|
||
s-linked) Receptors
By




From the * Department of Medicine; the
Department of Surgery; and the § Laboratory for
Cardiovascular Research, New York University Medical Center, New York 10016
The complete healing of wounds is the final step in a highly regulated response to injury. Although many of the molecular mediators and cellular events of healing are known, their manipulation for the enhancement and acceleration of wound closure has not proven practical as
yet. We and others have established that adenosine is a potent regulator of the inflammatory response, which is a component of wound healing. We now report that ligation of the G
s-linked adenosine receptors on the cells of an artificial wound dramatically alters the kinetics of
wound closure. Excisional wound closure in normal, healthy mice was significantly accelerated by topical application of the specific A2A receptor agonist CGS-21680 (50% closure by day 2 in
A2 receptor antagonists. In rats rendered diabetic (streptozotocin-induced diabetes mellitus)
wound healing was impaired as compared to nondiabetic rats; CGS-21680 significantly increased the rate of wound healing in both nondiabetic and diabetic rats. Indeed, the rate of
wound healing in the CGS-21680-treated diabetic rats was greater than or equal to that observed in untreated normal rats. These results appear to constitute the first evidence that a small
molecule, such as an adenosine receptor agonist, accelerates wound healing in both normal animals and in animals with impaired wound healing.
Wound healing is a complex process characterized by
three overlapping phases: inflammation, tissue formation, and tissue remodeling. During tissue formation,
growth factors synthesized by local and migratory cells stimulate fibroblasts to migrate into the wound where they proliferate and construct an extracellular matrix. In response to
many of the same growth factors, keratinocytes migrate from
the edge of the wound over the surface of the injured area
and proliferate until the wound is completely covered. Both matrix formation and epithelialization, in turn, depend upon
angiogenesis, a process that occurs through the migration,
proliferation, and organization of vascular endothelial cells.
Earlier studies demonstrated that a variety of peptide growth
factors may promote reepithelialization, migration of fibroblasts into a wound, and angiogenesis, but no small molecules of potentially greater use have yet been shown to enhance the rate at which wounds close in normal healthy
animals (1).
Because of their potent effects on some of the cells involved in wound healing, we hypothesized that adenosine
receptor agonists promote wound healing both in vitro and
in vivo. Previous studies have demonstrated that adenosine,
acting at A2 receptors, inhibits neutrophil accumulation and
function (2) and promotes endothelial cell proliferation,
migration, and secretion of growth factors (3). In contrast, adenosine receptor occupancy inhibits keratinocyte proliferation (7) and its effects on fibroblast proliferation are
inconsistent (3, 8). Four adenosine receptors have been cloned and the deduced sequences reveal that all four are
members of the large family of 7 transmembrane-spanning,
G protein-coupled receptors. Three of the adenosine receptor subtypes, A1, A2A, and A2B, are highly conserved
throughout evolution (80-95% sequence homology), whereas
the A3 receptors differ significantly among species (for review see reference 9). Adenosine A1 and A2 receptors were
first differentiated by their opposing effects on cAMP accumulation (10, 11), effects mirrored, in some cell types (e.g.,
neutrophils), by opposing functional effects (for review see
reference 2).
Because results of preliminary in vitro studies indicated that
adenosine A2 receptor agonists promoted fibroblast and endothelial cell migration into an artificial wound, we tested
the effects of a specific adenosine A2A receptor agonist, CGS-21680 (4-[{N-ethyl-5 Materials.
CGS-21680, DMPX (3,7-dimethyl-1-propargylxanthine), and CSC (8-(3-chlorostyryl)caffeine) were obtained from
Research Biochemicals, Inc. (Natick, MA). Tissue culture media
and reagents were obtained from GIBCO BRL (Bethesda, MD).
Cell Lines.
Fibroblasts (CCD-25sk) were obtained from the
American Type Culture Collection (Rockville, MD) and were
originally derived from normal human dermal fibroblasts. These cells
were grown to confluence in standard tissue culture medium consisting of MEM/10% fetal bovine serum (vol/vol). HUVEC were
obtained by modifications of the method of Jaffe et al. (12). In
brief, HUVEC were obtained by collagenase treatment of fresh
human umbilical cords and grown to confluence in medium 199 with 20% fetal bovine serum, antibiotics, and endothelial growth
supplement at 37°C in a 5% CO2 atmosphere (12, 13). The experiments in the study were performed on HUVEC in their third
passage.
Reverse Transcriptase-PCR of Adenosine Receptor mRNA.
Total
RNA from confluent monolayers of either HUVEC or CCD-25sk cells was isolated by the RNAzolTM B method (Tel-Test,
Inc., Friendswood, TX) and first-strand cDNA was synthesized by
GeneAmpTM RNA PCR Core Kit (Perkin-Elmer Corp., Branchburg, NJ) according to the directions. The amplification primers
for the adenosine receptor messages have been previously described by Nilsen et al. (Nilsen, D., A. Talbot, C. Aston, R. Hirschhorn, B.N. Cronstein, and J. Reibman, manuscript submitted for
publication) and Boyle et al. (14). Upstream primers for the A1,
A2A and the A2B receptors were GGTGGAATTCTCCATCTCAGCTTTCCAGGC, GGTGGAATTCAACAACTGCGGTCAGCCAAA, and GGTGGAATTCGAACCACGAATGAAAGCTGC, respectively, and the downstream primers were
GGTGAAGCTTTCGAACTCGCACTTGATCAC, GGTGAAGCTTCAGCTGCCTTGAAAGGTTCT, and GGTGAAGCTTTGACCATTCCCACTCTTGAC, respectively. The nested
amplification primers for A3 receptors were AACGTGCTGGTCATCTGCGTGGTC (upstream), GTAGTCCATTCTCATGACGGAAAC (downstream), and CTGCAGACCACCACCTTCTATTTC (nested). Template first-strand cDNA (150 ng) was
added to a reaction mixture which included dNTPs (0.2 mM
each), Mg2+ (25 mM) and appropriate primers (1 mM), and Taq
DNA polymerase (0.025 U/µl) in a final volume of 50 µl. The
PCR was carried out in a thermocycler (GeneAmp 2400; Perkin-Elmer) programmed as follows: 94°C (2 min), and then 35 cycles
of 94°C (1 min), 58°C (1 min), 72°C (3 min), followed by a 10-min terminal extension (72°C) for the A1 receptor. The A2A, A2B,
and A3 receptors were amplified using the following program:
94°C (2 min), and then 35 cycles of 94°C (30 s), 58°C (30 s), and
72°C (45 s), followed by a 10-min terminal extension (72°C).
PCR products were separated in a 1.8% agarose gel. Sequencing
of the PCR products confirmed their identity with previously
described portions of the appropriate adenosine receptors.
Excisional Wound Formation.
Two sterile, full-thickness excisional wounds (12 mm in diameter) were formed on the dorsum
of anesthetized 6-8-wk-old male and female mice (BALB/c) using a
template and scissors. Wounds were treated daily with topical application of 20 µl of either the adenosine agonist CGS-21680
(250 µg/ml) or vehicle (1.5%, wt/vol carboxymethylcellulose in
PBS) in the presence or absence of either the adenosine receptor
antagonist DMPX (2.5 mg/ml) or CSC (250 µg/ml). Mice were
kept in individual cages to minimize licking of the wounds or applied agents. To determine the rate of closure, wounds were
traced onto clear plastic sheets on a daily basis and the area of the
wounds was quantitated by digitization of the wound tracings using a WACOM digitizing pad and Scan Analysis (Specom Research, Ferguson, MO) software. These experiments were approved by the Institutional Animal Care and Use Committee
(New York University School of Medicine).
Excisional Wound Formation in Rats Rendered Diabetic.
Adult
(330-400 g) female Sprague-Dawley rats were given a single intraperitoneal injection of streptozotocin (60 mg/kg). Animals were
then rested for 8 d before excision of 2.0 cm wounds on the dorsum of the rats (15, 16). Wounds were treated daily with topical
application of 20 µl of either the adenosine agonist CGS-21680
(250 µg/ml) or vehicle (1.5%, wt/vol carboxymethylcellulose in
PBS). The animals were kept in individual cages to minimize the
licking of the wounds or applied agents. The rate of wound closure was determined as described above. Mean serum glucose, tested
on the final day of the experiment using the Easy Test® Strips for
glucose with an Accu-Chek® EasyTM Monitor (Boehringer-Mannheim, Indianapolis, IN), was 156 ± 18.5 mg/dl in the nondiabetic
rats as compared to 432 ± 25 mg/dl in the diabetic rats. Seven
rats died after injection of streptozotocin but before excision of
the wounds and seven other diabetic rats died during the course
of these experiments (five control rats and two CGS-21680-
treated rats).
Histologic Analysis.
Some animals were killed on the stated
day by CO2 poisoning, and then wounds were excised and histologic slides were made using standard methods. Slides, stained
with hematoxylin and eosin, were graded using a variation of the
scoring described by Tsuboi and Rifkin (17). In brief, reepithelialization was measured on a score from 1 to 10 (1 = no closure;
10 = complete closure). Matrix density was scored from 1 to 4 (1 = edematous with little matrix; 2 = a small amount of coarse matrix; 3 = a moderate amount of matrix; and 4 = dense matrix).
Fibroblast infiltrate was scored from 1 to 4 (1 = few fibroblasts; 2 = a moderate number of fibroblasts; 3 = many cells; and 4 = very
many cells). Inflammatory cells were graded from 1 to 4 (1 = very many cells; 2 = many cells; 3 = a moderate number of cells;
4 = few cells). A maximum composite score of 22 can be obtained. All slides were graded in a blinded fashion.
To establish the profile of adenosine
receptors expressed by fibroblasts and endothelial cells, we
determined whether mRNA for adenosine A1, A2A, A2B,
and A3 receptors was present in cultured dermal fibroblasts
and HUVEC by use of reverse transcriptase-PCR. As shown
in Fig. 1, message for A2A, A2B, and A3 receptors was present
in both fibroblasts and HUVEC. In contrast, message for A1 receptors was expressed in HUVEC but not in fibroblasts. Results of other in vitro studies with these cells indicated that occupancy of adenosine A2 receptors, both A2A
and A2B receptors, promoted migration of both fibroblasts
and HUVEC into an artificial in vitro wound by a cAMP-dependent mechanism (data not shown).
The observation that both
HUVEC and dermal fibroblasts express mRNA for both A2A
and A2B receptors, the preliminary finding that adenosine
A2 receptor occupancy increases the rate of fibroblast migration, and the previous demonstration that agents binding to adenosine A2 receptors may promote angiogenesis (3)
all suggested that an adenosine A2 receptor agonist might
accelerate wound healing in vivo. To test this hypothesis
we studied the effect of the topical application of CGS-21680, the specific A2A agonist, on wound healing in
healthy, young (6-8-wk-old) BALB/c mice. As shown in
Fig. 2, wound closure was significantly more rapid in the
CGS-21680-treated mice than the mice treated with carrier alone (50% wound closure by day 2 versus by day 6;
P <0.00001, n = 10 wounds per group). Topical application of the adenosine A2 receptor antagonist DMPX (2.5 mg/ml) did not affect wound healing itself, but completely
reversed the effects of CGS-21680 on the rate of wound
closure (Fig. 2 A). Similarly, the more selective A2A receptor antagonist CSC also completely reversed the effect of
CGS-21680 on wound healing (Fig. 2 B). Upon histologic
examination of the wounds, fibroblast infiltration, matrix
density, and reepithelialization were markedly enhanced in
the CGS-21680-treated animals as compared to controls
(Fig. 3). Surprisingly, in contrast to the demonstrated antiinflammatory effects mediated by adenosine A2 receptor
occupancy (2), CGS-21680 did not affect the inflammatory
infiltrate in the wound until day 10 after wounding. The
change in inflammatory infiltrate observed so late in the
course of wound closure may have resulted from earlier
wound closure rather than any direct effect of CGS-21680
on inflammatory infiltrate in the wound. Topical application of CGS-21680 to open wounds had no obvious toxic
effect on the mice.
Patients with diabetes mellitus suffer from impaired wound healing, and
poor wound healing is responsible for significant morbidity
and mortality in these patients. To determine whether an
adenosine A2A receptor agonist might be useful in the promotion of wound healing in patients with diabetes, we
studied the effect of topical application of the adenosine receptor agonist CGS-21680 to full-thickness wounds in rats
rendered diabetic by a single injection of streptozotocin. As
expected, streptozotocin-treated rats had high serum glucose concentrations (432 ± 25 mg/dl in the diabetic rats
versus 156 ± 18.5 mg/dl in the nondiabetic; P <0.00001)
and the wounds of the diabetic animals healed more slowly
than those of the control animals (50% closure by day 9 versus by day 7, respectively; P <0.0001; Fig. 4). As with
the normal young mice, topical application of CGS-21680
significantly promoted wound healing in the healthy nondiabetic rats (50% closure by day 4; P <0.0001, Fig. 4). More
importantly, application of CGS-21680 increased the rate
at which the diabetic animals closed their wounds (50%
closure by day 6, P <0.0001, versus control diabetic rats,
Fig. 4) but did not affect the serum glucose concentration (432 ± 31 mg/dl versus 407 ± 40 mg/dl in the control
and CGS-21680-treated diabetic rats, respectively; P = NS). Indeed, the rate of wound healing in CGS-21680-
treated diabetic animals was as good as or better than that in
the untreated controls (Fig. 4).
The results reported here demonstrate that occupancy of
adenosine A2A receptors increases the rate at which wounds
heal in young, healthy mice and rats as well as in diabetic
rats. To our knowledge, this is the first demonstration that
a small nonpeptide agent, such as a purine nucleoside, promotes wound healing. Equally striking is the finding that
this phenomenon occurs in normal, healthy animals, since
only a few of the known peptide growth factors that accelerate wound healing in sick animals also accelerate wound
closure in healthy animals (1).
Preliminary studies in our laboratory indicated that adenosine A2 receptor occupancy, both A2A and A2B, contributes to enhanced fibroblast and endothelial cell migration.
Signal transduction at adenosine A2A and A2B receptors proceeds, at least in part, via activation of heterotrimeric G proteins leading to both cAMP-dependent and cAMP-independent signaling events (2, 9, 18). Our studies demonstrate
that adenosine receptor occupancy promotes fibroblast and
endothelial cell migration by a cAMP- and PKA-dependent pathway. In contrast, Sexl et al. have reported that adenosine A2A receptor occupancy modulates endothelial cell
proliferation by a cAMP-independent mechanism (4, 19).
These disparate findings suggest that stimulation of migration and proliferation in endothelial cells are mediated by
different signal transduction pathways which diverge after
occupancy of adenosine A2A receptors. However, there is
no evidence that these divergent effects of adenosine receptor occupancy occur in other cell types. Regardless of the
signal transduction pathway involved, our data clearly indicate that agents that occupy adenosine A2 receptors, receptors linked to G It is unlikely that an adenosine receptor-mediated increase in fibroblast migration and angiogenesis is solely responsible for accelerating wound closure. Previous studies
have demonstrated that adenosine and its analogues, acting
at A2A receptors, increase secretion of vascular endothelial
growth factor in addition to promoting endothelial cell
proliferation and migration [3-6]. These observations suggest that one mechanism by which adenosine receptor occupancy increases the rate of wound closure is by promoting secretion of growth factors that act locally. Alternatively,
by inhibiting the secretion of a variety of inflammatory cytokines (TNF- We conclude that adenosine A2 receptor agonists promote wound healing in normal and diabetic animals. This
is the first example of a member of the 7 transmembrane-
spanning, heterotrimeric G protein-associated family of receptors that, when occupied, promote wound healing by
itself. Moreover, unlike some growth factors, occupation of
adenosine A2A receptors promotes wound healing even in
young, healthy animals (1). The observation that this same adenosine receptor agonist promotes wound healing in diabetic animals as well suggests an entirely novel approach for
development of agents that promote wound healing in both
normal individuals and individuals with impaired wound
healing.
-carbamoyladenos-2-yl}aminoethyl] phenylpropionic acid), on wound healing in normal mice
and rats and in rats rendered diabetic. We report here that
adenosine, acting at specific A2A receptors, promotes healing both in normal, healthy, young animals and in diabetic
animals with impaired wound healing.
Endothelial Cells and Fibroblasts Express Message for Multiple
Adenosine Receptors.
Fig. 1.
Endothelial cells
(HUVEC) and a fibroblast cell
line (CCD-25sk) express message for adenosine receptor subtypes. RNA was isolated from
confluent monolayers of either
HUVEC or CCD-25sk cells, as described. cDNA was generated from the
isolated mRNA by reverse transcriptase and the message for the adenosine receptors was amplified by antisense primers as described. Shown is
one of two experiments yielding similar results.
[View Larger Version of this Image (18K GIF file)]
Fig. 2.
The effect of the adenosine A2A agonist CGS-21680 (250 µg/ml) on wound closure. (A) Wounds were excised on the dorsum of
mice and treated with carrier (1.5% methylcellulose), CGS-21680, the adenosine A2 antagonist DMPX (2.5 mg/ml), or their combination, as described. Wounds were traced daily and the area was determined after
computer digitization of the wounds. (B) Wounds were excised on the
dorsum of mice and treated with carrier (1.5% methylcellulose), CGS-21680, the adenosine A2A antagonist CSC (250 µg/ml), or their combination, as described. Each point represents the mean (± SEM) of 10 wounds. Similar results were found in two other experiments.
[View Larger Version of this Image (19K GIF file)]
Fig. 3.
Histologic analysis
of wounds in control and CGS-21680-treated mice. Wounds
were excised and mice were
treated with topical application
either of carrier or CGS-21680
in carrier. Analysis of fibroblast
density (A), matrix density (B),
epithelial closure (C), and inflammatory cell infiltrate (D) was
carried out blindly, as described.
Each point represents the mean
(± SEM) of six wounds on three
mice.
[View Larger Versions of these Images (11 + 11 + 11 + 11K GIF file)]
Fig. 4.
The effect of the adenosine A2A agonist CGS-21680 on
wound closure in normal and diabetic rats. Animals received a single injection of streptozotocin (60 mg/kg) followed 8 d later by excision of
three wounds (2 cm in diameter) on the dorsum of each rat. Wounds
were treated with carrier (1.5% methylcellulose/PBS, wt/vol) alone or
CGS-21680 (250 µg/ml) in carrier. The wounds were traced at the indicated intervals and the area was determined after computer digitization of
the wounds. Each point represents the mean (± SEM) of 9-21 wounds.
[View Larger Version of this Image (14K GIF file)]
S signal transduction proteins, promote wound healing.
, IL-6, IL-8) adenosine receptor occupancy
might diminish the secretion of agents that inhibit wound
healing (20). Another explanation for the effects of adenosine receptor occupancy on wound healing is suggested
by the work of Boyle et al. who reported that adenosine A2
receptor occupancy specifically inhibits synthesis and secretion of collagenase by synovial fibroblasts (14). Thus, diminished matrix degradation within the wound might also
enhance wound closure. Therefore, it is likely that there
are a number of adenosine-mediated effects that contribute
to the accelerated rate of wound closure and that are mediated by ligation of adenosine receptors.
Address correspondence to Dr. B.N. Cronstein, Department of Medicine, NYU Medical Center, 550 1st Ave., New York, NY 10016. Phone: 212-263-6404; FAX: 212-263-8804; E-mail: cronsb01{at}mcrcr6.med.nyu.edu
Received for publication 28 May 1997 and in revised form 29 August 1997.
This study was supported by grants from the Systemic Lupus Erythematosus Foundation, Inc. (M.C. Montesinos), the Arthritis Foundation, NY Chapter (E. Ostad), the Public Health Service, National Institutes of Health, Bethesda, MD (HL-RO1-51631 to J. Reibman, AI-R37-10343 to R. Hirschhorn, and AI/AR-41911, AR-11949, and HL-19721 to B.N. Cronstein), and the General Clinical Research Center (MO1RR00096) and the Kaplan Cancer Center (CA16087; New York University Medical Center).
| 1. | Pierce, G.F., and T.A. Mustoe. 1995. Pharmacologic enhancement of wound healing. Ann. Rev. Med. 46: 467-481 [Medline]. |
| 2. |
Cronstein, B.N..
1994.
Adenosine, an endogenous anti-inflammatory agent.
J. Appl. Physiol.
76:
5-13
|
| 3. |
Ethier, M.F.,
V. Chander, and
J.G. Dobson Jr..
1993.
Adenosine stimulates proliferation of human endothelial cells in
culture.
Am. J. Physiol.
265:
H131-H138
|
| 4. | Sexl, V., G. Mancusi, S. Baumgartner-Parzer, W. Schutz, and M. Freissmuth. 1995. Stimulation of human umbilical vein endothelial cell proliferation by A2-adenosine and beta 2-adrenoceptors. Br. J. Pharmacol. 114: 1577-1586 [Medline]. |
| 5. | Bull, D.A., E.A. Seftor, M.J. Hendrix, D.F. Larson, G.C. Hunter, and C.W. Putnam. 1993. Putative vascular endothelial cell chemotactic factors: comparison in a standardized migration assay. J. Surg. Res. 55: 473-479 [Medline]. |
| 6. |
Meininger, C.J.,
M.E. Schelling, and
H.J. Granger.
1988.
Adenosine and hypoxia stimulate proliferation and migration
of endothelial cells.
Am. J. Physiol.
255:
H554-H562
|
| 7. | Cook, P.W., N.M. Ashton, and M.R. Pittelkow. 1995. Adenosine and adeinine nucleotides inhibit the autonomous and epidermal growth factor-mediated proliferation of cultured human keratinocytes. J. Invest. Dermatol. 104: 976-981 [Medline]. |
| 8. | Ahmed, A.H., K. A. Jacobson, J. Kim, and L.A. Heppel. 1995. Presence of both A1 and A2a adenosine receptors in human cells and their interaction. Biochem. Biophys. Res. Commun. 208: 871-878 [Medline]. |
| 9. | Olah, M.E., and G.L. Stiles. 1995. Adenosine receptor subtypes: characterization and therapeutic regulation. Annu. Rev. Pharmacol. Toxicol. 35: 581-606 [Medline]. |
| 10. | van Calker, D., M. Muller, and B. Hamprecht. 1979. Adenosine regulates, via two different types of receptors, the accumulation of cyclic AMP in cultured brain cells. J. Neurochem. 33: 999-1005 [Medline]. |
| 11. |
Londos, C.,
D.M.F. Cooper, and
J. Wolff.
1980.
Subclasses
of external adenosine receptors.
Proc. Natl. Acad. Sci. USA.
77:
2551-2554
|
| 12. | Jaffe, E.A., R.L. Nachman, C.G. Becker, and C.R. Minick. 1973. Culture of human endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J. Clin. Invest. 52: 2745-2756 . |
| 13. | Levin, R.I., D.A. Moscatelli, and P.A. Recht. 1993. Oxalate, a potential atherogenic toxin of uremia, inhibits endothelial proliferation induced by heparin-binding growth factors in vitro. Endothelium: Journal Endothelial Research 1:179-192. |
| 14. | Boyle, D.L., F.G. Sajjadi, and G.S. Firestein. 1996. Inhibition of synoviocyte collagenase gene expression by adenosine receptor stimulation. Arthritis Rheum. 39: 923-930 [Medline]. |
| 15. | Covington, D.S., H. Xue, R. Pizzini, K.P. Lally, and R.J. Andrassy. 1993. Streptozotocin and alloxan are comparable agents in the diabetic model of impaired wound healing. Diabetes Res. 23: 47-53 [Medline]. |
| 16. | Greenwald, D.P., S. Shumway, L.S. Zachary, M. LaBarbera, P. Albear, M. Temaner, and L.J. Gottlieb. 1993. Endogenous versus toxin-induced diabetes in rats: a mechanical comparison of two skin wound-healing models. Plast. Reconstr. Surg. 91: 1087-1093 [Medline]. |
| 17. |
Tsuboi, R., and
D.B. Rifkin.
1990.
Recombinant basic fibroblast growth factor stimulates wound healing in healing-impaired db/db mice.
J. Exp. Med.
172:
245-251
|
| 18. |
Revan, S.,
M.C. Montesinos,
D. Naime,
S. Landau, and
B.N. Cronstein.
1996.
Adenosine A2 receptor occupancy
regulates stimulated neutrophil function via activation of a
serine/threonine protein phosphatase.
J. Biol. Chem.
271:
17114-17118
|
| 19. |
Sexl, V.,
G. Mancusi,
C. Holler,
E. Gloria-Maercker,
W. Schutz, and
M. Freissmuth.
1997.
Stimulation of the mitogen-activated protein kinase via the A2A-adenosine receptor in
primary human endothelial cells.
J. Biol. Chem.
272:
5792-5799
|
| 20. |
Parmely, M.J.,
W.-W. Zhou,
C.K. Edwards III,
D.R. Borcherding,
R. Silverstein, and
D.C. Morrison.
1993.
Adenosine and a related carbocyclic nucleoside analogue selectively inhibit tumor necrosis factor- production and protect
mice against endotoxin challenge.
J. Immunol.
151:
389-396
[Abstract].
|
| 21. | Bouma, M.G., R.K. Stad, F.A.J.M. van den Wildenberg, and W.A. Buurman. 1994. Differential regulatory effects of adenosine on cytokine release by activated human monocytes. J. Immunol. 153: 4159-4168 [Abstract]. |
| 22. | Cronstein, B.N., D. Naime, and G.S. Firestein. 1995. The antiinflammatory effects of an adenosine kinase inhibitor are mediated by adenosine. Arthritis Rheum. 38: 1040-1045 [Medline]. |
| 23. |
Sajjadi, F.G.,
K. Takabayashi,
A.C. Foster,
R.C. Domingo, and
G.S. Firestein.
1996.
Inhibiton of TNF expression by
adenosine: role of A3 adenosine receptors.
J. Immunol.
156:
3435-3442
[Abstract].
|
| 24. | Bouma, M.G., F.A.J.M. van den Wildenberg, and W.A. Buurman. 1996. Adenosine inhibits cytokine release and expression of adhesion molecules by activated human endothelial cells. Am. J. Physiol. 39: C522-C529 . |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|