fibroblasts,
and HCMV-infected fibroblasts treated with PFA/GCV were stimulated
with 200 U/ml IFN- for 30 min, nuclear extracts were recovered, and
EMSA was performed. HCMV infection inhibits IFN--stimulated GAF
formation under conditions where only IE and E genes are expressed
(lane 6).
|
|
| |
Discussion |
The studies presented here are the first to reveal a mechanism for HCMV inhibition of MHC class II expression.
Specifically, we found that IFN--stimulated signal transduction (Jak/Stat pathway) is disabled in infected cells. Jak/
Stat signaling is the most proximal of the levels required for
the induction of MHC class II expression, and its disruption prevents the upregulation of CIITA and activation of
MHC class II transcription (Fig. 9).
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 9.
Model for HCMV inhibition of IFN--stimulated MHC
class II expression. HCMV IE and/or E genes disable Jak/Stat signal
transduction by decreasing Jak1 expression, which inhibits IFN--stimulated signal transduction. Inhibiting IFN- signaling prevents the upregulation of CIITA and protein-protein interactions between CIITA and
class II promoter binding proteins that are believed to be required for
MHC class II transcription.
|
|
Fibroblasts and ECs are major targets of CMV infection
in vivo (37, 38, 40). ECs play a particularly important
role in CMV pathobiology, not only as reservoirs of persistence but as critical components of the dissemination pathway involving circulating leukocytes (43, 44). However,
ECs also play a vital role in inflammatory responses, and as
such are poised to interact as inducible antigen-presenting
cells with leukocytes. Therefore, it is important for HCMV-infected ECs to escape cell-mediated immunosurveillance
and persist by inhibiting expression of MHC molecules. It
has been shown that HCMV decreases MHC class I expression on ECs, for which several mechanisms have been
recently uncovered (5). Similarly, we have previously
demonstrated that HCMV inhibits IFN--mediated MHC
class II induction on ECs (27), and that this inhibition
occurs at the same time after infection as the decrease in
constitutive MHC class I (data not shown).
Inhibition of IFN- upregulation of MHC class II expression has coevolved in divergent viruses including
mouse hepatitis virus, HIV-1, Kirsten murine sarcoma virus, and measles virus, suggesting that escape from CD4+ T
lymphocyte immunosurveillance provides a survival advantage to the pathogen (45, 46). CD4+ T cells augment
CD8+ T lymphocyte and B lymphocyte responses to viral
infection. There is significant evidence that CD4+ T cells
can control CMV infection independent of the CD8+ T
cell subset: mice depleted of CD8+ T cells halt CMV dissemination with similar kinetics to immunocompetent mice (13), and clearance of CMV from select organs is
completely dependent upon the CD4+ T cell subset (12,
47). A direct role for CD4+ T cells in anti-CMV activity is
supported by the findings of CMV-specific class II-restricted
cytolysis and direct antiviral effects of the CD4+ T lymphocyte cytokine mileu, specifically IFN- (11, 12, 48- 50). The release of cytokines from CMV-specific CD4+ T
cells has significant direct and immunoregulatory anti-CMV effects in vivo and in vitro (11, 51, 52). Our results
suggest that HCMV may inhibit these direct and indirect
IFN- antiviral effects by knocking out IFN- responses at
their most proximal point, the level of IFN- signal transduction.
IFN- signal transduction is dependent upon the function of Jak1 (53). In mutant cell lines lacking this protein,
IFN--stimulated tyrosine phosphorylation of IFN-R1,
Jak1, Jak2, and Stat1 is inhibited (53). This pattern of
phosphorylation is analogous to what we found in HCMV-infected cells (Fig. 5), suggesting that the HCMV-associated posttranscriptional decrease in Jak1 protein results in
inhibition of IFN--stimulated MHC class II expression. Northern analysis of Jak1 mRNA in infected cells revealed
steady state levels equivalent to those in noninfected cells.
This data, in conjunction with experiments with the proteasome inhibitor Z-L3VS, suggest that increased degradation by the proteasome complex is at least partly responsible for the decrease in Jak1 protein.
Lastly, we found that CMV IE and/or E genes inhibit
IFN--stimulated MHC class II expression by disrupting
IFN--mediated Jak/Stat signal transduction. CMV IE and
E genes mediate the majority of known HCMV immunoregulatory effects. They downregulate MHC class I expression (5), inhibit the transporter associated with antigen
processing (54), and encode an MHC class I homologue (3, 4).
In conclusion, we have demonstrated that HCMV inhibits inducible MHC class II expression in ECs and fibroblasts by disabling IFN- stimulated signal transduction. To
our knowledge, this is the first report of a mechanism for
the HCMV-mediated disruption of inducible MHC class II
expression and the first report of a direct virus-associated
alteration in Janus kinase levels. These findings are yet another example of the diverse mechanisms by which HCMV,
and thus viruses in general, are capable of avoiding immunosurveillance and establishing persistence.
| 1.
| Ho, M. 1991. Cytomegalovirus: Biology and Infection, 2nd
Ed. Plenum Medical Book Company, New York. 353 pp.
|
| 2.
| Britt, W.J., and C.A. Alford. 1996. Cytomegalovirus. In
Fields Virology. B.N. Fields, D.M. Knipe, and P.M. Howley, editors. Lippincott-Raven Publishers, Philadelphia. 2493-
2523.
|
| 3.
|
Reyburn, H.T.,
O. Mandelboim,
M. Vales-Gomez,
D.M. Davis,
L. Pazmany, and
J.L. Strominger.
1997.
The class I
MHC homologue of human cytomegalovirus inhibits attack by natural killer cells.
Nature
386:
514-517
[Medline].
|
| 4.
|
Farrell, H.E.,
H. Vally,
D.M. Lynch,
P. Fleming,
G.R. Shellam,
A.A. Scalzo, and
N.J. Davis-Poynter.
1997.
Inhibition of natural killer cells by a cytomegalovirus MHC class I homologue in vivo.
Nature.
386:
510-514
[Medline].
|
| 5.
|
Wiertz, E.,
D. Tortorella,
M. Bogyo,
J. Yu,
W. Mothes,
T.R. Jones,
T.A. Rapoport, and
H.L. Ploegh.
1996.
Sec61-mediated transfer of a membrane protein from the endoplasmic reticulum to the proteasome for destruction.
Nature.
384:
432-438
[Medline].
|
| 6.
|
Wiertz, E.,
T.R. Jones,
L. Sun,
M. Bogyo,
H.J. Geuze, and
H.L. Ploegh.
1996.
The human cytomegalovirus US11 gene
product dislocates MHC class I heavy chains from the endoplasmic reticulum to the cytosol.
Cell.
84:
769-779
[Medline].
|
| 7.
|
Ahn, K.,
A. Angulo,
P. Ghazal,
P.A. Peterson,
Y. Yang, and
K. Fruh.
1996.
Human cytomegalovirus inhibits antigen presentation by a sequential multistep process.
Proc. Natl. Acad.
Sci. USA.
93:
10990-10995
[Abstract/Free Full Text].
|
| 8.
|
Jones, T.R.,
E.J. Wiertz,
L. Sun,
K.N. Fish,
J.A. Nelson, and
H.L. Ploegh.
1996.
Human cytomegalovirus US3 impairs
transport and maturation of major histocompatibility complex class I heavy chains.
Proc. Natl. Acad. Sci. USA.
93:
11327-11333
[Abstract/Free Full Text].
|
| 9.
|
Jones, T.R., and
L. Sun.
1997.
Human cytomegalovirus US2
destabilizes major histocompatibility complex class I heavy
chains.
J. Virol
71:
2970-2979
[Abstract].
|
| 10.
|
Warren, A.P.,
D.H. Ducroq,
P.J. Lehner, and
L.K. Borysiewicz.
1994.
Human cytomegalovirus-infected cells have
unstable assembly of major histocompatibility complex class I
complexes and are resistant to lysis by cytotoxic T lymphocytes.
J. Virol
68:
2822-2829
[Abstract/Free Full Text].
|
| 11.
|
Davignon, J.-L.,
P. Castanie,
J.A. Yorke,
N. Gautier,
D. Clement, and
C. Davrinche.
1996.
Anti-human cytomegalovirus activity of cytokines produced by CD4+ T-cell clones
specifically activated by IE1 peptides in vitro.
J. Virol
70:
2162-2169
[Abstract].
|
| 12.
|
Lucin, P.,
I. Pavic,
B. Polic,
S. Jonjic, and
U.H. Koszinowski.
1992.
Gamma interferon-dependent clearance of cytomegalovirus infection in salivary glands.
J. Virol.
66:
1977-1984
[Abstract/Free Full Text].
|
| 13.
|
Jonjic, J.V.,
I. Pavic,
P. Lucin,
D. Rukavina, and
U.H. Koszinowski.
1990.
Efficacious control of cytomegalovirus infection after long-term depletion of CD8+ T lymphocytes.
J.
Virol.
64:
5457-5464
[Abstract/Free Full Text].
|
| 14.
|
Boss, J.M..
1997.
Regulation of transcription of MHC class II
genes.
Curr. Opin. Immunol
9:
107-113
[Medline].
|
| 15.
|
Loh, J.E.,
C.-H. Chang,
W.L. Fodor, and
R.A. Flavell.
1992.
Dissection of the interferon--MHC class II signal transduction pathway reveals that type I and type II interferon systems
share common signaling components.
EMBO (Eur. Mol. Biol.
Organ.) J.
11:
1351-1363
[Medline].
|
| 16.
|
Steimle, V.,
C.-A. Siegrist,
A. Mottet,
B. Lisowska-Grospierre, and
B. Mach.
1994.
Regulation of MHC class II expression
by interferon- mediated by the transactivator gene CIITA.
Science.
265:
106-109
[Abstract/Free Full Text].
|
| 17.
|
Jabrabe-Ferrat, N.,
J.D. Fontes,
J.M. Boss, and
B.M. Peterlin.
1996.
Complex architecture of major histocompatibility
complex class II promoters: reiterated motifs and conserved
protein-protein interactions.
Mol. Cell. Biol
16:
4683-4690
[Abstract].
|
| 18.
|
Moreno, C.S.,
P. Emery,
J.E. West,
B. Durand,
W. Reith,
B. Mach, and
J.M. Boss.
1995.
Purified X2 binding protein
(X2BP) cooperatively binds the class II MHC X box region
in the presence of purified RFX, the X box factor deficient
in the bare lymphocyte syndrome.
J. Immunol
155:
4313-4321
[Abstract].
|
| 19.
|
Darnell, J.E.,
I.M. Kerr, and
G.R. Stark.
1994.
Jak-Stat pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins.
Science.
264:
1415-1421
[Abstract/Free Full Text].
|
| 20.
|
Hibino, Y.,
C.S. Kumar,
T.M. Mariano,
D. Lai, and
S. Pestka.
1992.
Chimeric interferon- receptors demonstrate
that an accessory factor required for activity interacts with the
extracellular domain.
J. Biol. Chem
267:
3741-3749
[Abstract/Free Full Text].
|
| 21.
|
Kotenko, S.V.,
L.S. Izotova,
B.P. Pollack,
T.M. Mariano,
R.J. Donnelly,
G. Muthukumaran,
J.R. Cook,
G. Garotta,
O. Silvennoinen,
J.N. Ihle, and
S. Pestka.
1995.
Interaction between the components of the interferon- receptor complex.
J. Biol. Chem
270:
20915-20921
[Abstract/Free Full Text].
|
| 22.
|
Bach, E.A.,
J.W. Tanner,
S. Marsters,
A. Ashkenazi,
M. Aguet,
A.S. Shaw, and
R.D. Schreiber.
1996.
Ligand-induced assembly and activation of the gamma interferon receptor in
intact cells.
Mol. Cell. Biol
16:
3214-3221
[Abstract].
|
| 23.
|
Sakatsume, M.,
K. Igarashi,
K.D. Winestock,
G. Garotta,
A. Larner, and
D.S. Finbloom.
1995.
The Jak kinases differentially associate with the and (accessory factor) chains of
the interferon receptor to form a functional receptor unit
capable of activating STAT transcription factors.
J. Biol.
Chem
270:
17528-17534
[Abstract/Free Full Text].
|
| 24.
|
Watling, D.,
D. Guschin,
M. Muller,
O. Silvennoinen,
B.A. Witthuhn,
F.W. Quelle,
N.C. Rogers,
C. Schindler,
G.R. Stark,
J.N. Ihle, and
I.M. Kerr.
1993.
Complementation by
the protein tyrosine kinase Jak2 of a mutant cell line defective in the interferon- signal transduction pathway.
Nature
336:
166-170
.
|
| 25.
|
Ihle, J.N.,
B.A. Witthuhn,
F.W. Quelle,
K. Yamamoto, and
O. Silvennoinen.
1995.
Signaling through the hematopoietic
cytokine receptors.
Annu. Rev. Immunol
13:
369-398
[Medline].
|
| 26.
|
Schindler, C., and
J.E. Darnell.
1995.
Transcriptional responses to polypeptide ligands: the Jak-Stat pathway.
Annu. Rev. Biochem
64:
621-651
[Medline].
|
| 27.
|
Ng-Bautista, C.L., and
D.D. Sedmak.
1995.
Cytomegalovirus infection is associated with absence of alveolar epithelial
cell HLA class II antigen expression. 1995.
J. Infect. Dis
171:
39-44
[Medline].
|
| 28.
|
Sedmak, D.D.,
A.M. Guglielmo,
D.A. Knight,
D.J. Birmingham,
E.H. Huang, and
W.J. Waldman.
1994.
Cytomegalovirus inhibits major histocompatibility class II expression on infected endothelial cells.
Am. J. Pathol
144:
683-692
[Abstract].
|
| 29.
|
Knight, D.A.,
W.J. Waldman, and
D.D. Sedmak.
1997.
Human cytomegalovirus does not induce human leukocyte antigen class II expression on arterial endothelial cells.
Transplantation
63:
1366-1369
[Medline].
|
| 30.
|
Scholz, M.,
A. Hamann,
R.A. Blaheta,
M.K.H. Auth,
A. Encke, and
B.H. Markus.
1992.
Cytomegalovirus and interferon related effects on human endothelial cells.
Hum. Immunol
35:
230-238
[Medline].
|
| 31.
|
Waldman, W.J.,
W.H. Roberts,
D.H. Davis,
M.V. Williams,
D.D. Sedmak, and
R.E. Stephens.
1991.
Preservation of natural endothelial cytopathogenicity of cytomegalovirus by propagation in endothelial cells.
Arch. Virol
117:
143-164
[Medline].
|
| 32.
|
Huang, E.-S..
1975.
Human cytomegalovirus. III. Virus-induced DNA polymerase.
J. Virol
16:
298-310
[Abstract/Free Full Text].
|
| 33.
|
Stenberg, R.A.,
D.R. Thomsen, and
M.F. Stinski.
1984.
Structural analysis of the major immediate early gene of human cytomegalovirus.
J. Virol
49:
190-199
[Abstract/Free Full Text].
|
| 34.
|
Brown, J.A.,
X.-F. He,
S.D. Westerheide, and
J.M. Boss.
1995.
Characterization of the expressed CIITA allele in the
class II MHC transcriptional mutant RJ2.2.5.
Immunogenetics.
43:
88-91
.
|
| 35.
|
Dignam, J.D.,
R.M. Lebovitz, and
R.G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids
Res
11:
1475-1489
[Abstract/Free Full Text].
|
| 36.
|
Bogyo, M.,
J.S. McMaster,
M. Gaczynska,
D. Tortorella,
A.L. Goldberg, and
H. Ploegh.
1997.
Covalent modification
of the active site threonine of proteasomal subunits and the
Escherichia coli homolog HsIV by a new class of inhibitors.
Proc. Natl. Acad. Sci. USA.
94:
6629-6634
[Abstract/Free Full Text].
|
| 37.
|
Percivalle, E.,
M.G. Revello,
L. Vago,
F. Morini, and
G. Gerna.
1993.
Circulating endothelial giant cells permissive for
human cytomegalovirus (HCMV) are detected in disseminated HCMV infections with organ development.
J. Clin. Invest
92:
663-670
.
|
| 38.
|
Sinzger, C.,
A. Grefte,
B. Plachter,
A.S.H. Gouw,
T.H. The, and
G. Jahn.
1995.
Fibroblasts, epithelial cells, endothelial
cells, and smooth muscle cells are major targets of human cytomegalovirus infection in lung and gastrointestinal tissues.
J.
Gen. Virol
76:
741-750
[Abstract/Free Full Text].
|
| 39.
|
Hobart, M.,
V. Ramassar,
N. Goes,
J. Urmson, and
P.F. Halloran.
1997.
IFN regulatory factor1 plays a central role in the
regulation of the expression of class I and II MHC genes in
vivo.
J. Immunol
158:
4260-4269
[Abstract].
|
| 40.
|
Ho, D.D.,
T.R. Rota,
C.A. Andrews, and
M.S. Hirsch.
1984.
Replication of human cytomegalovirus in endothelial
cells.
J. Infect. Dis
150:
956-957
[Medline].
|
| 41.
|
Myerson, D.,
R.C. Hackman,
J.A. Nelson,
D.C. Ward, and
J.K. McDougall.
1984.
Widespread presence of histologically
occult cytomegalovirus.
Hum. Pathol
15:
430-439
[Medline].
|
| 42.
|
Lathey, J.L.,
C.A. Wiley,
M.A. Verity, and
J.A. Nelson.
1990.
Cultured human brain capillary endothelial cells are
permissive for infection by human cytomegalovirus.
Virology
176:
266-273
[Medline].
|
| 43.
|
Waldman, W.J.,
D.A. Knight,
E.H. Huang, and
D.D. Sedmak.
1995.
Bidirectional transmission of infectious cytomegalovirus between monocytes and vascular endothelial cells: an
in vitro model.
J. Infect. Dis
171:
263-272
[Medline].
|
| 44.
|
Fish, K.N.,
S.G. Stenglein,
C. Ibanez, and
J.A. Nelson.
1995.
Cytomegalovirus persistence in macrophages and endothelial
cells.
Scand. J. Infect. Dis
99:
34-40
.
|
| 45.
|
Maudsley, D.J., and
A.G. Morris.
1989.
Regulation of IFN-
induced host cell MHC antigen expression by Kirsten MSV and MLV.
Immunology.
67:
26-31
[Medline].
|
| 46.
|
Rinaldo, C.R..
1994.
Modulation of major histocompatibility complex antigen expression by viral infection.
Am. J. Pathol
144:
637-650
[Medline].
|
| 47.
|
Jonjic, S.,
W. Mutter,
F. Weiland,
M.J. Reddehause, and
U.H. Koszinowski.
1989.
Site-restricted persistent cytomegalovirus infection after selective long-term depletion of CD4+
T lymphocytes.
J. Exp. Med
169:
1199-1212
[Abstract/Free Full Text].
|
| 48.
|
Muller, D.,
B.H. Koller,
J.L. Whitton,
K.E. Lapan,
K.K. Brigman, and
J.A. Frelinger.
1992.
LCMV-specific class II-
restricted cytotoxic T cells in b-2 microglobulin-deficient mice.
Science
255:
1576-1578
[Abstract/Free Full Text].
|
| 49.
|
Lindsley, M.D.,
D.J. Torpey, and
C.R. Rinaldo.
1986.
HLA-DR restricted cytotoxicity of cytomegalovirus infected
monocytes mediated by Leu-3 positive T cells.
J. Immunol
136:
3045-3051
[Abstract].
|
| 50.
|
Hengel, H.,
P. Lucin,
S. Jonjic,
T. Ruppert, and
U.H. Koszinowski.
1994.
Restoration of cytomegalovirus antigen presentation by gamma interferon combats viral escape.
J. Virol
68:
289-297
[Abstract/Free Full Text].
|
| 51.
|
Geginat, G.,
T. Ruppert,
H. Hengel,
R. Holtappels, and
U.H. Koszinowski.
1997.
IFN- is a prerequisite for optimal
antigen processing of viral peptides in vivo.
J. Immunol
158:
3303-3310
[Abstract].
|
| 52.
|
Orange, J.S.,
B. Wang,
C. Terhorst, and
C.A. Biron.
1995.
Requirement for natural killer cell-produced interferon- in
defense against murine cytomegalovirus infection and enhancement of this defense pathway by interleukin 12 administration.
J. Exp. Med
182:
1045-1056
[Abstract/Free Full Text].
|
| 53.
|
Muller, M.,
J. Briscoe,
C. Laxton,
D. Guschin,
A. Ziemiecki,
O. Silvennoinen,
A.G. Harpur,
G. Barbieri,
B.A. Witthuhn,
C. Schindler, et al
.
1993.
The protein tyrosine kinase Jak1
complements defects in interferon-/ and - signal transduction.
Nature.
366:
129-135
[Medline].
|
| 54.
|
Kwangseog, A.,
A. Gruhler,
B. Galocha,
T.R. Jones,
E.J.H.J. Wiertz,
H.L. Ploegh,
P.A. Peterson,
Y. Yang, and
K. Fruh.
1997.
The ER-luminal domain of the HCMV glycoprotein
US6 inhibits peptide translocation by TAP.
Immunity
6:
613-621
[Medline].
|
Top
Abstract
Introduction
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
