J. Exp. Med.,
Volume 187, Number 2, January 19, 1998 253-258
BRIEF DEFINITIVE REPORT:
Highly Biased CDR3 Usage in Restricted Sets of
Chain Variable Regions During Viral Superantigen
9 Response
By
Cristina
Ciurli,*
David N.
Posnett,§
Rafick-Pierre
Sékaly,*
¶
and
François
Denis*
From the * Laboratoire d'Immunologie, Institut de Recherches Cliniques de Montréal, Montréal (QC),
Canada, H2W 1R7;
Département de Microbiologie-Immunologie, Faculté de Médecine, Université
de Montréal, Montréal (QC), Canada, H3C 3J7; § Department of Medicine, and
Immunology
Program, Graduate School of Medical Sciences, Cornell University Medical College, New York
10021; and ¶ Department of Microbiology and Immunology, School of Medicine, McGill University,
Montréal (QC), Canada, H3A 2B4
 |
Abstract |
Superantigens encoded by the mouse mammary tumor virus can stimulate a large proportion of
T cells through interaction with germline-encoded regions of the T cell receptor
chain like
the hypervariable region 4 (HV4) loop. However, several lines of evidence suggest that somatically generated determinants in the CDR3 region might influence superantigen responses. We
stimulated T cells from donors differing at the BV6S7 allele with vSAG9 to assess the nature
and structure of the T cell receptor in amplified T cells and to evaluate the contribution of
non-HV4 elements in vSAG recognition. This report demonstrates that vSAG9 stimulation caused the expansion of TCR BV6-expressing T cells, although to varying degrees depending
on the BV6 subfamily. The BV6S7 subfamily was preferentially expanded in all donors, but in
donors homozygous for the BV6S7*2 allele, a significant number of BV6S5 T cells were amplified and showed a highly biased
chain junctional region (BJ) and CDR3 usage. As CDR3 regions are involved in major histocompatibility complex (MHC)-peptide interaction, such a selection is highly suggestive of an intimate MHC-TCR interaction and would imply that the
topology of the MHC-vSAG-TCR complex is similar to the one occurring during conventional antigen recognition.
 |
Introduction |
Mouse mammary tumor virus (MMTV) is a retrovirus
that uses the immune system for its transmission by
encoding a viral superantigen (vSAG) (1). MMTV vSAGs
can stimulate a large pool of T cells by interacting with the
hypervariable region 4 (HV4) of the TCR
chain, which
is germline encoded by individual
chains (2, 3) and is distinct from the CDR3 hypervariable region involved in recognition of antigens presented by MHC molecules (4). Since
SAG-responsive cells can express different TCR
and
combinations, it is believed that an intimate TCR-MHC
interaction is not required for recognition, as most T cells
bearing appropriate
chain variable regions (BVs) can respond to vSAGs (1). Potential contributions of non-HV4
elements have been proposed since vSAG response can be
influenced by
chain usage (5, 6), and nonrandom joining region usage has been described in SAG-responsive BVs
(7). T cell repertoire analysis in mice differing by the presence of vSAG7 has shown that particular
chain junctional
regions (BJs) and CDR3 lengths were underrepresented in
BVs having survived deletion (8), but this indirectly infers a
CDR3 selection by analyzing the structure of TCRs in
nonresponding cells. These data suggest that TCR-MHC
contacts might be required for productive interaction. To
assess which TCRs would be amplified by vSAG stimulation, we subjected T cells from individuals, differing at the
BV6S7 allele, to vSAG9 stimulation. The structure of
TCRs amplified by vSAG9 provides evidence that CDR3s
are selected in BVs having lower responsiveness towards
the superantigen. This suggests that additional contacts provided by CDR3-peptide interaction allow stabilization of
the complex and implies that vSAGs cross-link MHC and
TCR in a way that preserves interactions seen in conventional antigen recognition (4, 9), in marked contrast with
what occurs during bacterial SAG (bSAG) recognition (10).
 |
Materials and Methods |
Genotyping for BV6S7 Alleles.
The nomenclature used for BV
genes is according to Wei et al. (11). PBMCs were separated by
Ficoll centrifugation (Pharmacia Biotech AB, Uppsala, Sweden)
and stimulated for 24 h with 1 µg/ml of PHA (Murex Diagnostics, Guelph, Canada). Total RNA was extracted from 4 × 107
cells with RNAzol B (CINNA/BIOTECX Laboratories, Houston, TX) and 10 µg were reverse transcribed with 5 µg of oligodT and 60 U of AMV-RT (Life Sciences, St. Petersburg, FL).
The BV6S7 cDNAs were amplified by PCR using primers and
conditions described elsewhere (12), digested with BamHI, and
fractionated on 2% gels.
T Cell Stimulation with vSAG9.
Human T cells were purified
from four donors homozygous for either BV6S7 allele using rosetting with sheep red blood cells (Quélab, Montréal, Canada)
and PBMCs separated by Ficoll centrifugation. Purity was assessed
by staining with anti-CD3 (OKT3-FITC) and anti-HLA-DR
(L-243) mAbs (Becton Dickinson, Mountain View, CA) and T
cell purity was >99%, whereas the non-T cell fraction contained <15% of T cells. T cells were stimulated in the presence of irradiated autologous feeder cells with DAP-DR1 cells, which are murine fibroblasts transfected with DR1
and
chain cDNAs, or
DAP-DR1 expressing vSAG9 (13). DAP-DR1 and DR1-vSAG9
cells were treated for 1 h at 37°C with 100 µg/ml mitomycin C
(Sigma Chemical Co., St. Louis, MO) and cocultured in 96-well
plates in DMEM, 5% FCS, 2 mM L-glutamine, and 20 µg/ml
gentamycin. 6 × 105 human T cells were cultured with 2 × 105
DAP-DR1 or DR1-SAG9 in the presence of 5 × 105 autologous
irradiated feeder cells. After 2 d, 10 U/ml of recombinant human
IL-2 was added and the culture proceeded for an additional 7 d.
For PHA stimulation, 106 T cells were cocultured in 24-well
plates with 2 × 105 irradiated feeder cells and 1 µg/ml PHA in
1.5 ml. Proliferation was measured by [3H]thymidine incorporation (Dupont Co.-New England Nuclear, Boston, MA) after 3 d
and determined with a
plate counter (Pharmacia Biotech AB).
FACS® and Quantitative PCR Analysis of the BV Repertoire.
FACS® analysis was performed after T cell stimulation with
DR1-SAG9 or PHA, using CD4, CD8, and BV-specific mAbs.
The BV-specific mAbs used were anti-BV2, 3, 8, BV13S3
(JU74), 17, 19, 21 (Immunotech Coulter, St. Laurent, Canada),
BV5 (MH3-2), BV5 (3D11), BV6S7*1 (OT145), BV9 (MKB1),
BV12 (S511), BV13 (BAMB), BV13S1 (H131), BV13S2 (H132),
and BV23 (HUT-78). Cells were stained for CD4 (OKT4-PE) and CD8 (OKT8-PerCP) (Becton Dickinson) and 3 × 105 live
cells were gated according to forward and side light scatter and
analyzed on a FACScan®. For quantitative PCR (qPCR), cDNAs
were synthesized as described above and PCR was performed using conditions and primers described elsewhere (14). PCR products were fractionated on 12% polyacrylamide gels and exposed
overnight on PhosphorImager screens (Molecular Dynamics, Sunnyvale, CA). Quantification of signals was performed on a PhosphorImager running the IMAGEQUANT software (Molecular Dynamics) and normalized against a TCR
chain constant region internal control (14).
Cloning and Analysis of BV6 Subfamily Members.
BV6 members were amplified by PCR using DeepVent (New England
Biolabs, Mississauga, Canada) using the constant region primer GGTGTGGGAGATGTCGACTTTTGATGGCTCAAAC and the
pan-BV6 primer: CCTTTACTGGTACCGACAGAGCCTGG. PCR products were digested with KpnI and SalI, cloned into
pBSKS+ (Stratagene, La Jolla, CA), and recombinants were
screened by PCR using reverse and universal primers (15). BV6
members were subdivided by RFLP based on the presence of
BamHI and ApaLI sites (BamHI+ApaLI+: BV6S7*1; BamHI
ApaLI+: BV6S7*2; BamHI
ApaLI
: BV6S5; BamHI+ApaLI
:
BV6S1, BV6S3, BV6S4, BV6S11, and BV6S14). 10 µl of PCR
reactions were digested with BamHI and ApaLI and fractionated
on 2% gels. Sequence determination was performed using the T7
Sequencing Kit (Pharmacia Biotech AB).
 |
Results and Discussion |
Since vSAG9 can stimulate BV6S7+ human T cells and
polymorphism between BV6S7 alleles is located within the
HV4 region (16), we assumed that responsiveness to
vSAG9 might differ between individuals homozygous for
either allele and that analysis of BVs expanded in donors
bearing a less responsive allele might reveal the contribution of non-HV4 elements in vSAG9 response.
vSAG9 Preferentially Expands the TCR BV6 Family.
Since the murine cell line DAP, expressing both HLA-DR1 (DAP-DR1) and vSAG7, has been shown to stimulate human T cells in a BV-restricted manner (14), we used
DAP-DR1 transfected with vSAG9 (DR1-SAG9; reference 13) to stimulate T cells from an individual homozygous for BV6S7*1 (donor J). Proliferation measured by
thymidine incorporation peaked after 4 d of coculture and
was reproducibly fourfold higher compared to control DR1
cells (data not shown). FACS® analysis of BV usage in human CD4+ T cells in response to vSAG9 or PHA, a mitogen that stimulates T cells independently of BV usage (17 and
data not shown), shows that vSAG9 stimulated BV6S7*1+
and BV21+ T cells (Fig. 1 A). Since the BV-specific mAbs
currently available cover ~65% of the repertoire, qPCR
analysis was performed and this confirmed that only BV6
and BV21 responded to vSAG9 and were amplified four-
and threefold, respectively (Fig. 1 B). This selective expansion was reproduced on a second BV6S7*1 homozygous
individual (data not shown). T cells derived from two individuals homozygous for the BV6S7*2 allele (donors S and
M) were stimulated with vSAG9 and proliferation was six-
and fourfold higher compared to control DAP-DR1 cells
(data not shown). Quantitative PCR analysis was performed and, as with the BV6S7*1 donors, only BV6+ and
BV21+ T cells were amplified (Fig. 2, A and B). The responsiveness of BV6 and BV21 is not surprising given that
they share significant homology, notably in the CDR1 and
HV4 regions (18). HLA typing for MHC haplotypes was
performed and showed that donor J was DR1/DR1, donor
S was DR7/DR7, and donor M was DR2/DR7. Although donors S and M express MHC molecules different
from DR1, T cell proliferation after 3 d of coculture with
the control DR1 transfectant was similar between the DR1
donor (3.2 × 104 cpm) and the non-DR1 donors (3.1 × 104 and 3.0 × 104 cpm), indicating that no significant allogeneic response occurred, which is not surprising since
DAP cells are known to be poor at eliciting alloresponses
(19). From qPCR analysis, it is apparent that the overwhelming majority of T cells that responded to vSAG9 belonged to the BV6 family (Figs. 1 B, 2, A and B). Since the human BV6 locus contains seven expressed genes (18) and
our qPCR did not allow discrimination between subfamily
members, BV6s were amplified using a pan-BV6 primer
and cloned for analysis. Approximately 200 clones from
PHA- and vSAG9-stimulated cells were analyzed by
RFLP. For donor J (BV6S7*1 homozygous), 98% of the
clones obtained after vSAG9 stimulation used BV6S7. With
donors S and M (BV6S7*2 homozygous), RFLP analysis
showed that 64 and 87% of the clones used BV6S7, although a significant number of other BV6 gene segments
were also obtained after stimulation (Table 1). For donor S,
27% of the BV6s present after vSAG9 stimulation were
BV6S5+, whereas in donor M, 5% of BV6 gene segments
were BV6S5+. For all donors, BV6S7 was clearly the best
responder to vSAG9, as evidenced by the low numbers of
BV6+, non-BV6S7 cells present after stimulation. For donor M, the proportion of BV6S7*2-positive clones present
in the PHA-stimulated population was twice that of the
other donors (Table 1) and appear to have dominated the
vSAG9 response, perhaps explaining the lower number of
BV6S5 found after stimulation.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
(A) Cytofluorometric analysis of TCR BV usage in T cells
stimulated by vSAG9. T cells from donor J (homozygous for BV6S7*1) were stained with a panel of human BV-specific antibodies. Shown is the
percentage of BV expression in CD4+ T cells after PHA, DR1, or
vSAG9 stimulation. (B) Percentage of TCR BV usage determined by
qPCR analysis. The signal intensity for each BV obtained by volume integration using the IMAGEQUANT software was normalized against the
chain internal control, and the relative percentage of BV expression was
calculated by dividing the individual normalized values by the sum of all
BV normalized values.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2.
qPCR analysis of TCR BV usage in vSAG9-stimulated T
cells from BV6S7*2 donors. (A) Donor S, homozygous for the BV6S7*2
allele; (B) donor M, homozygous for the BV6S7*2 allele. The values were calculated as described in the legend of Fig. 1 B.
|
|
CDR3 Structure of BV6 Subfamily Members Amplified by
vSAG9.
To evaluate the possible contribution of the
chain CDR3 in recognition of the vSAG9-MHC complex, TCR junctional regions from T cells stimulated by
vSAG9 or PHA were sequenced. Sequence analysis of the
BV6S7 clones revealed no particular BJ selection from either vSAG9- or PHA-stimulated cells, with a random BJ
usage and CDR3 length distribution (data not shown, Table 2). In contrast, the BV6S5 clones obtained after vSAG9
stimulation in donor S revealed a striking bias; 89% of
BV6S5 clones amplified used the BJ1S5 element (Table 2),
whereas BJ1S5 usage in BV6S5 clones from PHA-stimulated T cells was not elevated (10%; data not shown). Two
dominant clonotypes were found, with CDR3 regions bearing a P(Q/E)NSG motif (Table 2), created entirely by
N-additions at the V-J junction. In donor M, a dominant
BV6S5 clonotype, having the totally N-encoded CDR3 region, LEHSTRP, represented 89% of the BV6S5+ clones
present after vSAG9 stimulation (Table 2), whereas this clonotype could not be detected in PHA-stimulated cells
(data not shown). The number of BV6S1, S3, and S4
present after vSAG9 stimulation was low in all donors, and
the total lack of CDR3 bias seen in these clones suggests
that they have not been amplified. Thus, the bias observed
in the CDR3 region of BV6S5 clones suggests that intimate MHC-TCR contacts might exist during vSAG response. Other studies have yielded similar results, as sequence analysis of TCR-
junctional regions in BV6+
CD4+ T cells that survived deletion mediated by vSAG7
showed a BJ usage and CDR3 length distribution that differed significantly from H2-matched mice lacking vSAG7
(8). Introduction of an E
transgene in SJL mice, which do
not express I-E and therefore can not present the endogenous vSAG9, restores deletion of BV17+ T cells; when
compared to nontransgenic mice, T cells having survived
negative selection showed increased BJ2S5 and decreased BJ1S1 usage, indicating that the nature of the BJ segment
can have an impact on T cell deletion (7). Our results are in
agreement with these studies and extend them by providing evidence that the structure of the CDR3 plays a positive role in vSAG responsiveness.
Model of MHC-vSAG-TCR Interaction.
Comparison of
HV4 sequences between BV6s and BV21s reveals that they
are highly homologous except for the presence of a glutamic acid at the tip of the HV4 loop in all nonresponding
BV6s. The allelic polymorphism between the BV6S7s is located next to that residue in which the glycine present in
BV6S7*1 is replaced by a glutamic acid in BV6S7*2. These
differences might partially explain the differential reactivity
observed between BV6 subfamily members. Although HV4
is clearly the overriding determinant in vSAG recognition,
it appears that a BV with a suboptimal HV4 would become
more dependent on stabilization provided by TCR-MHC
contacts. As mutagenesis of the CDR1 in murine BV6 was
shown to abrogate both vSAG7 and conventional antigen
recognition (20), this argues in favor of a similar MHC-
TCR topology. In addition, mutagenesis in CDR1 (but
not CDR2) affects vSAG responsiveness, and mutagenesis in CDR2 (but not CDR1) affects bSAG reactivity, indicating that vSAGs and bSAGs probably bind differently to the
TCR (21). Mutagenesis studies have shown the importance
of CDR2 in bSAG recognition (21, 22) and the structure
of SEC3 bound to TCR shows that it contacts the CDR2
peptide backbone and should act like a wedge between
TCR and MHC, allowing only part of the MHC to contact the TCR (10). In addition, the structure of SEB bound
to DR1 predicts that the SAG-MHC-TCR orientation
should differ by 45° compared to MHC-peptide-TCR orientation (23).
Our results and those from others (7, 8) indicate that BJ
usage impacts vSAG recognition. Although this region might be a contact site for vSAGs, we feel this is unlikely given
it is located opposite to HV4 (4, 9) and that the two
BV6S7*2 homozygous individuals used different BJs. The
BJ bias observed during vSAG9 response might be due to a
TCR interaction with a peptide present in the MHC groove,
since the BJ gene segment contributes for a significant portion of the CDR3 (4, 9). The different CDR3s found in
the two donors could be due to recognition of different peptides or a dominant peptide being recognized by both
TCRs, since TCRs having identical BV segments, but different CDR3 sequences, can recognize the same peptide-
MHC complex (24). Since the TCR
and
chains CDR1
and CDR2 are involved in MHC contacts (4), this would
explain
chain biases (5, 6) and the contribution of the
chain CDR1 (20, 21), whereas the skewed BJ usage observed (7, 8) could be explained by CDR3 contacts with
peptide-MHC complexes. Thus, the data in the literature
about the role of non-HV4 regions in vSAG responses
could be readily reconciled using a model in which vSAGs
cross-link MHC and TCR in a way that allows the interactions occurring during conventional antigen recognition to
exist.
 |
Footnotes |
Address correspondence to Dr. François Denis, Laboratoire d'Immunologie, Institut de Recherches Cliniques de Montréal, 110 Av. des Pins Ouest, Montréal, Québec, Canada H2W 1R7. Phone: 514-987-5549;
Fax: 514-987-5711; E-mail: denisf{at}ircm.umontreal.ca
Received for publication 17 July 1997 and in revised form 23 October 1997.
We would like to thank Walid Mourad for performing HLA typing of individuals and are grateful to Pascal
Lavoie, Hugo Soudeyns, and Ursula Utz for critical reading of the manuscript.
This work was supported by grant No. 6605-4847-AIDS from the National Health Research Development
Program to F. Denis and grant No. RG-544/95M from the Human Frontier Foundation to R.-P. Sékaly.
R.-P. Sékaly holds a Medical Research Council Scientist Award and C. Ciurli has received a PhD fellowship
from the National Health Research Development Program of Canada.
 |
References |
| 1.
|
Acha-Orbea, H.,
W. Held,
G.A. Waanders,
A.N. Shakhov,
L. Scarpellino,
R.K. Lees, and
H.R. MacDonald.
1993.
Exogenous and endogenous mouse mammary tumor virus superantigens.
Immunol. Rev.
131:
5-25
[Medline].
|
| 2.
|
Pullen, A.M.,
T. Wade,
P. Marrack, and
J.W. Kappler.
1990.
Identification of the region of the T cell receptor chain that
interacts with the self-superantigen Mls-1a.
Cell.
61:
1365-1374
[Medline].
|
| 3.
|
Cazenave, P.-A.,
P.N. Marche,
E. Jouvin-Marche,
D. Voegtlé,
F. Bonhomme,
D. Bandeira, and
A. Couthino.
1990.
V 17 gene polymorphism in wild-derived mouse strains: two
amino acid substitutions in the V 17 region greatly alter T cell
receptor specificity.
Cell.
63:
717-728
[Medline].
|
| 4.
|
Garboczi, D.N.,
P. Ghosh,
U. Utz,
Q.R. Fan,
W.E. Biddison, and
D.C. Wiley.
1996.
Structure of the complex between human T-cell receptor, viral peptide and HLA-A2.
Nature.
384:
134-141
[Medline].
|
| 5.
|
Smith, H.P.,
P. Le,
D.L. Woodland, and
M.A. Blackman.
1992.
T cell receptor -chain influences reactivity to Mls-1
in V 8.1 transgenic mice.
J. Immunol.
149:
887-896
[Abstract].
|
| 6.
|
Vacchio, M.S.,
O. Kanagawa,
K. Tomonari, and
R.J. Hodes.
1992.
Influence of T cell receptor V expression on Mlsa superantigen-specific T cell responses.
J. Exp. Med.
175:
1405-1408
[Abstract/Free Full Text].
|
| 7.
|
Candéias, S.,
C. Waltzinger,
C. Benoist, and
D. Mathis.
1991.
The V 17+ T cell repertoire: skewed J usage after
thymic selection; dissimilar CDR3s in CD4+ versus CD8+
cells.
J. Exp. Med.
174:
989-1000
[Abstract/Free Full Text].
|
| 8.
|
Chies, J.A.B.,
G. Marodon,
A.-M. Joret,
A. Regnault,
M.-P. Lembezat,
B. Rocha, and
A.A. Freitas.
1995.
Persistence of
V 6+ T cells in Mls-1a mice. A role for the third complementarity-determining region (CDR3) of the T cell receptor
chain in superantigen recognition.
J. Immunol.
155:
4171-4178
[Abstract].
|
| 9.
|
Garcia, K.C.,
M. Degano,
R.L. Stanfield,
A. Brunmark,
M.R. Jackson,
P.A. Peterson,
L. Teyton, and
I.A. Wilson.
1996.
An  T cell receptor structure at 2.5 Å and its orientation in the TCR-MHC complex.
Science.
274:
209-219
[Abstract/Free Full Text].
|
| 10.
|
Fields, B.A.,
E.L. Malchiodi,
H. Li,
X. Ysern,
C.V. Stauffacher,
P.M. Schlievert,
K. Karjalainen, and
R.A. Mariuzza.
1996.
Crystal structure of a T-cell receptor -chain complexed with a superantigen.
Nature.
384:
188-192
[Medline].
|
| 11.
|
Wei, S.,
P. Charmley,
M.A. Robinson, and
P. Concannon.
1994.
The extent of the human germline T-cell receptor V
beta gene segment repertoire.
Immunogenetics.
40:
27-36
[Medline].
|
| 12.
|
Vissinga, C.S.,
P. Charmley, and
P. Concannon.
1994.
Influence of coding region polymorphism on the peripheral expression of a human TCR V gene.
J. Immunol.
152:
1222-1227
[Abstract].
|
| 13.
|
Thibodeau, J.,
N. Labrecque,
F. Denis,
B.T. Huber, and
R.-P. Sékaly.
1994.
Binding sites for bacterial and endogenous retroviral superantigens can be dissociated on major histocompatibility complex class II molecules.
J. Exp. Med.
179:
1029-1034
[Abstract/Free Full Text].
|
| 14.
|
Labrecque, N.,
H. McGrath,
M. Subramanyam,
B.T. Huber, and
R.-P. Sékaly.
1993.
Human T cells respond to mouse
mammary tumor virus-encoded superantigen: V restriction
and conserved evolutionary features.
J. Exp. Med.
177:
1735-1743
[Abstract/Free Full Text].
|
| 15.
|
White, B.A., and
S. Rosenzweig.
1989.
The polymerase
chain reaction colony miniprep.
Biotechniques.
7:
696-698
[Medline].
|
| 16.
|
Liao, L.,
A. Marinescu,
A. Molano,
C. Ciurli,
R.-P. Sékaly,
J.D. Fraser,
A. Popowicz, and
D.N. Posnett.
1996.
TCR binding differs for a bacterial superantigen (SEE) and a viral superantigen (Mtv-9).
J. Exp. Med.
184:
1471-1482
[Abstract/Free Full Text].
|
| 17.
|
Wong, F.S.,
M.L. Hibberd,
L. Wen,
B.A. Millward, and
A.G. Demaine.
1993.
The human T cell receptor V repertoire of normal peripheral blood lymphocytes before and after
mitogen stimulation.
Clin. Exp. Immunol.
92:
361-366
[Medline].
|
| 18.
|
Rowen, L.,
B.F. Koop, and
L. Hood.
1996.
The complete
685-kilobase DNA sequence of the human T cell receptor locus.
Science.
272:
1755-1762
[Abstract].
|
| 19.
|
Lechler, R.I.,
V. Bal,
J.B. Rothbard,
R.N. Germain,
R. Sékaly,
E.O. Long, and
J. Lamb.
1988.
Structural and functional studies of HLA-DR restricted antigen recognition by
human helper T lymphocyte clones by using transfected cell lines.
J. Immunol.
9:
3003-3009
.
|
| 20.
|
Kang, J.,
C.A. Chambers,
J. Pawling,
C. Scott, and
N. Hozumi.
1994.
Conserved amino acid residues in the complementarity-determining region 1 of the TCR -chain are involved in the recognition of conventional Ag and Mls-1
superantigen.
J. Immunol.
152:
5305-5317
[Abstract].
|
| 21.
|
Hong, S.-C.,
G. Waterbury, and
C.A. Janeway Jr..
1996.
Different superantigens interact with distinct sites in the V
domain of a single T cell receptor.
J. Exp. Med.
183:
1437-1446
[Abstract/Free Full Text].
|
| 22.
|
Patten, P.A.,
E.P. Rock,
T. Sonoda,
B. Fazekas de St,
Groth,
J.J. Jorgensen, and
M.M. Davis.
1993.
Transfer of putative
complementarity determining region loops of T cell receptor
V domains confers toxin reactivity but not peptide/MHC specificity.
J. Immunol.
150:
2281-2294
[Abstract].
|
| 23.
|
Jardetzky, T.S.,
J.H. Brown,
J.C. Gorga,
L.J. Stern,
R.G. Urban,
Y.I. Chi,
C. Stauffacher,
J.L. Strominger, and
D.C. Wiley.
1994.
Three-dimensional structure of a human class II
histocompatibility molecule complexed with a superantigen.
Nature.
368:
711-718
[Medline].
|
| 24.
|
Boitel, B.,
M. Ermonval,
P. Panina-Bordignon,
R.A. Mariuzza,
A. Lanzavecchia, and
O. Acuto.
1992.
Preferential V
usage and lack of junctional sequence conservation among T cell receptors specific for a tetanus toxin-derived peptide: evidence for a dominant role of a germline-encoded V region
in antigen/major histocompatibility complex recognition.
J. Exp. Med.
175:
765-777
[Abstract/Free Full Text].
|