|
||
Articles |


Biologie moléculaire de gène, Institut National de la Santé et de la Recherche Médicale U277, Institut Pasteur, 75015, Paris, France; and
Laboratoire d'immunologie des pathologies infectieuses et tumorales, Institut Cochin Génétique Moléculaire, Institut National de la Santé et de la Recherche Médicale U445, 75014, Paris, France
| Abstract |
|---|
|
|
|---|
RIIb2 and Fc
RIII, respectively), in the selection of peptides for presentation to T lymphocytes. B lymphoma cells expressing recombinant Fc
RIIb2 or Fc
RIII were used to assess the presentation of several epitopes from two different antigens. 4 out of the 11 epitopes tested were efficiently presented after antigen internalization through Fc
RIIb2 and Fc
RIII. In contrast, the 7 other epitopes were efficiently presented only when antigens were internalized through Fc
RIII, but not through Fc
RIIb2. The capacity to present these latter epitopes was transferred to a tail-less Fc
RIIb2 by addition of the Fc
RIII-associated
chain cytoplasmic tail. Mutation of a single leucine residue at position 35 of the
chain cytoplasmic tail resulted in the selective loss of presentation of these epitopes. Therefore, the nature of the receptor that mediates internalization determines the selection of epitopes presented to T lymphocytes within single protein antigens.
Antigen receptors on CD4+ helper T lymphocytes recognize short peptides presented by class II molecules of MHC (1, 2). Antigenic peptides are generated by proteolytic degradation in the endocytic pathway, where they associate with MHC class II molecules. Only a very limited set of peptides among all the potential peptides is actually loaded onto MHC class II molecules in APCs (3). The mechanisms underlying the selection of peptides for MHC class II–restricted antigen presentation are yet unclear. However, we know that two independent complex processes of intracellular transport towards endosomes are crucial for MHC class II–restricted antigen presentation: the traffic of MHC class II molecules and the delivery of antigens (4, 5).
MHC class II intracellular transport has been analyzed in detail. Newly synthesized MHC class II molecules reach endosomes, either directly from the trans-golgi network or after a short appearance at the plasma membrane, in association to the invariant (Ii)1 chain (5). Ii is then degraded and the class II–associated Ii chain peptide (CLIP) is replaced by an antigenic peptide under the control of HLA-DM (6). It has recently become clear that an alternative, Ii chain–independent pathway for MHC class II transport to endosomes also exists. Indeed, MHC class II molecules may reach the endocytic pathway from the cell surface by endocytosis (7), due to internalization signals present in the cytosolic domain of the MHC class II β chain (8). Newly synthesized and recycling MHC class II molecules may present different peptides (9). Accordingly, we have previously shown that different antigen receptors may also selectively target antigens for presentation by either of these MHC class II presentation pathways (10).
In contrast, very little is known about the endocytic transport of antigen receptors. Physiologically, antigens are delivered to the endocytic pathway by different families of receptors, which strongly increase the efficiency of MHC class II–restricted antigen presentation (11). In B lymphocytes, surface Ig mediates both cell activation and the uptake of specific antigens (12), while the expression of a particular endocytosis-deficient receptor for the Fc portion of IgG (Fc
In monocytes and dendritic cells, receptors for IgG (Fc
To individually analyze the function of these two receptors, we expressed them by cDNA transfection into an Fc
The diversity in the signals required of Fc
Internalization of antigen–antibody complexes through Fc
T Cell Hybridomas.
RIIb1) prevents efficient presentation of irrelevant IgG-complexed antigens (13). Interestingly, the epitope specificity of surface Ig positively and negatively influences the presentation of various T cell epitopes (14, 15).
Rs), in addition to mannose receptors, mediate antigen internalization and strongly increase the efficiency of presentation to specific T cells (16). Two different Fc
Rs, type IIb2 and type III (Fc
RIIb2 and Fc
RIII) are expressed in dendritic cells. Fc
RIIb2 is a monomeric receptor that, like Fc
RIIb1, mediates the inhibition of cell activation when cocrosslinked to surface Ig (13). Fc
III is an heterotrimer consisting of an
chain and a dimer of
chains, which couple the receptor to cytoplasmic effectors of signal transduction (17).
R-negative B cell lymphoma cell line (13, 18, 19). We have previously shown that the amino acid sequence, called immunoreceptor tyrosine kinase activation motif (ITAM), in the Fc
III-associated
chain responsible for cell activation is also involved in receptor internalization (18, 19). In addition, mutation of either of the two tyrosine residues in the ITAM of the
chain inhibits both cell activation and ligand internalization (19). Thus, in contrast to Fc
RIIb2, which contains no ITAM, is not tyrosine phosphorylated, and does not induce cell activation, Fc
RIII associates with and activates cytosolic tyrosine kinases after engagement by its ligand (18). In addition to this functional diversity of the two receptors, their expression is also selectively regulated, since TNF-
and IFN-
increase the expression of Fc
RIII and inhibit that of Fc
RIIb2 in monocytes (20).
RIIb2 and Fc
RIII internalization, as well as the differential regulation of their expression in APCs, suggest that the two receptors may have different antigen-presenting functions. We here examine the ability of Fc
RIIb2 and Fc
RIII to induce the presentation of various T cell epitopes from two different antigens, CI
repressor and hen egg lysozyme (HEL).
RIII induced the efficient presentation of all the T cell epitopes tested, whereas Fc
RIIb2 only induced the presentation of a few. Point mutation of leucine 35 to alanine (L35A) in the cytoplasmic tail of Fc
RIII
chain blocked signal transduction without affecting the internalization of immune complexes. This mutation also blocked the presentation of the epitopes that were only presented after internalization by Fc
RIII. In contrast, the presentation of all the epitopes that were efficiently generated after internalization by Fc
RIIb2 was not affected. Thus, the nature of the receptor that mediates antigen internalization influences the selection of the epitopes presented to T lymphocytes.
![]()
Materials and Methods
Top
Abstract
Materials and Methods
Results
Discussion
References
B Lymphoma Cell Lines.
The B lymphoma IIA1.6 is a type II Fc
R–defective variant of A20 B lymphoma cells (21) that also lacks expression
and
chains of type III Fc
R (18). This cell line was cultured in RPMI 1640 containing 10% FCS, 10 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 50 µM 2-mE, and 5 mM sodium pyruvate (GIBCO, Paisley, UK). Fc
RII–ic
chimeras were constructed by adding the sequences encoding the cytoplasmic domain of the
chain to cDNA encoding the extracellular and transmembrane domains of mouse Fc
II (18). The cDNAs were stably expressed by transfection in the mouse B cell line IIA1.6 as previously described (18). IIAI.6 cells expressing tail minus Fc
RII have been previously described (13). Fc
RII–ic
L35 chimeras were constructed by using PCR with the two complementary oligonucleoides GAGACATATGAGACTGCGAAGCATGAAAAACCA and TGGTTTTTCATGCTTCGCAGTCTCATATGTCTC. They introduced an alanine residue in place of the leucine at position 35 of the cytoplasmic domain of the
chain in the Fc
RII–ic
chimeras. The resulting construction was inserted in expression vectors and sequenced, and cDNA were stably expressed by transfection in the mouse B cell line IIA1.6 as previously described (18). Cell surface expression of Fc
Rs was measured with the rat anti–mouse Fc
RII and III mAb 2.4G2 and revealed by FITC-coupled mouse anti–rat antibodies. The samples were analyzed with a FACScan® flow cytometer (Becton Dickinson, San Jose, CA).
Culturing of the T cell hybridomas and antigen presentation assays were performed in RPMI 1640 containing 10% FCS, 10 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 5 x 10–5 M 2-ME. The specificity of all the CD4+ T cell hybridoma is shown in Table 1. The CI
repressor–specific hybridomas 24.4, A128, 26.1, 9C12, and 4G2 were previously characterized (22–24). The anti-HEL T cell hybridomas B9.1 and CAB43 have been previously described (25), and Ad71, 930B2, G28C9, and 16F2QCOY (3) were obtained from Dr. E. Sercarz (University of California, Los Angeles, CA).
|
repressor or HEL, complexed or not with two mAbs, 22D and 51F, that recognize distinct epitopes on the
repressor (13), or F10.6.14 and F9.13.7, which recognize distinct epitopes on HEL (26). The complexes were preformed by incubating different concentrations of purified
repressor or HEL (from 30,000 ng to 0.5 ng) with 15 µg/ml of each of two different mAbs (51F and 22D or F10.6.14 and F9.13.7) at 37°C for 15 min. The release of IL-2 by the T-cell hybridoma was determined using a CTL.L2 proliferation assay (13). Each point represents the average of duplicate samples, which varied by <5%.
Kinetics analysis was performed as previously described (10). In brief, a dose of antigen (3 µg/ml) was used for which presentation was strictly dependent on immune complex formation with the mAbs. Immune complexes were preformed at 37°C by mixing the purified
repressor with 51F and 22D mAbs, to make a 10x mix in the culture medium. 30 µl of preformed immune complexes were added to 270 µl of APCs adjusted at 2 x 106 cells/ml and incubated at 37°C for different times. The cells were then washed twice with PBS, fixed with 0.05% glutaraldehyde for 20 min on ice, and washed again twice. Fixed cells, in duplicate samples of 100 µl, were added to 50 µl of T cell hybridomas and adjusted to 2 x 106 cells/ml. After 24 h, IL-2 production was tested as above. When indicated, APCs were preincubated for 3 h at 37°C with 10 µg/ml cycloheximide diluted from a stock solution at 10 mg/ml in water. In this case, cycloheximide was also present during the incubation times with preformed immune complexes before fixation with glutaraldehyde.
Ovalbumin immune complexes were made by mixing ovalbumin (15 µg/ml; Sigma Chemical Co., St. Louis, MO) and the IgG fraction of a rabbit antiovalbumin antiserum (50 µg/ml; Sigma Chemical Co.). The binding of these immune complexes to FcRs was controlled by immunofluorescence and FACScan® analysis. For costimulation experiments, APCs were incubated with or without ovalbumin immune complexes for 18 h and then fixed as described above. Fixed cells, in duplicate samples of 100 µl, were added to 50 µl of T cell hybridomas 24.4 and 26.1 (adjusted to 2 x 106 cells/ml) and various concentrations of CI
repressor 12– 26 peptides. In another set of experiments, APCs were incubated either with
repressor (30 µg/ml) and preformed ovalbumin immune complexes to stimulate FcR, or with preformed
repressor immune complexes (as described above) and F(ab')2 fragments of specific goat anti–mouse IgG2a antibodies (15 µg/ml; Southern Biotechnology Associated, Birmingham, AL), which do not cross-react with IgG1 anti-
repressor mAbs 51F and 22D, and which specifically stimulate endogenous membrane IgG2a on IIA1.6 cells. After 18 h, the cells were fixed and incubated with CI
repressor–specific T cell hybridomas 24.4 and 26.1. T cell stimulation was assayed using a CTL.L2 proliferation assay.
Assays for Cell Activation.
Cell activation through Fc receptors or endogenous membrane immunoglobulins was determined as previously described (19). In brief, triplicates of each B lymphoma cell (105 cells/well in 100 µl) were stimulated either through Fc receptors using preformed ovalbumin immune complexes, made as described above, or through endogenous membrane immunoglobulins using F(ab')2 fragments of the IgG fraction of a rabbit anti–mouse IgG antisera (15 µg/ml). After 18 h, the supernatants were harvested and their content in I1-2 was measured using a CTL.L2 proliferation assay.
Immune Complex Internalization.
The internalization of immune complexes was assayed as previously described (19). In brief, the cells were washed once in internalization buffer (RPMI, 5% FCS, 10 mM glutamine, 5 mM sodium pyruvate, 50 mM 2-ME, and 20 mM Hepes, pH 7.4) and incubated with horseradish peroxidase (HRP) anti-HRP immune complexes for 2 h at 0°C (107 cells/ml). Immune complexes were prepared as a 10x solution in internalization buffer (HRP 50 µg/ml and a polyclonal rabbit anti-HRP antibody at 400 µg/ml) for 30 min at 37°C. After fixation of HRP immune complexes, the cells were washed three times in internalization buffer and incubated at 37°C for various times (2 x 106 cells/ml). Internalization was stopped by adding cold internalization buffer and the cells were washed once in PBS. Duplicates of each time point were either left in PBS at 4°C to measure cell surface HRP-ICs or incubated in Triton X-100 (0.1%) for 5' at room temperature to measure the total amount of HRP-ICs. The HRP was revealed by adding substrate buffer (0.5 mg/ml OPD [Sigma Chemical Co.] and 0.12% H2O2 in 0.05 M phospho-citrate buffer, pH 5.0) at 4°C. The reaction was stopped with 6 N HCl and the change in color was determined spectrophotometrically at 492 nm.
| Results |
|---|
|
|
|---|
RIII.
RIIb2 and III in IIA1.6 cells (an Fc
R-negative B lymphoma cell line derived from A20 cells) induces presentation of the dominant epitope of the CI
repressor (12–26 peptide on IAd) at antigen concentrations 102–104-fold lower than fluid phase uptake (13, 19). This increase in the efficiency of antigen presentation is, at least in part, due to increased antigen uptake by the APCs since endocytosis-incompetent receptors for IgG (13, 19) were deficient for both internalization of immune complexes and efficient presentation at low antigen concentrations. Although these results underline the importance of internalization in antigen presentation, they do not address the possibility that postinternalization intracellular targeting of antigen–receptor complexes is also important for the generation of certain epitopes. If this was the case, we would then expect that internalization through particular antigen receptors results in the presentation of different epitopes to specific T lymphocytes.
To test this possibility, we assessed the ability of cells expressing either Fc
RIIb2 or Fc
RIII (cells coexpressing the
and
chains, which we have previously shown to present the 12–26/IAd epitope at very low antigen-IgG concentrations) to present another epitope, defined by the same 12–26 in association with I-Ed. This epitope is not presented after fluid phase antigen uptake, or in vivo after immunization with intact antigen (it is therefore a cryptic epitope), but it elicited an immune response when the mice were injected directly with the peptide (22).
The cell lines expressing either Fc
RIIb2 or Fc
RIII were incubated with increasing concentrations of CI
repressor, free or complexed to two different anti-
repressor mAbs, as previously described (13). Complexing antigen to IgG allowed receptor-mediated antigen uptake through Fc
Rs. T cell hybridomas specific for either IAd- or the IEd-restricted epitopes were also included in the cultures. Antigen presentation was assessed by measuring IL-2 secretion by the T cell hybridomas.
As shown in Fig. 1 A, the IEd restricted epitope was not presented after fluid phase uptake (right), whereas the IAdrestricted epitope was presented at high antigen concentrations (left). Confirming our previous results, Fc
RIIb2 increased the efficiency of presentation of the IAd restricted epitope by 3–4 logs when the C1
repressor was complexed to IgGs (T cell activation was still observed at 30 ng/ml). Similarly, Fc
RIII-mediated internalization induced presentation of this epitope at concentrations 30–100-fold lower than fluid phase uptake. Therefore, both type II and III IgG receptors increased the efficiency of presentation of this dominant IAd-restricted epitope.
|
RIII was less efficient than Fc
RIIb2 (Fig. 1 A, compare lower and upper left). This difference was due to the different levels of expression of the two receptors, since Fc
RII and Fc
RIII were expressed at 1.6 x 105 molecules/cell and 2.8 x 104 molecules/cell, respectively (reference 19 and data not shown). When cells expressing 2–3 x 104 Fc
IIb2 per cell were used, the efficiency of presentation was similar to that obtained with Fc
RIII expressing cells (data not shown).
In contrast to this IAd-restricted epitope, the IEd epitope was not presented after Fc
RIIb2-mediated internalization of immune complexes (Fig. 1 A, lower right). In contrast, efficient presentation of 12–26 on IEd was observed with Fc
RIII-expressing cells after internalization of immune complexes (upper right). This selectivity of presentation of the IEd-restricted epitope was not due to a difference between the Fc
RIIb2 and Fc
RIII cell lines in the levels of surface expression of either MHC class II or other costimulatory molecules, because the 12–26 peptide was presented with similar efficiencies to the two T cell hybridomas by the two transfected cell lines (Fig. 1 B). Since engagement of Fc
III by immune complexes may, under certain circumstances (see below), induce IL-2 secretion by A20 and IIA1.6 cells (18, 27), we verified that the CI
repressor immune complexes did not induce any IL-2 secretion in the absence of T cell hybridomas (data not shown).
Therefore, only Fc
RIII-mediated internalization induced presentation of the 12–26 peptide on IEd. Fc
RIIb2, which induced very efficient presentation of the same peptide on IAd, was totally inefficient for the presentation of the IEd-restricted epitope. Therefore, receptor-mediated antigen internalization is not sufficient for presentation of all T cell epitopes; the nature of the receptor mediating antigen uptake influences the selection of epitopes presented to T lymphocytes.
Presentation of the IEd-restricted Epitope Requires the Fc
RIII-associated
Chain.
We have shown previously that both the internalization and the increased efficiency of presentation of the IAd/12–26 dominant epitope in the CI
repressor were dependent on the Fc
RIII-associated
chains (19). Thus, Fc
RIII with a cytoplasmic domain–deleted
chain did not internalize ligand or promote antigen presentation at low concentrations. In addition, when the cytoplasmic domain of the
chain was fused to the extracellular and transmembrane domains of Fc
RIIb2, cell activation, immune complex internalization, and efficient antigen presentation were observed (19). Therefore, we next sought to assess if the presentation of 12–26 on IEd was also dependent on the Fc
RIII-associated
chain.
As expected, the tail-less Fc
RIIb2, which was not internalized, did not allow the efficient presentation of the two epitopes (Fig. 2 A, lower panels). In contrast, when the cytoplasmic tail of the
chain was fused to this tail-less receptor to form an Fc
RII/ic
chimera, efficient presentation of both IAd/12–26 and IEd/12–26 was observed after immune complex internalization (Fig. 2 A, upper panels). The cell lines expressing the tail-less Fc
RII and the Fc
RII/ic
chimeras presented the 12–26 peptide with similar efficiencies (Fig. 1 B). Therefore, the cytoplasmic domain of the
chain bears all the information required for the presentation of the IEd epitope.
|
RIIb2 and Fc
RIII were also targeting antigens for presentation by different pathways and that the IEd epitope could only be generated in one of these pathways.
We tested this possibility by assessing the effect of the protein synthesis inhibitor cycloheximide on the kinetics of presentation of the IAd and IEd epitopes. Fc
RIIb2- or Fc
RIII-expressing cells were preincubated in cycloheximide for 3 h before addition of CI
repressor immune complexes. After incubation of the cells at 37°C for various periods of time, the cells were fixed and T cell hybrids specific for the IAd/12–26 or IEd/12–26 epitopes were added. After an additional 18 h incubation, the amounts of IL-2 produced by the T cell hybrids were measured in the supernatants.
As shown in Fig. 3, presentation of the IAd epitope in Fc
RII- and Fc
RIII-expressing cells, as well as presentation of the IEd epitope by Fc
RIII-expressing cells, all exhibited slow kinetics and were blocked by cycloheximide. These results indicate that both receptors induced antigen presentation through the conventional pathway, which requires newly synthesized MHC class II molecules. The difference in the presentation of the IEd epitope is therefore not due to the targeting of antigen to different antigen presentation pathways by the two receptors.
|
RIII, but not of Fc
RIIb2, induces the activation of multiple tyrosine kinases, a rise of cytosolic Ca2+ concentrations and, subsequently, the activation of the transcription of various genes (18). Therefore, the selective presentation of the cryptic epitope by cells expressing Fc
RIII could be either a direct consequence of a different intracellular targeting of antigen or an indirect effect of overall cell activation. We next attempted to test the latter possibility in two different ways.
First, we tested whether cell activation by Fc
RII/ic
chimera induced a change in surface expression of a putative costimulatory molecule required only for the efficient activation of some of the epitope-specific T cell hybrids. The Fc
RIIb2- and Fc
RII/ic
-expressing cells were incubated overnight with or without irrelevant immune complexes (ovalbumin (OVA)-anti-OVA), in order to induce cell activation (we verified that these immune complexes induced efficient cell activation using a phosphotyrosine blot assay and IL-2 secretion, data not shown). The cells were then fixed and reincubated with increasing doses of 12–26 peptide and either the IAd or the IEd 12–26 epitope-specific T cell hybrids.
As shown in Fig. 4 A, the peptide was presented to both T cell hybridomas with similar efficiencies by the unstimulated and the stimulated cells. Therefore, cell activation through the
chain did not induce any modification in the efficiency of presentation of the 12–26 peptide to the IAd and the IEd specific T cell hybrids. The effect of antigen internalization through Fc
RIII is therefore related to the intracellular processing of antigen.
|
RII/ic
expressing cells were incubated with soluble CI
repressor in the presence of irrelevant immune complexes (as in Fig. 4 A) in order to engage the corresponding receptors, and induce cell activation. The cells were then fixed and reincubated with either the IAd or the IEd 12–26 specific T hybridomas. As shown in Fig. 4 B, activation through Fc
RII/ic
did not induce the presentation of the cryptic epitope after fluid phase antigen uptake.
However, it was still possible that both cell activation and efficient receptor-mediated antigen uptake were required together for the presentation of the IEd restricted epitope. To test this possibility, the Fc
RIIb2 expressing cells were simultaneously incubated with
repressor–containing immune complexes (to allow efficient antigen uptake) and specific anti–mouse IgG2a goat antibodies (to induce cell activation through surface immunoglobulin). The cells were then fixed and reincubated with the two T cell hybrids. As shown in Fig. 4 C, cell activation through sIgG did not induce Fc
RIIb2 expressing cells to present the cryptic epitope. Therefore, overall cell activation is not sufficient to allow presentation of the IEd-restricted epitope after Fc
RIIb2-mediated antigen internalization.
Mutation of Leucine 35 to Alanine in the Cytoplasmic Tail of Fc
RIII-associated
Chain Inhibits Cell Activation, but not Internalization of Immune Complexes.
We concluded from the previous series of experiments that the presentation of the IEd-restricted epitope was not an exclusive consequence of overall cell activation, but rather resulted from the selective intracellular targeting of antigen by Fc
RIII. However, the intracellular traffic of membrane receptors may also be related to their signal transduction capabilities. In the case of tyrosine kinase receptors, like epidermal growth factor receptor, the kinase activity is involved in internalization (29) and endosomal trafficking (30). By analogy to PTK receptors, we reasoned that the ability of Fc
RIII (or Fc
RII/ic
) to activate PTKs after cross-linking (17) might influence its intracellular traffic and thereby allow the generation of the IEd-restricted epitope.
We attempted to address this possibility by searching for mutations that differentially affected internalization and cell activation by the
chain. An alanine scan of the region of the ITAM (Amigorena, S., and C. Bonnerot, unpublished results) was performed by sequentially introducing single point mutations in the cytoplasmic tail of Fc
RII/ic
. The corresponding cDNAs were expressed stably in the IIA1.6 B lymphoma cells and the resulting transfectants were tested for their ability to induce cell activation and ligand internalization after receptor cross-linking by anti-Fc
R mAbs (Amigorena, S., and C. Bonnerot, unpublished results). Thus, we found that mutation of leucine in position 35 to alanine (Fc
RII/ic
L35A) completely abolished cell activation without affecting receptor internalization.
As shown in Fig. 5 A, Fc
RII–ic
L35A chimera–expressing cells have lost the ability to secrete IL-2 after engagement of the receptor by immune complexes, whereas secretion of IL-2 was normal after engagement of surface IgG in the same cells. In contrast, internalization of immune complexes was not affected by the mutation (Fig. 5 B). Therefore, leucine 35 in the
chain cytoplasmic domain is required for cell activation but dispensable for receptor internalization.
|
RIII Induces the L35-dependent Presentation of Multiple Epitopes that were Not Presented after Internalization through Fc
RII.
RII–ic
L35A was incapable of stimulating IL-2 production or inducing activation of PTKs (Amigorena, S., and C. Bonnerot, unpublished results) but was normally internalized, we next tested its ability to induce the presentation of the IAd- and IEd-restricted 12–26 peptide. As shown in Fig. 6 A, Fc
RII–ic
L35A–expressing cells presented soluble CI
repressor IAd 12–26 epitope with the same efficiency as Fc
RIII-expressing cells. When the cells were incubated with antigen–IgG complexes, both Fc
RIII–ic
– and Fc
RII– ic
L35A–expressing cells presented the IAd epitope with high efficiency. In contrast, only Fc
RII–ic
–expressing cells presented the IEd 12–26 epitope, whereas absolutely no presentation of this epitope was observed after immune complexes internalization by Fc
RII–ic
L35A–expressing cells (Fig. 6 A, lower panels). The efficiencies of presentation of the 12–26 peptide to the IAd and IEd-specific T cell hybridomas were similar for the Fc
RII–ic
– and the Fc
RII– ic
L35A–expressing cells (Fig. 6 B). The mutation of leucine 35 therefore affected the presentation of the IEd 12–26 epitope much more drastically than the presentation of the same peptide with IAd.
|
RIIb2 and Fc
RII–ic
. In contrast, the 80–102 peptide was only presented after internalization by the Fc
RII–ic
. As in the case of the IEd 12–26 epitope, the IAd 80–102 epitope was not at all presented after internalization by Fc
RIIb2. In addition, as in the case of the IEd 12–26 and IAd 12–26, the presentation of the IAd 80– 102, but not of IAd 46–64 epitope, was blocked by the L35A mutation.
|
RIII or Fc
RII–ic
antigen internalization limited to CI
repressor? To answer this question, we tested a panel of six T cell hybridomas specific for various epitopes of HEL. The efficiency of presentation of IgG-complexed HEL to the different T cell hybrids was compared for the Fc
RIIb2– and the Fc
RII–ic
–expressing cells. As shown in Fig. 7 (lower panels), the IAd 11–25 and IEd 108–116 epitopes were efficently presented only after internalization by Fc
RII–ic
–expressing cells. As in the case of the CI
repressor IAd 12–26 and IAd 46–64 epitopes, the L35A mutation inhibited the efficient presentation of these two epitopes.
As summarized in Table 1, internalization by Fc
RII–ic
chimeras allowed the efficient presentation of all epitopes tested, whereas Fc
RIIb2 only presented a subset of these epitopes. For all the other epitopes tested, Fc
RIIb2 either allowed no presentation or induced presentation at the same high antigen concentrations as those which also induced presentation after fluid phase uptake. As a general rule, the epitopes which were efficiently presented after internalization by either Fc
RIII or Fc
RIIb2 were also efficiently presented by the L35 mutant receptors. In contrast, in the case of the epitopes that were presented after Fc
RIII and Fc
RII–ic
, but not presented after internalization by Fc
RIIb2, the L35 mutation inhibited presentation. In all cases, the L35 mutant receptors behaved like the Fc
RIIb2 in terms of epitope presentation.
| Discussion |
|---|
|
|
|---|
RII or Fc
RIII (which in most cases were also presented, although less efficiently after fluide phase uptake), and the second, of the epitopes that were only presented after internalization by Fc
RIII, or the Fc
RII– ic
chimeras (at least two of these epitopes were cryptic, i.e., not presented after immunization of mice with intact antigen).
Why, then, did Fc
RIII and Fc
RIIb2/
-chain chimeras induce the presentation of epitopes that were not presented after internalization via Fc
RIIb2 or fluid phase uptake? The selectivity in the presentation of different epitopes between receptors is certainly not due to quantitative differences in the uptake of antigen by the presenting cells, because (a) both Fc
RIII and the Fc
RII–chain chimeras were expressed at lower levels than Fc
RIIb2; (b) all receptors mediated the internalization of immune complexes with similar kinetics and efficiencies (Fig. 5 B); and (c) Fc
RIIb2 increased the efficiency of presentation of several epitopes to the same extent or even to greater extents than Fc
RIII and the Fc
RII–ic
chimera (Figs. 1 and 2). Therefore, the selectivity in epitope presentation must reside in a qualitative difference between the two receptors.
One of the qualitative differences between type II and III Fc
Rs is in the induction of cell activation. The
chains have been shown to mediate activation through Fc
RIII, due to a conserved ITAM, present in its cytoplasmic tail. In contrast, Fc
RIIb2 bears no ITAM and does not induce cell activation. Upon activation through Fc
RIII, IIA1.6 cells produced a cytokine that supports the growth of the CTLL.2 IL-2–dependent cell line (18). We checked very carefully that the IL2 production measured by the CTLL.2 cells in our antigen presentation experiments was due to the T cell hybrids and not to the presenting cells. If the presenting cells were incubated with CI
repressor or HEL immune complexes in the absence of T lymphocytes, background proliferation of the CTLL.2 cells was observed (data not shown). In addition, all the experiments were repeated with paraformaldehyde-fixed APCs, a treatment that completely prevents cytokine secretion (Fig. 3 and data not shown). Under these conditions, only the T cell hybrids can produce IL-2.
The coactivation experiments (Fig. 4) show that presentation of the Fc
RIII-restricted epitopes was not a consequence of overall cell activation. The most convincing result from this point of view may be the one shown in Fig. 4 C. When immune complexes were internalized by Fc
RIIb2-expressing cells in the continuous presence of F(ab)'2 fragments of anti-IgG antibodies, which efficiently induced cell activation through mIgG (18), no presentation of the Fc
RIII-restricted epitopes was observed. It could be argued here that cell activation through sIgG might be qualitatively different from cell activation through Fc
RIII. Although we can not completely exclude this possibility, we found that direct antigen internalization though sIg (using A20 B cells expressing anti-DNP sIg and DNP-derivatized CI
repressor) allowed presentation of the same epitopes as Fc
RIII (data not shown). This shows that although presentation of Fc
RIII-restricted epitopes also occurred after antigen internalization by sIg, overall cell activation through sIg did not induce the presentation of those epitopes when the antigen was internalized through Fc
RIIb2. Therefore, antigen must be physically associated to the receptor for the efficient presentation of the Fc
RIII-restricted epitopes.
The simplest and most direct explanation for these results is that Fc
RIII targeted antigens to a particular intracellular compartment that Fc
RIIb2 can not access. Several of our experiments support this possibility and, taken together, shed light on various aspects of this putative transport path. First, the differential generation of T cell epitopes after internalization by Fc
RIIb2 and III was not due to selective antigen targeting to the conventional and recycling presentation pathways, since presentation of both dominant and cryptic epitopes had slow kinetics and were blocked by cycloheximide. This was an important possibility to test because it has recently been shown that the epitopes presented by both pathways may be different (9).
Second, a single point mutation (of leucine 35 to alanine) blocked the presentation of Fc
RIII-restricted epitopes, without affecting the presentation of the epitopes efficiently presented after Fc
RIIb2 internalization. In other words, the chimeric Fc
RII–ic
L35A behaved exactly like Fc
RIIb2 in terms of epitope presentation. Interestingly, L35A mutation was first identified as blocking cell activation, but not receptor internalization. Therefore, like Fc
RIIb2, L35A chimeric receptors are not capable of inducing activation of cytosolic PTKs. These results suggest that association to tyrosine kinases or tyrosine phosphorylation of the receptor itself is required for the efficient generation of the Fc
RIII-restricted epitopes.
In the case of PTK receptors, like the epidermal growth factor receptor, the kinase activity has been shown to directly affect intracellular transport, since in addition to internalization (29) transport from endosomes to lysosomes requires the kinase activity (30). Although the Fc
RIII-associated
chain contains no intrinsic PTK activity, it has been shown to associate to Syk after phosphorylation of its ITAM by PTK of the src family (17). In addition, for ITAM-containing receptors like Fc
RIII, association to Syk is required for transport from endosomes to lysosomes (Amigorena, S., and C. Bonnerot, unpublished results). However, transport to lysosomes is unlikely to be determinant for presentation of the Fc
RIII-restricted epitopes, since Fc
RIIb2 efficiently mediated transport of immune complexes to Percoll heavy, degradative compartments (31).
Several recent studies have analyzed the intracellular locations where peptide loading occurs and showed that multiple endocytic compartments may be involved (32–34). However, little is known about the actual influence of the intracellular compartments where peptide loading occurs on the generation of particular T cell epitopes (34). Indeed, besides the affinity of peptides for MHC class II molecules, other factors are critical for the formation of T cell epitopes. The proteolytic generation of peptides, or their degradation depends on specific proteolytic enzymes. The loading of different peptides is differentially affected by HLA-DM (35). Therefore, the endosomal environment most likely determines the nature of the peptides loaded onto MHC class II molecules (34).
We have previously shown that a particular population of vesicles in the cells used here, class II vesicles or CIIV, are an important site of peptide loading (36, 37). Therefore, it is possible that Fc
RIIb2 and Fc
RIII (or Fc
RII– ic
) have differential accessibilities to CIIV, thus accounting for the generation of different peptides after internalization by these two receptors. Directly testing this possibility will require an extensive analysis of Fc
RIIb2 and Fc
RIII intracellular transport, which will next be undertaken.
Physiologically, Fc
RII and Fc
RIII are expressed on professional APCs such as macrophages and dendritic cells (20, 38). Furthermore, the relative rates of expression of these two receptors is regulated by cytokines such as IFN-
and TNF-
(20). Our results therefore suggest that the selection of peptides presented to T cells depends on the antigen receptors expressed by the APCs which are themselves dependent on their microenvironment.
The consequences of antigen receptor expression on the presentation of different epitopes may also be relevant to autoimmunity. Indeed, it has recently been proposed that only dominant epitopes from autoantigens participate in thymic selection, since cryptic epitopes would not be presented under normal conditions (3, 39). T cells specific for cryptic epitopes from autoantigens therefore are not tolerized and may become pathogenic if cryptic epitopes are presented in the periphery for any particular reason. In the recent past, several groups have shown various mechanisms for unveiling cryptic epitopes in vitro (for review see reference 39). Interestingly, after downregulation of a membrane receptor antigen by its ligand, cryptic epitopes may be revealed (40). Changes in the hierarchy of epitope presentation may also occur in different APCs or when antigen is complexed to other proteins (such as antibodies) (15). Our results indicate a novel mechanism of cryptic epitope unveiling, i.e., receptor-mediated antigen uptake. The participation of Fc
RIII in revealing cryptic epitopes in vivo, as well as the possible involvement of FcRs in epitope spreading and in autoimmunity, have now to be evaluated.
Submitted: 15 September 1997
Revised: 2 December 1997
repressor and anti-HEL T cell hybridomas, to P. Benaroch and G. Langsley for critically reading the manuscript and to all members of the CJF-INSERM 95-01 for useful discussions. This work was supported by grants from the INSERM, Institut Curie, the Association de Recherche contre le Cancer (ARC), and the Ligue Nationale Contre le Cancer. L. Gapin was supported by ARC and Pasteur-Weizman fellowships and V. Briken by an E.C. fellowship.
Address correspondence to Sebastian Amigorena, INSERM CJF 95-01, Institut Curie, Section Recherche, 12 rue Lhomond, 75005, Paris, France. Phone: 33-01-42-34-63-89; Fax: 33-01-42-34-63-82; E-mail, s.amigorena{at}curie.fr
1 Abbreviations used in this paper: Ii, invariant chain; ITAM, immunoreceptor tyrosine kinase activation motif; HEL, hen egg lysozome; HRP, horseradish, peroxidase; PTK, protein tyrosine kinase.
| References |
|---|
|
|
|---|
1 Germain RN & Margulies DH. The biochemistry and cell biology of antigen processing and presentation, Annu Rev Immunol, 1993, 11, 403–450.[Medline]
2 Cresswell P. Assembly, transport, and function of MHC class II molecules, Annu Rev Immunol, 1994, 12, 259–293.[Medline]
3 Sercarz EE, Lehmann PV, Ametani A, Benichou G, Miller A & Moudgil K. Dominance and crypticity of T cell antigenic determinants, Annu Rev Immunol, 1993, 11, 729–766.[Medline]
4 Lanzavecchia A. Receptor-mediated antigen uptake and its effect on antigen presentation to class II-restricted T lymphocytes, Annu Rev Immunol, 1990, 8, 773–793.[Medline]
5 Germain RN. MHC-dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation, Cell, 1994, 76, 287–299.[Medline]
6 Roche, P.A. 1995. HLA-DM: an in vivo facilitator of MHC class II peptide loading. 3:259–262.
7 Reid PA & Watts C. Cycling of cell-surface MHC glycoproteins through primaquine-sensitive intracellular compartments, Nature, 1990, 346, 655–657.[Medline]
8 Pinet V, Vergelli M, Martin R, Bakke O & Long EO. Antigen presentation mediated by recycling of surface HLA-DR molecules, Nature, 1995, 375, 603–606.[Medline]
9 Guangming Z, Romagnoli P & Germain RN. Related leucine-based cytoplasmic targeting signals in invariant chain and major histocompatibility complex class II molecules control endocytic presentation of distinct determinants in a single protein, J Exp Med, 1997, 185, 429–438.
10 Bonnerot C, Lankar D, Hanau D, Spehner D, Davoust J, Salamero J & Fridman WH. Role of B cell receptor Ig alpha and Ig beta subunits in MHC class II–restricted antigen presentation, Immunity, 1995, 3, 335–347.[Medline]
11 Lanzavecchia A. Antigen uptake and accumulation in antigen-specific B cells, Immunol Rev, 1987, 99, 39–51.[Medline]
12 Lanzavecchia A. Antigen-specific interaction between T and B cells, Nature, 1985, 314, 537–539.[Medline]
13 Amigorena S, Bonnerot C, Drake JR, Choquet D, Hunziker W, Guillet JG, Webster P, Sautes C, Mellman I & Fridman WH. Cytoplasmic domain heterogeneity and functions of IgG Fc receptors in B lymphocytes, Science, 1992, 256, 1808–1812.
14 Watts C & Lanzavecchia A. Suppressive effect of antibody on processing of T cell epitopes, J Exp Med, 1993, 178, 1459–1463.
15 Simitsek PD, Campbell DG, Lanzavecchia A, Fairweather N & Watts C. Modulation of antigen processing by bound antibodies can boost or suppress class II major histocompatibility complex presentation of different T cell determinants, J Exp Med, 1995, 181, 1957–1963.
16 Sallusto F & Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony–stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor
, J Exp Med, 1994, 179, 1109–1118.
17 Ravetch JV. Fc receptors: rubor redux, Cell, 1994, 78, 553–560.[Medline]
18 Bonnerot C, Amigorena S, Choquet D, Pavlovich R, Choukroun V & Fridman WH. Role of associated gamma-chain in tyrosine kinase activation via murine Fc gamma RIII, EMBO (Eur Mol Biol Organ) J, 1992, 11, 2747–2757.[Medline]
19 Amigorena S, Salamero J, Davoust J, Fridman WH & Bonnerot C. Tyrosine-containing motif that transduces cell activation signals also determines internalization and antigen presentation via type III receptors for IgG, Nature, 1992, 358, 337–341.[Medline]
20 Weinshank RL, Luster AD & Ravetch JV. Function and regulation of a murine macrophage-specific IgG Fc receptor, Fc
R
, J Exp Med, 1988, 167, 1909–1925.
21 Jones B, Tite JP & Janeway CA. Different phenotypic variants of the mouse B cell tumor A20/2J are selected by antigen- and mitogen-triggered cytotoxicity of L3T4-positive, IA-resticted T cell clones, J Immunol, 1986, 136, 348–356.[Abstract]
22 Guillet JG, Lai MZ, Briner TJ, Smith JA & Gefter ML. Interaction of peptide antigens and class II major histocompatibility complex antigens, Nature, 1986, 324, 260–262.[Medline]
23 Lai MZ, Ross DT, Guillet JG, Briner TJ, Gefter ML & Smith JA. T lymphocyte response to bacteriophage lambda repressor cI protein. Recognition of the same peptide presented by Ia molecules of different haplotypes, J Immunol, 1987, 139, 3973–3980.[Abstract]
24 Li WF, Fan MD, Pan CB & Lai MZ. T cell epitope selection: dominance may be determined by both affinity for major histocompatibility complex and stoichiometry of epitope, Eur J Immunol, 1992, 22, 943–949.[Medline]
25 Cibotti R, Cabaniols JP, Pannetier C, Delarbre C, Vergnon I, Kanellopoulos JM & Kourilsky P. Public and private Vβ T cell receptor repertoires against hen egg white lysozyme (HEL) in nontransgenic versus HEL transgenic mice, J Exp Med, 1994, 180, 861–872.
26 Harper M, Lema F, Boulot G & Poljack RJ. Antigen specific and cross-reactivity of monoclonal anti-lysozyme antibodies, Mol Immunol, 1987, 2, 97–108.
27 Justement LB, Kreiger J & Cambier JC. Production of multiple lymphokines by the A20.1 B cell lymphoma after cross-linking of membrane Ig by immobilized anti-Ig, J Immunol, 1989, 143, 881–889.[Abstract]
28 Pinet V, Malnati MS & Long EO. Two processing pathways for the MHC class II–restricted presentation of exogenous influenza virus antigen, J Immunol, 1994, 152, 4852–4860.[Abstract]
29 Lamaze C & Schmid SL. Recruitment of epidermal growth factor receptors into coated pits requires their activated tyrosine kinase, J Cell Biol, 1995, 129, 47–54.
30 Felder S, Miller K, Moehren G, Ullrich A, Schlessinger J & Hopkins CR. Kinase activity controls the sorting of the epidermal growth factor receptor within the multivesicular body, Cell, 1990, 61, 623–634.[Medline]
31 Mellman I & Plutner H. Internalization and degradation of macrophage Fc receptors bound to polyvalent immune complexes, J Cell Biol, 1984, 98, 1170–1177.
32 Castellino F & Germain RN. Extensive trafficking of MHC class II–invariant chain complexes in the endocytic pathway and appearance of peptide-loaded classs II in multiple compartments, Immunity, 1995, 2, 73–88.[Medline]
33 Brachet V, Raposo G, Amigorena S & Mellman I. Ii chain controls the transport of major histocompatibility complex class II molecules to and from lysosomes, J Cell Biol, 1997, 137, 51–65.
34 Griffin JP, Chu R & Harding CV. Early endosomes and a late endocytic compartment generate different peptide–class II MHC complexes via distinct processing mechanisms, J Immunol, 1997, 158, 1523–1532.[Abstract]
35 Kropshofer H, Vogt AB, Moldenhaur G, Hammer J, Blum JS & Hammerling GJ. Editing of HLA-DR peptide repertoire by HLA-DM, EMBO (Eur Mol Biol Organ) J, 1996, 15, 6144–6154.[Medline]
36 Amigorena S, Drake JR, Webster P & Mellman I. Transient accumulation of new class II MHC molecules in a novel endocytic compartment in B lymphocytes, Nature, 1994, 369, 113–120.[Medline]
37 Amigorena S, Webster P, Drake J, Newcomb J, Cresswell P & Mellman I. Invariant chain cleavage and peptide loading in major histocompatibility complex class II vesicles, J Exp Med, 1995, 181, 1729–1741.
38 Astier A, de la Salle H, de la Salle C, Bieber T, Esposito-Farese ME, Freund M, Cazenave JP, Fridman WH, Teillaud JL & Hanau D. Human epidermal Langerhans cells secrete a soluble receptor for IgG (Fc gamma RII/ CD32) that inhibits the binding of immune complexes to Fc gamma R+cells, J Immunol, 1994, 152, 201–212.[Abstract]
39 Lanzavecchia A. How can cryptic epitopes trigger autoimmunity? , J Exp Med, 1995, 181, 1945–1948.
40 Salemi S, Caporossi AP, Boffa L, Longobardi MG & Barnaba V. HIVgp120 activates autoreactive CD4-specific T cell responses by unveiling of hidden CD4 peptides during processing, J Exp Med, 1995, 181, 2253–2257.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|