|
||
By
* From the University of Texas Medical Branch, Department of Internal Medicine, Allergy and Immunology Division, Galveston, TX 77555-0762
Interleukin-5 (IL-5) regulates the growth and function of eosinophils. It induces rapid tyrosine
phosphorylation of Lyn and Jak2 tyrosine kinases. The role of tyrosine phosphatases in IL-5 signal transduction has not been investigated. In this study, we provide first evidence that SH2
protein tyrosine phosphatase 2 (SHPTP2) phosphotyrosine phosphatase plays a key role in prevention of eosinophil death by IL-5. We found that IL-5 produced a rapid activation and tyrosine phosphorylation of SHPTP2 within 1 min. The tyrosine phosphorylated SHPTP2 was
complexed with the adapter protein Grb2 in IL-5-stimulated eosinophils. Furthermore,
SHPTP2 appeared to physically associate with
common (
c) chain of the IL-5 receptor (IL-5
cR). The association of SHPTP2 with IL-5
cR was reconstituted using a synthetic phosphotyrosine-containing peptide,
c 605-624, encompassing tyrosine (Y)612. The binding to the
phosphotyrosine-containing peptide increased the phosphatase activity of SHPTP2, whereas
the same peptide with the phosphorylated Y612
F mutation did not activate SHPTP2. Only
SHPTP2 antisense oligonucleotides, but not sense SHPTP2, could inhibit tyrosine phosphorylation of microtubule-associated protein kinase, and reverse the eosinophil survival advantage
provided by IL-5. Therefore, we conclude that the physical association of SHPTP2 with the
phosphorylated
c receptor and Grb2 and its early activation are required for the coupling of
the receptor to the Ras signaling pathway and for prevention of eosinophil death by IL-5.
Eosinophils play an integral role in the pathogenesis of
allergic and parasitic disorders (1). IL-5 is a cytokine
that primarily promotes the differentiation of eosinophils
from the stem cells and stimulates the survival and function
of mature eosinophils (2). This diverse effect of IL-5 on
eosinophils has been proposed as the key mechanism for
the development of blood and tissue eosinophilia in the
course of allergic inflammation.
IL-5R is a member of the hematopoietic receptor superfamily and is composed of a ligand-specific Little is known about the function of protein tyrosine
phosphatases (PTPs)1 in the signaling process initiated by the
receptors of the cytokine receptor superfamily. The PTP
Src homology (SH)PTP2, recently designated Src homology 2 phosphatase 2 (SHP2) and also called PTP1D or Syp,
is one member of a small family of Src homology 2 (SH2)
domain-containing PTPs, which also includes Corkscrew (Csw) and PTP-1C (also called SH-PTP1 or HCP) (7, 8).
SHPTP2 contains two SH2 domains and a single catalytic
domain. This phosphatase is ubiquitously expressed and
found to be tyrosine phosphorylated and activated in response
to erythropoietin, platelet-derived growth factor (PDGF),
prolactin, IL-3, and GM-CSF (9). Upon specific stimulation, SHPTP2 binds to the receptor for PDGF and Epo.
Once phosphorylated on tyrosine, SHPTP2 generates a
binding site for the adapter protein, Grb2, which in turn
may lead to activation of the Ras-signaling pathway (13,
14). Although it has been postulated that PTPs function as
the negative regulators of the signal generated by protein
tyrosine kinases, several recent studies show that the inactivation of SHPTP2 leads to a decrease in mitogenesis in response to epidermal growth factor, PDGF, and insulin, indicating that this phosphatase may, in some instances, act as
a positive signal transmitter (11, 15, 16).
The role of SHPTP2 in the IL-5 signal transduction in
eosinophils has not been investigated. In this study we investigated the phosphorylation state, association with other
proteins, and catalytic activity of this phosphatase after triggering of the IL-5R. Furthermore, using specific antisense
oligodeoxynucleotides, we investigated the role of SHPTP2
in IL-5-mediated prolongation of eosinophil survival.
Reagents.
Percoll was purchased from Pharmacia, Inc. (Piscataway, NJ). The mAb against antiphosphotyrosine (clone 4G10) was
obtained from Upstate Biotechnology Inc. (Lake Placid, NY). Rabbit polyclonal anti-SHPTP2, anti-Grb2, anti-Erk 2, and monoclonal anti-IL-5 Eosinophil Purification.
Peripheral blood for eosinophil purification was obtained from subjects with mild to moderate eosinophilia (6-12%). Eosinophils were isolated by sedimentation with
3% hydroxyethyl starch, followed by centrifugation on discontinuous Percoll gradients according to the method of Gartner, as described previously (17). The cells were further purified by negative selection using anti-CD16 immunomagnetic beads (Miltenyi
Biotec, Bergisch Gladbach, Germany). Eosinophils (>99% purity) were then suspended in RPMI 1640 in tubes coated with
3% human serum albumin.
Preparation of Cytosolic Cell Extracts and Immunoprecipitation.
Eosinophils (2-4 × 106/ml) were incubated with IL-5 at a concentration of 10
subunit and
shared with IL-3 and GM-CSF
common (
c) subunit
(3). Although neither of the receptor subunits contain a kinase-like catalytic domain, IL-5 does induce a rapid and reversible tyrosine phosphorylation of various cellular proteins (4). Recent findings indicate that for IL-5R type, the
binding of the ligand results in the activation of cytoplasmic
tyrosine kinases of the Jak/Tyk and Src type families (5, 6).
Indeed, we have shown that the stimulation of eosinophils
with IL-5 results in phosphorylation and activation of the
receptor-bound Lyn and Jak2 kinases. The consequence of
activation of these tyrosine kinases is the propagation of signal through the ras-raf-1-MEK-MAP (MAP, microtubule-associated protein, MEK, MAP or Erk kinase) kinase pathway and the Jak-STAT pathway. These observations clearly
support a major role of protein tyrosine phosphorylation in
IL-5-mediated signaling.
R antibodies were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA). Enhanced chemiluminescence
detection system was purchased from Amersham Corp. (Arlington Heights, IL).
10 M or medium at 37°C for 5 min. When kinetic studies were performed, IL-5 was added to samples at 0, 25, and 29 min, and all samples were harvested at 30 min, i.e., eosinophils were stimulated for 30, 5, and 1 min, respectively. This way
of stimulation allowed us to use one control sample, and all samples could be prepared simultaneously, under the same conditions. The stimulation was terminated by addition of 1 vol of ice-cold PBS containing 1 mM Na3VO4. The cells were pelleted by
centrifugation, washed rapidly with PBS, and lysed in a buffer containing 50 mM Tris HCl, pH 7.4, 150 mM NaCl, 1 mM EGTA,
0.25% sodium deoxycholate, 1 mM PMSF, 1 mM Na3VO4, 1 mM
NaF, 0.5% Triton X-100, and 1 µg/ml of aprotinin, leupeptin,
and pepstatin. For study of phosphatase activity, Na3VO4 was excluded from PBS and lysis buffer. After an incubation on ice for
10 min, the lysates were passaged several times through a 26-gauge needle, and detergent insoluble materials were removed by
centrifugation at 4°C at 12,000 g. The protein concentration was
determined using bicinchoninic acid assay (Pierce Chem. Co., Rockford, IL).
Immune Complex Phosphatase Assay. Immunoprecipitates of SHPTP2 were prepared as described above and washed sequentially 3 times with the cold lysis buffer (without Na3VO4) and 3 times with the phosphatase buffer (50 mM Hepes, pH 7.4, 60 mM NaCl, 60 mM KCl, 0.1 mM PMSF, 1 µM pepstatin, 5 µg/ml aprotinin, 1 µg/ml leupeptin) (15, 18). Phosphatase activity was assayed by resuspending the final pellet in a total volume of 80 µl of reaction buffer (phosphatase buffer, pH 5.5, containing 1 mg/ml bovine serum albumin, 5 mM EDTA, 10 mM dithiothreitol). The reaction was initiated by the addition of para-nitrophenyl phosphate (10 nM, final concentration) for 30 min at 30°C. The reaction was stopped by the addition of 0.9 ml of 1 N NaOH, and the absorbance of the samples was measured at 410 nm.
Peptide Binding Assay.
A biotinylated and tyrosine phosphorylated peptide corresponding to the amino acid residues 605-624
of IL-5
R (biotin-PPPGSLE phosphorylated tyrosine (pY)612LCLPAGGQVQLV-NH2) was synthesized by the Quality Controlled
Biochemicals, Inc. (Hopkinton, MA). Two control peptides were
also synthesized. One control peptide had the same sequence except pY612 was replaced with F. SHPTP2 is likely to bind
c
through its SH2 domain. Since SH2 domain binds to pY only but
not to Y residues, we used a second control peptide derived from
c 450-465 which contained two nonphosphorylated Y residues:
biotin-YGYRLRRKWEEKIPNP. All peptides had a COOH-terminal amide. The peptides were purified by HPLC to >95%
purity and evaluated by mass spectrometry for correct molecular
weight. The lyophilized peptides were reconstituted in distilled
water and then diluted in 100 mM Hepes, pH 7.4. For peptide
binding assay we used lysates from promyelocytic human cell line
HL-60, which expresses SHPTP2 (CCL 240; American Type Culture Collection, Rockville, MD). These nondifferentiated
leukemic cells were maintained in RPMI 1640 with 10% FCS.
SHPTP2 immunoprecipitated from HL-60 has no detectable
phosphotyrosine and its basal phosphatase activity is comparable
to that obtained from nonstimulated eosinophils. HL-60 cell lysates were prepared as described above and precleared with avidin-conjugated agarose beads (Sigma Chemical Co., St. Louis,
MO) for 1 h. Aliquots of cell lysates (equivalent to 107 cells) were
then incubated with biotinylated peptides (50 µM) for 2-4 h, and
subsequently with avidin-conjugated agarose beads (50 µl) for 2 h
at 4°C. After the last incubation, the beads were washed five
times with the lysis buffer. The beads were suspended in 50 µl of
2 times concentrated electrophoresis buffer, boiled for 4 min, and
subjected to electrophoresis and Western blotting with anti-SHPTP2 Ab.
Gel Electrophoresis and Immunoblotting. SDS-polyacrylamide gels were prepared according to the Laemmli protocol and used for immunoblotting. The concentration of polyacrylamide was either 7 or 12%, depending on the molecular weight range of the proteins studied. Gels were blotted onto Hybond membranes for Western blotting using the enhanced chemiluminescence system (Amersham Corp.). Blots were incubated in blocking buffer containing 5% BSA in TBST buffer (20 mM Tris base, 137 mM NaCl, made to pH 7.6, and 0.05% Tween 20) for 1 h followed by incubation with the primary Ab (0.1 µg/ml) for 1 h. After washing five times in TBST buffer, blots were incubated for 30 min with a horseradish peroxidase conjugated secondary antibody (0.1 µg/ml) directed against the primary Ab. The blots were developed with the enhanced chemiluminescence substrate according to manufacturer's protocol. In some experiments, blots were reprobed with another Ab after stripping in a buffer of 62.5 mM Tris-HCl (pH 6.7), 100 mM 2-mercaptoheptanol, and 2% SDS at 50°C for 30 min.
Antisense Oligodeoxynucleotides. Three 20-mer oligodeoxynucleotides (ODNs) were synthesized by Operon Technologies (Alameda, CA) based on sequence information provided by H.E. Broxmeyer (Indiana University Medical Center, Indianapolis, IN). Sequences used were as follows: an antisense (CTCCGCGATGTCATGTTCCT) of SHPTP2 199-219 nucleotides, a sense (GAGGAACATGACATCGCGGA) for the same region, and a nonsense (TGGGTGTGTCCAAGAGAACT). The ODNs were phosphorothioate modified and resuspended in a sterile H2O at 100 µM concentration.
Eosinophil Survival Assay.
Purified eosinophils were suspended
at 106/ml in RPMI 1640 without FCS and cultured in duplicate
in the presence of ODNs at concentration of 7.5 µM. After 6 h,
eosinophils were counted and cultured with IL-5 (10
10 M) for
2 h. At this time, duplicates were lysed and subjected to immunoblotting for SHPTP2 expression. After treatment with IL-5, cells
were washed and resuspended in RPMI 1640 without IL-5, FCS,
and ODNs and cultured for another 24 h. The viability of the cultured eosinophils was assessed immediately before and 24 h after
IL-5 stimulation. The relative amounts of dead cells were determined by uptake of 5 µM propidium iodide which was analyzed under a fluorescence microscope. In some experiments, cells
were lysed after stimulation with IL-5 for 10 min and subjected
to immunoprecipitation with an anti-Erk-2 antibody followed by
Western blotting with antiphosphotyrosine antibody.
It has been reported that the tyrosine phosphorylation of SHPTP2 is associated with its increased phosphatase activity (19). Therefore, we first tested
whether IL-5 induced tyrosine phosphorylation of SHPTP2.
In this analysis, eosinophils were stimulated with IL-5 for
various time periods and then lysed and immunoprecipitated with a polyclonal anti-SHPTP2 antibody. Western
blotting with an antiphosphotyrosine antibody revealed phosphorylation of SHPTP2 as early as 1 min, reaching the highest level 5 min after the stimulation (Fig. 1). This suggests a
relatively early involvement of SHPTP2 in the IL-5 signaling pathway. Reprobing the membrane with the anti-SHPTP2 antibody confirmed the presence of equal amounts
of the immunoprecipitated protein.
Next, we assessed whether IL-5 stimulated the enzymatic activity of SHPTP2. SHPTP2 was immunoprecipitated from control or IL-5-treated eosinophils, and the
phosphatase activity was measured. The results are shown
in Fig. 2. The kinetics of phosphatase bioactivity was similar to the pattern of tyrosine phosphorylation, reaching the
peak in 5 min. A significant activity was detectable as late as
30 min after stimulation. A two- to threefold increase in
phosphatase activity was consistently observed in three independent experiments.
Physical Association with Grb2.
Once phosphorylated on tyrosine, SHPTP2 conforms to the consensus binding site, pYXNX, for the SH2 domain of Grb2 adapter protein (20). Since the binding of Grb2 to SHPTP2 might explain Ras activation after IL-5 stimulation, we asked whether SHPTP2 could bind Grb2 in stimulated eosinophils. To analyze the interaction between SHPTP2 and Grb2, first we performed immunoprecipitation of Grb2 from IL-5- stimulated and control cells followed by immunoblotting with antiphosphotyrosine and anti-SHPTP2 antibodies.
As shown in Fig. 3 A, we detected a band of a 70-kD tyrosine phosphorylated protein in the immunoprecipitate of
Grb2 from IL-5-stimulated cells. Reprobing the same
membrane with the anti-SHPTP2 antibody confirmed the
presence of SHPTP2 in immunoprecipitate of Grb2 (Fig. 3
A). In a next set of experiments, we looked for the presence of Grb2 in the immunoprecipitates of SHPTP2. As
shown in Fig. 3 B, Grb2 was detectable in the anti-SHPTP2 immunoprecipitates and predictably, in the anti-Grb2 immunoprecipitate from IL-5-stimulated eosinophils.
These experiments suggest a physical association of SHPTP2
and Grb2 that occurs in an IL-5-dependent manner.
) and (+) indicate cells incubated with medium or IL-5 for 5 min, respectively. Immunoblotting with antiphosphotyrosine antibody revealed a
70-kD protein, suggesting the presence of SHPTP2 in the immunoprecipitate of Grb2 (left). Western blotting with anti-SHPTP2 antibody confirmed the identity of the phosphatase. (B) Eosinophils lysates were immunoprecipitated with anti-Grb2 antibody and anti-SHPTP2 antibody.
Western blotting with anti-Grb2 antibody revealed the presence of Grb2
in its own immunoprecipitates as well as in immunoprecipitates of
SHPTP2 from IL-5-stimulated eosinophils.
Physical Association with IL-5
cR.
The next set of coimmunoprecipitation experiments was carried out to investigate the physical association of SHPTP2 with IL-5
cR. For
this purpose, eosinophil lysates were immunoprecipitated
with anti-SHPTP2 antibody and immunoblotted with antireceptor IL-5
c antibody. We found the presence of IL-5
cR
in immunoprecipitate of SHPTP2 obtained from IL-5-stimulated cells (Fig. 4 A). In the next set of experiments we
looked for the presence of SHPTP2 in immunoprecipitates
of IL-5
cR. Western blotting with anti-SHPTP2 antibody
revealed the presence of the phosphatase in immunoprecipitate of IL-5
cR (Fig. 4 B). The association between SHPTP2
and receptor appears to be present only in stimulated eosinophils.
cR in IL-5-
stimulated eosinophils. (A) Eosinophil lysates were immunoprecipitated with a polyclonal anti-SHPTP2 antibody and subjected to Western blot
analysis with anti-SHPTP2 (left) and anti-IL-5
cR (right) antibodies. The
band of IL-5
cR was present in the immunoprecipitate of SHPTP2 obtained from IL-5-stimulated cells. (B) Anti-IL-5
cR was used to immunoprecipitate lysates from eosinophils treated with (+) and without (
)
IL-5 (5 min). The resulting immunoblot was screened with anti-IL-5
cR
antibody showing the presence of equal amounts of the receptor and with
anti-SHPTP2 antibody revealing the presence of phosphatase in immunoprecipitate of IL-5
cR from stimulated eosinophils. Different intensity
of IgH is due to different isotypes of Abs used for immunoprecipitation
reacting with Western blotting secondary Ab.
The binding of SHPTP2 with IL-5
cR only in stimulated cells suggests that the physical association occurs through
the SH2 domains of SHPTP2. The SH2 domain of SHPTP2
is predicted to bind to a consensus sequence of SXXpYXXL (21, 22). The
c subunit of IL-5R has seven tyrosine residues in cytosolic region and one of the tyrosine
residues at position 612 conforms best to the tyrosine binding motif of protein tyrosine phosphatases. We synthesized a tyrosine phosphorylated (pY612) peptide encompassing
the residues 605-624 of IL-5
cR. Two peptides served as
controls. The first control peptide had the same sequence except the replacement of pY612 with F. Since SH2 domain
binds to phosphorylated Y and not to nonphosphorylated
Y residues, we used a second control peptide,
c450-465
that contained two nonphosphorylated Y residues. All peptides were biotinylated. For peptide binding experiments,
we used lysates from HL-60 cells instead of eosinophils.
HL-60 cells constitutively express SHPTP2 and served as a
readily available source of the phosphatase. The peptides
were incubated with HL-60 cell lysates and the precipitated
proteins were blotted with anti-SHPTP2 antibody. As
shown in Fig. 5, only the phosphotyrosine-containing peptide bound SHPTP2. This experiment shows that the
phosphorylated
receptor can directly bind to SHPTP2
phosphatase.
cR (residues 605-624).
The controls were a nonphosphorylated F612 peptide (peptide
2) and a
c 450-465 peptide
(peptide 3). The peptides were
biotinylated and used in a peptide
binding assay using the HL-60
cell lysate. The bound proteins
were precipitated with streptavidin-agarose, followed by immunoblotting
with anti-SHPTP2. The first lane, (L, cell lysate) shows the position of
the 70-kD SHPTP2. The identity of the upper band is unknown. The
buffer control is shown in the last lane (0).
To examine the potential effect of the IL-5
cR binding
to SHPTP2, we asked whether addition of the phosphopeptide,
c 605-624 affected SHPTP2 activity. SHPTP2
activity was assayed in the absence or presence of the phosphopeptide. The mutated peptide was used as the control.
The addition of the phosphopeptide
c 605-624 strongly
stimulated SHPTP2 activity by more than fivefold (Fig. 6)
suggesting that binding of the phosphatase alone is responsible for its activation. The mutated
c 605-624 peptide
did not activate the phosphatase.
Survival of Eosinophils Treated with SHPTP2 Antisense ODNs.
Since eosinophils are terminally differentiated
cells with life spans of ~4 d, the use of antisense oligodeoxynucleotides is the most practical method to specifically alter expression of SHPTP2. Eosinophils were incubated
with ODNs without FCS to protect stability of ODNs. As
demonstrated in Fig. 7, eosinophils exposed to 7.5 µM
antisense ODN for 6 h expressed little or no detectable
SHPTP2, whereas sense or nonsense ODNs did not alter SHPTP2 level. Antisense ODNs used in our assay did not
alter expression of a closely related phosphatase SHPTP1
(data not shown). The viability of eosinophils assessed at
this time (immediately before stimulation with IL-5) always
exceeded 90% and was not different from control samples,
indicating that at concentration of 7.5 µM the ODNs were
not toxic to the cells. After 2 h of stimulation, eosinophils
were resuspended in medium without IL-5, ODNs, and FCS. We excluded FCS from this stage of experiment,
since in a previous study by Inhorn et al., serum appeared
to alleviate the requirement for the Ras pathway for GM-CSF-dependent viability and proliferation in mutant cells
with
receptor lacking the 626-763 amino acid residues
(23). Viability of the cells cultured without serum was always higher than 55% as assessed 24 h after stimulation with
IL-5. In contrast to IL-5-stimulated cells, there was usually
<40% viable control (not treated with IL-5) eosinophils at
the same time. However, as shown in Fig. 8, SHPTP2 antisense oligonucleotides blocked the ability of IL-5 to prevent eosinophil death (35.0 ± 6.8 versus 66.2 ± 8.0 versus
60.2 ± 5.4% for antisense, sense, and nonsense ODN-
treated cells, respectively, P <0.05) indicating critical role
of SHPTP2 phosphatase in IL-5-induced survival of eosinophils.
10 M) for 2 h, and then
washed and incubated without
ODNs and IL-5 for an additional
24 h. No inhibition of eosinophil death by IL-5 was observed in SHPTP2 AS-treated cells. In contrast,
SHPTP2 SS- and NS-treated cells demonstrated a significant prolongation of eosinophil survival by IL-5. None of the ODNs at 7.5 µM concentration was toxic to eosinophils. Shown are the means ± SD of five
independent experiments. *Significantly different from the cells not
treated with IL-5 at P <0.05 (Student's t test).
Next we addressed the question of requirements of
SHPTP2 phosphatase in IL-5-induced phosphorylation of
MAP/Erk2 kinase. As shown in Fig. 9, there was significant reduction in MAP kinase tyrosine phosphorylation in
eosinophils that were treated with the antisense ODNs. Since
MAP kinase is considered a downstream molecule of the
Ras signaling pathway, these results suggest that SHPTP2
plays a positive role in IL-5-induced activation of the Ras-MAP kinase pathway.
Previously, we have demonstrated that IL-5 stimulates
the phosphorylation and activation of the receptor-bound
tyrosine kinases in eosinophils. In this report, we show that
the IL-5 stimulation results in the phosphorylation and activation of the protein tyrosine phosphatase, SHPTP2. Others
have reported the tyrosine phosphorylation of SHPTP2 in
IL-3 and GM-CSF-stimulated murine myeloid cell lines (12).
Our data extend these findings by showing that SHPTP2 binds to the
c chain of the IL-5R in human eosinophils.
In additional studies, we have demonstrated that the tyrosine phosphorylated
c 605-624 peptide encompassing
pY612 binds and activates SHPTP2. There was no binding
of SHPTP2 to the same peptide when phosphotyrosine
(pY612) was replaced with phenylalanine. This is the first
evidence that SHPTP2 directly interacts with the native
fragment of
c chain of IL-5R. Finally, we demonstrate the
requirement of the SHPTP2 for IL-5-induced phosphorylation of MAP/Erk2 kinase and prolongation of eosinophil
survival.
Specific domains within the
c receptor may contain information necessary to initiate distinct events such as proliferation or differentiation through propagation of distinct
signaling pathways. Previous studies using a series of truncated mutants revealed that the cytoplasmic domain of
c
contained two functional regions required for signaling (24).
The membrane proximal region (amino acid residues 456-
517) was shown to be essential for proliferation, activation
of Jak2 and pim-1, and induction of c-myc. A second domain (amino acid residues 627-763) was found to be necessary for activation of Shc, p21 Ras, Raf-1, and MAP kinase
as well as for induction of c-fos and c-jun. It is noteworthy
that site-directed mutagenesis of tyrosine 750 to phenylalanine revealed a viability defect of mutated cells comparable
to deletion of the entire 627-763 domain (23). In a recent
work, Itoh et al. attempted to find the functional region of
the
c responsible for activation of Ras and induction of
c-fos promoter (25). They found that GM-CSF-induced tyrosine phosphorylation of two signaling molecules, Shc and
SHPTP2, functioning in Ras activation. As tyrosine phosphorylation of Shc was abrogated by the single substitution
at Y577 of the full-length
c receptor, Y577 has an essential
role in Shc activation. In contrast to Shc, both
589 truncated and
wild with Y577
F mutation, were capable of
inducing tyrosine phosphorylation of SHPTP2, indicating
that activation of the phosphatase is mediated by multiple
sites, including Y577 as well as by other functional sites located COOH-terminal to amino acid 589.
In our study, we found that
c coprecipitates with
SHPTP2, suggesting that physical association of these molecules occurs in IL-5-stimulated eosinophils. The direct association of SHPTP2 and
c seems reasonable since the
synthetic 20-mer peptide,
c605-624 containing a phosphorylated tyrosine (Y612), was able to bind SHPTP2. However, the exact binding site for SHPTP2 on
c receptor remains to be clarified. There are four tyrosine residues (Y612,
Y750, Y806, and Y869) located COOH-terminal to amino acid
589 on
c receptor surrounded by amino acid residues partially matching a consensus sequence of Y(I/V)Xaa(V/I/L/P)
that favors the binding of the NH2-terminal SH2 domain
of SHPTP2 (21). We speculate that Y612 and/or Y750 are
likely binding sites for SHPTP2, since the sequence surrounding Y612 and Y750 human IL-5
cR conform to the
so-called immunoreceptor tyrosine-based inhibitory motif
(ITIM) sequence motif of (T/S)XX(pY)XXL (22). Synthetic phosphopeptides representing the ITIM sequence have been shown to bind tyrosine phosphatases SHPTP1 and
SHPTP2 and, what is of much interest, this binding results
in dramatic increase in their phosphatase activity (26). Indeed, we have shown that addition of a phosphotyrosine
peptide comprising the region around pY612 stimulates
SHPTP2 activity four- to sixfold, whereas the nonphosphorylated peptide has no stimulatory effect. The phosphorylated
c 612-624 reported here is the first native peptide derived from
c that potently stimulates SHPTP2
phosphatase activity.
The current model of the IL-5/IL-3/GM-CSF signaling
pathway predicts that the stimulation of the receptor by the
ligand causes the activation of the receptor bound tyrosine
kinases. The activated tyrosine kinases then tyrosine phosphorylate
c receptor. Tyrosine kinases bound to box 1 (W458-P465) are likely to be responsible for this event, since
deletion of this motif results in loss of tyrosine phosphorylation of
c (25). Indeed, in mutant cells lacking Jak2 kinase, there was no phosphorylation of
c in response to
GM-CSF. Moreover, these cells failed to phosphorylate
SHPTP2 (27). We believe that one of the phosphorylated
tyrosines on
c creates the binding site for the SH2 domain
of SHPTP2. It is possible that SHPTP2 binds to more than
one phosphorylated tyrosine residue, and which one is critical for SHPTP2 activation remains to be determined. The occupancy of SH2 domains results in an increase in phosphatase activity, presumably due to the induction of conformational changes in SHPTP2 (28). The role of increased
phosphatase activity of SHPTP2, as well as its target molecule remains unclear. One possible target for activated
SHPTP2 phosphatase is
c. Upon
c binding, activated
SHPTP2 might attenuate the
c signal by dephosphorylating the receptor, receptor-associated proteins, or itself. However, the observation that SHPTP2 remains associated with
the phosphorylated IL-5
cR might argue against this model.
We did not observe dephosphorylation of
c, SHPTP2,
Jak2, and Lyn immunoprecipitated from IL-5-stimulated cells at the time of maximal activation of SHPTP2 (data
not shown). An alternative possibility is that SHPTP2 acts
as a positive signal transducer by dephosphorylating inhibitory phosphotyrosine residues. Although we did not observe inhibition of Lyn and Jak2 phosphorylation in eosinophils lacking SHPTP2 phosphatase, we cannot exclude
other tyrosine kinases as a target of the phosphatase. Feng
et al. showed that SHPTP2 becomes constitutively tyrosine
phosphorylated in v-Src-transformed cells (29). The authors
suggested that SHPTP2 might dephosphorylate c-src on
Tyr527, whose phosphorylation blocks tyrosine kinase activity. IL-5 has been shown to activate several tyrosine kinases
including members of Src kinases family Lyn and Fyn and
tyrosine kinase Syk (5, 30, 31). Moreover, SHPTP2 and
c
have been shown to coprecipitate with PI-3 kinase (12).
Whether SHPTP2 is involved in regulation of any of these
kinases in response to IL-5 remains to be determined.
SHPTP2 is phosphorylated on tyrosine residues after IL-5
stimulation. However, the biological significance of this
event as well as its relation to phosphatase activity is not yet
clear. Our data predict that the binding to the receptor
alone stimulates its catalytic activity. This result is consistent with a model in which IL-5 activates tyrosine kinases
and tyrosine kinases phosphorylate several tyrosines within
c. SHPTP2 then binds, via its SH2, to one or two phosphorylated tyrosines, which leads to a conformational change
in SHPTP2 and an increase of phosphatase activity. Once
bound to the receptor, SHPTP2 becomes a target for receptor-associated tyrosine kinases, perhaps Jak2 or Lyn kinases. It has been postulated that tyrosine phosphorylation of SHPTP2 modulates its interaction with other SH2-containing signaling proteins such as Grb2. Grb2 tends to bind to
YXNX motif which is present on SHPTP2 (e.g., Y542 and
Y580). The binding of SHPTP2 to Grb2 is inhibited by
phosphopeptide containing this motif (32). In our study,
SHPTP2 and Grb2 were coimmunoprecipitated by anti-SHPTP2 and anti-Grb2 antibody, respectively. At this time
we do not know whether Grb2 also binds to
c receptor. Grb2 is known to bind to nucleotide-exchange protein
Sos, which activates Ras. Thus, tyrosine phosphorylation of
SHPTP2 may result in recruitment of the Grb2-Sos complex to the membrane, where the substrate for Sos, Ras, is
located (13).
Recently, it has been demonstrated that SHPTP2 functions as a positive growth regulator. Microinjection of
anti-SHPTP2 antibody results in decreased insulin-mediated mitogenesis (16). Mutant inactive forms of SHPTP2
strongly inhibited the mitogenic signals induced by PDGF,
-thrombin (15), and IFN-
and -
(33). Further, negative
mutations of SHPTP2 led to inhibition of prolactin-induced lactogenic signaling (11). Using antisense oligodeoxynucleotides against SHPTP2, we demonstrated a positive role of
the phosphatase in IL-5-induced activation of eosinophils.
Regardless of the target molecule for SHPTP2, this phosphatase appears to act upstream of Ras-Raf-MAP kinase
pathway activated in response to IL-5. Further, an activation of SHPTP2 phosphatase and Ras-Raf-MAP pathway
seems to be required for the delay of the death in eosinophils. In a recent paper, Yousefi et al. showed the requirement of Lyn and Syk tyrosine kinases for the prevention of
apoptosis by IL-5 and GM-CSF in eosinophils (31). Our
identification of SHPTP2 provides a further definition of
intracellular signaling pathways activated by IL-5 by showing the requirement of the tyrosine phosphatase for eosinophil survival.
Address correspondence to Dr. Rafeul Alam, The University of Texas Medical Branch, Department of Internal Medicine, Rt-0672, Galveston, TX 77555-0762. Phone: 409-772-3411; FAX: 409-772-5841; E-mail: ralam{at}impo1.utmb.edu
Received for publication 3 January 1997 and in revised form 16 June 1997.
1 Abbreviations used in this paper:
c,
common; ITIM, immunoreceptor
tyrosine-based inhibitory motif; MAP, microtubule-associated protein;
ODN, oligodeoxynucleotide; PDGF, platelet-derived growth factor;
PTP, protein tyrosine phosphatase; SH, Src homology.
This work was supported by grants from National Institutes of Health (RO1 35713) and John Sealy Memorial Foundation. K. Pazdrak was supported by a McLaughlin Foundation Postdoctoral Fellowship, the President's Grant-In-Aid from the American Academy of Allergy, Asthma & Immunology, and the Texas Allergy and Immunology Society Memorial Foundation. T. Adachi is the recipient of a McLaughlin Postdoctoral Fellowship.
| 1. | Corrigan, C.J., and A.B. Kay. 1992. T cells and eosinophils in the pathogenesis of asthma. Immunol. Today. 13: 501-503 [Medline]. |
| 2. | Owen, W.F., Jr., and K.F. Austen. 1994. Cytokine regulation of eosinophil-mediated inflammatory reactions by modulation of eosinophil programmed cell death and subsequent priming for augmented function. In Eosinophils in Allergy and Inflammation. G.J. Gleich and A.B. Kay, editors. Marcel Decker, New York. 239-253. |
| 3. |
Tavernier, J.,
R. Devos,
S. Cornelis,
T. Tuypens,
J. Van der
Heyden,
W. Fiers, and
G. Plaetnick.
1991.
A human high affinity interleukin-5 receptor (IL-5) is composed of an IL-5
specific chain and a chain shared with the receptor for
GM-CSF.
Cell.
66:
1175-1180
[Medline].
|
| 4. |
Kanakura, Y.,
B. Druker,
S.A. Connistra,
S.A. Furukawa,
Y. Torinoko, and
J.D. Griffin.
1990.
Signal transduction of the
human granulocyte macrophage colony-stimulating factor
and interleukin 3 receptors involves tyrosine phosphorylation
of a common set of cytoplasmic proteins.
Blood.
76:
706-711
|
| 5. |
Pazdrak, K.,
D. Schreiber,
P. Forsythe,
L. Justement, and
R. Alam.
1995.
The signal transduction mechanism of IL-5 in
eosinophils: the involvement of lyn tyrosine kinase and the
ras-raf1-MEK-MAP kinase pathway.
J. Exp. Med.
181:
1827-1834
|
| 6. | Pazdrak, K., S. Stafford, and R. Alam. 1995. The activation of the Jak-STAT1 signaling pathway in eosinophils by IL-5. J. Immunol. 155: 397-402 [Abstract]. |
| 7. |
Freeman, R.M. Jr.,
J. Plutzky, and
B. G. Neel.
1992.
Identification of a human src homology 2-containing protein-tyrosine-phosphatase: a putative homolog of Drosophila corkscrew.
Proc. Natl. Acad. Sci. USA.
89:
11239-11243
|
| 8. |
Ahmad, S.,
D. Banville,
Z. Zhao,
E.H. Fisher, and
S.-H. Shen.
1993.
A widely expressed human protein-tyrosine phosphatase containing src homology 2 domains.
Proc. Natl. Acad.
Sci. USA.
90:
2197-2201
|
| 9. |
Tauchi, T.,
G.S. Feng,
R. Shen,
M. Hoatlin,
G.C. Bagby Jr.,
D. Kabat,
L. Lu, and
H.E. Broxmeyer.
1995.
Involvement of
SH2-containing phosphotyrosine phosphatase Syp in erythropoietin receptor signal transduction pathways.
J. Biol.
Chem.
270:
5631-5635
|
| 10. |
Lechleider, R.J.,
S. Sugimoto,
A.M. Bennett,
A.S. Kashishian,
J.A. Cooper,
S.E. Shoelson,
C.T. Walsh, and
B.G. Neel.
1993.
Activation of the SH2-containing phosphotyrosine
phosphatase SH-PTP2 by its binding site, phosphotyrosine
1009, on the human platelet-derived growth factor receptor.
J. Biol. Chem.
268:
21478-21481
|
| 11. |
Ali, S.,
Z. Chen,
J.J. Lebrun,
W. Vogel,
A. Kharitonenkov,
P.A. Kelly, and
A. Ulrich.
1996.
PTP1D is a positive regulator of the prolactin signal leading to -casein promoter activation.
EMBO (Eur. Mol. Biol. Organ.) J.
15:
135-142
[Medline].
|
| 12. |
Welham, M.J.,
U. Dechert,
K.B. Leslie,
F. Jirik, and
J.W. Schrader.
1994.
Interleukin (IL)-3 and granulocyte/macrophage colony-stimulating factor, but not IL-4, induce tyrosine phosphorylation, activation, and association of SHPTP2
with Grb2 and phosphatidylinositol 3 -kinase.
J. Biol. Chem.
269:
23764-23768
|
| 13. |
Bennet, A.M.,
T.L. Tang,
S. Sugimoto,
C.T. Walsh, and
B.G. Neel.
1994.
Protein-tyrosine-phosphatase SHPTP2 couples platelet-derived growth factor receptor to Ras.
Proc. Natl.
Acad. Sci. USA.
91:
7335-7339
|
| 14. | Lowenstein, E.J., R.J. Daly, A.G. Batzer, W. Li, B. Margolis, R. Lammers, A. Urlich, and J. Schlesinger. 1992. The SH2- and SH3-containing protein Grb2 links receptor tyrosine kinases to ras signaling. Cell. 70: 431-437 [Medline]. |
| 15. |
Rivard, N.,
F.R. McKenzie,
J.M. Brondello, and
J. Pouyssegur.
1995.
The phosphotyrosine phosphatase PTP1D, but
not PTP1C, is an essential mediator of fibroblast proliferation
induced by tyrosine kinase and G protein-coupled receptors.
J. Biol. Chem.
270:
11017-11022
|
| 16. |
Xiao, S.,
D.W. Rose,
T. Sasaoka,
H. Maegawa,
T.R. Burke Jr.,
P.P. Roller,
S.E. Shoelson, and
J.M. Olefsky.
1994.
Syp
(SHPTP2) is a positive mediator of growth factor-stimulated
mitogenic signal transduction.
J. Biol. Chem.
269:
21244-21248
|
| 17. | Gartner, I.. 1980. Separation of human eosinophils in density gradients of polyvinylpyrrolidone-coated silica gel (Percoll). Immunology. 40: 133-136 [Medline]. |
| 18. |
Klinghoffer, R.A., and
A. Kazlauskas.
1995.
Identification of
a putative Syp substrate, the PDGF receptor.
J. Biol. Chem.
270:
22208-22214
|
| 19. |
Vogel, W.,
R. Lammers,
J. Juang, and
A. Ulrich.
1993.
Activation of phosphotyrosine phosphatase by tyrosine phosphorylation.
Science (Wash. DC).
259:
1611-1614
|
| 20. |
Songyang, Z.,
S.E. Shoelson,
J. McGlade,
P. Olivier,
T. Pawson,
X. Bustelo,
M. Barbacid,
H. Sabe,
H. Hanafusa,
T. Yi, et al
.
1994.
Specific motifs recognized by the SH2 domains of Csk, 3BP2, fps/fes, Grb2, HCP, SHC, Syk, and
Vav.
Mol. Cell. Biol.
14:
2777-2785
|
| 21. | Songyang, Z., S.S. Shoelson, M. Chaudhuri, G. Gish, T. Pawson, W.G. Haser, F. King, T. Roberts, S. Ratnofsky, R.J. Lechleider, et al . 1993. SH2 domains recognize specific phosphopeptide sequences. Cell. 72: 767-778 [Medline]. |
| 22. | Thomas, M.L.. 1995. Of ITAM and ITIMs: turning on and off the B cell antigen receptor. J. Exp. Med. 181: 1963-1966 . |
| 23. |
Inhorn, R.C.,
N. Carlesso,
M. Durstin,
D.A. Frank, and
J.D. Griffin.
1995.
Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor -chain
involving tyrosine-750.
Proc. Natl. Acad. Sci. USA.
92:
8665-8669
|
| 24. |
Sato, N.,
K. Sakamaki,
N. Terada,
K. Arai, and
A. Miyajima.
1993.
Signal transduction by the high-affinity GM-CSF receptor: two distinct cytoplasmic regions of the common subunit responsible for different signaling.
EMBO (Eur. Mol.
Biol. Organ.) J.
11:
4181-4189
.
|
| 25. |
Itoh, T.,
A. Muto,
S. Watanabe,
A. Miyajima,
T. Yokota, and
K. Arai.
1996.
Granulocyte-macrophage colony stimulating factor provokes ras activation and transcription of c-fos
through different modes of signaling.
J. Biol. Chem.
271:
7587-7592
|
| 26. | Pei, D., U. Lorenz, U. Klingmuller, B.G. Neel, and C.T. Walsh. 1994. Intramolecular regulation of protein tyrosine SH-PTP1: a new function for Src homology domains. Biochemistry. 33: 15483-15488 [Medline]. |
| 27. |
Watanabe, S.,
T. Itoh, and
K. Arai.
1996.
Jak2 is essential for
activation of c-fos and c-myc promoters and cell proliferation
through the human granulocyte-macrophage colony-stimulating factor receptor in BA/F3 cells.
J. Biol. Chem.
271:
12681-12686
|
| 28. |
Sugimoto, S.,
T.J. Wandless,
S.E. Shoelson,
B.G. Neel, and
C.T. Walsh.
1994.
Activation of the SH2-containing protein
tyrosine phosphatase, SHPTP2, by phosphotyrosine-containing peptides derived from insulin receptor substrate-1.
J. Biol.
Chem.
269:
13614-13622
|
| 29. |
Feng, G.S.,
C.C. Hui, and
T. Pawson.
1993.
SH2-containing
phosphotyrosine phosphatase as a target of protein-tyrosine
kinases.
Science (Wash. DC).
259:
1607-1611
|
| 30. |
Appleby, M.W.,
J.D. Kerner,
S. Chien,
C.R. Maliszewski,
S. Bondadaa, and
R.M. Perlmutter.
1995.
Involvement of
p59fynT in interleukin-5 receptor signaling.
J. Exp. Med.
182:
811-820
|
| 31. |
Yousefi, S.,
D.C. Hoessli,
K. Blaser,
G.B. Mills, and
H.U. Simon.
1996.
Requirement of Lyn and Syk tyrosine kinases for
the prevention of apoptosis by cytokines in human eosinophils.
J. Exp. Med.
183:
1407-1414
|
| 32. |
Li, W.,
R. Nishimura,
A. Kashishian,
A.G. Batzer,
W.J.H. Kim,
J.A. Cooper, and
J. Schlessinger.
1994.
A new function
for a phosphotyrosine phosphatase: linking grb2-Sos to a receptor tyrosine kinase.
Mol. Cell. Biol.
14:
509-517
|
| 33. |
David, M.,
G. Zhou,
R. Pine,
J.E. Dixon, and
A.C. Larner.
1996.
The SH2 domain-containing tyrosine phosphatase
PTP1D is required for interferon / -induced gene expression.
J. Biol. Chem.
271:
15862-15865
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|