© The Rockefeller University Press, 0022-1007/1997/12/1809/ $5.00
The Journal of Experimental Medicine, Volume 186, Number 11, December 1, 1997 1809-1818
A Common Inhibitory Receptor for Major Histocompatibility Complex Class I Molecules on Human Lymphoid and Myelomonocytic Cells
Marco Colonna*,
Francisco Navarro
,
Teresa Bellón
,
Manuel Llano
,
Pilar García
,
Jacqueline Samaridis*,
Lena Angman*,
Marina Cella*, and
Miguel López-Botet
From the * Basel Institute for Immunology, Basel CH-4005, Switzerland; and
Hospital Universitario de la Princesa, 28006 Madrid, Spain
 |
Abstract
|
|---|
Natural killer (NK) cell–mediated lysis is negatively regulated by killer cell inhibitory receptors specific for major histocompatibility complex (MHC) class I molecules. In this study, we characterize a novel inhibitory MHC class I receptor of the immunoglobulin-superfamily, expressed not only by subsets of NK and T cells, but also by B cells, monocytes, macrophages, and dendritic cells. This receptor, called Ig-like transcript (ILT)2, binds MHC class I molecules and delivers a negative signal that inhibits killing by NK and T cells, as well as Ca2+ mobilization in B cells and myelomonocytic cells triggered through the B cell antigen receptor and human histocompatibility leukocyte antigens (HLA)–DR, respectively. In addition, myelomonocytic cells express receptors homologous to ILT2, which are characterized by extensive polymorphism and might recognize distinct HLA class I molecules. These results suggest that diverse leukocyte lineages have adopted recognition of self–MHC class I molecules as a common strategy to control cellular activation during an immune response.
Address correspondence to Marco Colonna, Basel Institute for Immunology, 487 Grenzacherstrasse, CH-4005 Basel, Switzerland. Phone: 41-61-605-1393; FAX: 41-61-605-1364; E-mail: colonna{at}bii.ch or Miguel López-Botet, Servicio de Inmunología, Hospital de la Princesa, Diego de León 62, 28006 Madrid, Spain. Phone: 34-1-520-2370; FAX: 34-1-309-2496; E-mail: mlbotet/princesa{at}hup.es
Natural killer (NK) cells lyse transformed or virally infected cells that have lost or downregulated expression of self–MHC class I molecules (1). This recognition of "missing self" is mediated by inhibitory receptors that deliver a negative signal upon specific interaction with class I ligands (2–5). In humans, p58, p70, and p70/p140 killer cell inhibitory receptors (KIRs)1 belong to the Ig-superfamily (SF), and recognize distinct polymorphic determinants of HLA-C, -B, and -A molecules, respectively (6). The CD94/NKG2A heterodimer belongs to the C-type lectin SF and recognizes cells expressing a broad range of HLA-A, -B, and -C molecules (7–9) as well as the nonclassical class I molecule HLA-G (10–12). However, KIRs and CD94/NKG2A do not entirely explain the class I specificities of several NK cell clones, suggesting the presence of yet unknown inhibitory MHC class I receptors (6, 10, 11).
Recently, we have identified new members of the Ig-SF, called Ig-like transcript (ILT)1, ILT2, and ILT3 (13, 14). Their homology to KIRs and their location on human chromosome 19 in close linkage with KIRs has suggested that some of these molecules may be inhibitory class I receptors. ILT1 is expressed on NK cells, but lacks cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs) that may mediate negative signaling (15). ILT3 is not expressed on NK cells and does not bind to MHC class I molecules (14). ILT2 remains a potential candidate, since it is characterized by a cytoplasmic tail containing ITIMs and is expressed by NK cells (13).
In an attempt to identify novel NK inhibitory class I receptors distinct from KIRs, we have now obtained an mAb, termed HP-F1, which is specific for ILT2. Using this mAb, we show that ILT2 is expressed not only by NK and T cells, but also by B and myelomonocytic cells. ILT2 binds class I molecules and delivers a negative signal that inhibits killing by NK and T cells and Ca2+ mobilization in B and myelomonocytic cells triggered via the B cell receptor and HLA-DR. We also find that myelomonocytic cells express ILT2 homologs, which are significantly diverse and might recognize distinct HLA class I molecules. Thus, diverse leukocyte lineages express inhibitory class I receptors, which may modulate thresholds of cellular activation.
 |
Materials and Methods
|
|---|
Cells.
C1R and 721.221 are MHC class I–deficient EBV-transformed human B cell lines (16, 17). HLA-B*2702-, -B*2705-, -B*5101-, -A*0301-, -B*0702-, -Cw*0301- and -G1-721.221 are HLA–class I transfectants in 721.221. All of these cells were grown in RPMI/10% FCS. NKL is an NK cell line (18), which was grown as previously described (10). NK cell clones and T cell clones were derived from PBMCs and cultured as previously described (19). Monocytes were prepared from PBMCs by adhesion to plastic (14). Dendritic cells (DCs) were derived either from CD34+ hematopoietic precursors cultured in GM-CSF and TNF-
for 10 d (20) or from purified monocytes (21–23). Macrophages were obtained by culturing monocytes for 10 d in 6-well plates at a concentration of 106 cells/ml in RPMI with 20% human serum and supplemented with 1ng/ml M-CSF.
Monoclonal Antibody and Cytotoxicity Assays.
The mAb HP-F1 was raised by immunizing BALB/c mice against the NKL cell line. Hybridoma supernatants were screened for the capacity of reconstituting NKL-mediated lysis against HLA-B*5101 and HLA-G1 transfectants in 721.221. Cytotoxicity assays, reverse antibody-dependent cell-mediated cytotoxicity (rADCC), and control mAbs [HP-1F7 (anti–MHC class I, IgG1), C218 (anti-CD56, IgG1) and HP-3B1 (anti-CD94, IgG2a)] have been previously described (9, 10).
Antibodies and FACS® Staining.
PBMCs were stained with the HP-F1 mAb followed by either FITC- or PE-conjugated goat anti–mouse IgG1 and counter-stained with anti-CD56–PE, anti-CD3–PE, anti-TCR-
/β–FITC, anti-TCR-
/
–FITC, anti-CD19–PE, and anti-CD14–PE (Becton Dickinson and Co., Mountain View, CA). DCs derived from CD34+ hematopoietic precursors were double-stained with anti–HLA-DR (L243, IgG2a, American Type Culture Collection, Rockville, MD) and HP-F1 mAbs. DCs derived from purified monocytes were double-stained with anti-CD1a (IgG2b, PharMingen, San Diego, CA) and HP-F1 mAbs. Stained cells were analyzed by flow cytometry on a FACStar® Plus (Becton Dickinson) using the LYSYS II software.
Transfections and Immunoprecipitations.
ILT2 cDNA subcloned into pCDNA3 (Invitrogen Corp., Carlsbad, CA) was transiently transfected into COS7 cells by DEAE-Dextran, as previously described (9). Immunoprecipitations from NKL and transfected COS cells were as previously described (9). In brief, cells were 125I-labeled and lysed, and then lysates were subjected to immunoprecipitation with the HP-F1 mAb or with culture supernatant of X63 murine myeloma. Immunoprecipitates were analyzed by standard SDS-PAGE. N-linked glycans were removed from immunoprecipitates using N-glycosidase F (Boehringer Mannheim, Mannheim, Germany).
Production of ILT2 Soluble Protein.
To obtain a soluble form of ILT2, we produced a fusion protein of the ILT2 extracellular domain and human IgG1 constant regions, using the myeloma-based expression system (24, 25). The nucleotide sequence encoding ILT2 extracellular region was amplified from cloned plasmid DNA by PCR using the oligonucleotides GGGATCGGTACCGACGCCATGACCCCCATCCTCACGGTC and GGGATCAAGCTTATACTTACCGTGCCTTCCCAGACCACT as sense and antisense primers, respectively. The sense primer contained the native ILT2 start codon. The antisense primer contained a HindIII restriction site (underlined), a splice donor sequence, and six ILT2 codons preceding the transmembrane domain. The
1,400-bp amplified product was gel purified and ligated into the expression vector pCD4-Hg1 (24). The vector contains the exons encoding hinge, CH2, and CH3 regions of the human IgG1 gene and the guanosine phosphotransferase gene, which confers resistance to mycophenolic acid. The ILT2-IgG1 plasmid was transfected into J558L mouse myeloma cells by electroporation and cells were cultured in DMEM supplemented with 10% FCS, 2 mM L-glutamine, 1% nonessential amino acids, 1% sodium pyruvate, 50 µg/ml kanamycin. After 2 d of culture, selective medium containing 4 µg/ml mycophenolic acid (Calbiochem-Novabiochem, La Jolla, CA) and 125 µg/ml xanthine (Sigma Chemical Co., St. Louis, MO) were added and incubation at 37°C was continued until resistant colonies appeared. Clones were screened for production of soluble IgG fusion proteins by a two-site sandwich ELISA. HP-F1 mAb was employed as capture antibody, while horseradish peroxidase–conjugated goat anti–human IgG antibody was used as detection antibody. Producer clones were expanded, diminishing the FCS content to 2%. For purification of the fusion protein, culture supernatant was concentrated and adsorbed over a recombinant protein A column (Repligen, Cambridge, MA). After washing with PBS with 0.02% sodium azide, bound fusion protein was eluted with 0.1 M glycine-HCl, pH 2.65. 1 ml fractions were collected in test tubes containing 100 µl 2 M Tris-HCl, pH 8, pooled, and dialyzed against PBS. Purified protein was then concentrated, sterile filtered, and kept frozen.
Serotonin Release.
Rat basophilic leukemia (RBL) cells were transfected with ILT2 cDNA subcloned into pCDNA3 (Invitrogen Corp.) by electroporation, and stable transfectants were selected in G418-containing medium. ILT2-transfected and untransfected RBL cells (106/ml) were pulsed for 3 h at 37°C in MEM/Earle's salts/10% FCS containing 2 µCi/ml [3H]serotonin (Dupont-NEN, Boston, MA). Cells were washed, incubated at 37°C for 1 h, washed again, resuspended at 5 x 106/ml, and plated in 50 µl aliquots in 96-well flat-bottomed plates precoated with 20 µg/ml of anti-TNP mouse IgE (Sigma Chemical Co.) alone or in combination with 20 µg/ml of HP-F1 [whole antibody or F(ab')2 fragments] or 20 µg/ml of HP-1F7 [whole antibody or F(ab')2 fragments], as controls. After 1 h at 37°C the reaction was stopped with 150 µl of cold medium, and then 100 µl of supernatants was collected from each well and radioactivity was measured. Serotonin release was calculated according to the formula: % serotonin release = ([cpm sample] – [cpm spontaneous release]) / ([cpm total] – [cpm spontaneous release]).
Immunoblottings.
Cells (3–4 x 107) were incubated for 10 min at 37°C in 1 ml of RPMI alone or with 0.03% H2O2/100 µM sodium orthovanadate (pervanadate), which inhibits phosphatase activity and thus increases protein tyrosine phosphorylation. Cells were then lysed at 4°C in lysis buffer (100 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM sodium orthovanadate, 1% Triton X-100, 5 mM EDTA, 1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin). Lysates were precleared for 2 h at 4°C on protein G sepharose beads and incubated overnight at 4°C with HP-F1 mAb followed by protein G sepharose beads for 2 h. Precipitates were washed 3x with lysis buffer, resolved by 8% SDS-PAGE under nonreducing conditions, and transferred to nitrocellulose membranes (Hybond-C super; Amersham Corp., Arlington Heights, IL). After blocking with PBS with 0.1% Tween 20 and 5% nonfat dry milk, the membranes were incubated with anti–SHP-1 polyclonal rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA) followed by horseradish peroxidase–conjugated goat anti–rabbit IgG (Southern Biotechnology Associates, Inc., Birmingham, AL). Immunoblotted proteins were visualized by chemiluminescence using the enhanced chemiluminescence detection reagents (Amersham Corp.). Membranes were stripped of antibodies by incubation for 30 min at 55°C in 100 mM 2-ME, 2% SDS, and 62.5 mM Tris-HCl, pH 6.7, according to the protocol supplied by Amersham Corp. Stripped blots were reprobed after blocking with anti–SHP-2 rabbit antiserum (Santa Cruz Biotechnology) or with anti-SHIP rabbit antiserum (provided by Mark Coggeshall, Ohio State University, Columbus, OH).
Measurement of Cytosolic Calcium in B Cells and Monocytes.
EBV-transformed B cell lines and monocytes were loaded with Indo-1 AM (Sigma Chemical Co.) as previously described (26). B cells were then incubated for 5 min on ice either with anti–MHC class I mAb HP-1F7 or with the HP-F1 mAb (200 µl of culture supernatant). 2.5 ng of mouse anti–human IgG were added and incubation was continued for 15 min on ice. After washing with medium, cells were shifted at 37°C for 15 min followed by addition of 10 µg of F(ab')2 goat anti–mouse IgG as cross-linker. Cells were analyzed on a flow cytofluorimeter (FACS® Vantage; Becton Dickinson) to detect Ca2+ fluxes. Only live (based on forward scatter criteria) and Indo-1–loaded cells (based on 405 nM vs. 525 nM emission spectra) were included in the analysis. Ca2+ mobilization triggered in monocytes by the anti–class II mAb 3.8B1 was determined as previously described (14).
Reverse Transcriptase–PCR and Oligonucleotide Primers.
Oligo-dT–primed cDNAs were prepared from NK cells, T cells, monocytes, macrophages, and DCs as previously described (27). ILT2, ILT4, and ILT5 were amplified from the above cDNAs by PCR, cloned into pCR2.1 (Invitrogen Corp.) and sequenced. Amplification primers were as follows: sense, ATGACCCCCATCCTCACGGTCCTG; antisense, CTGGGCTAGTGGATGGCCAG. PCR and cloning conditions were as previously described (27). ILT5 allelic forms were amplified by reverse transcriptase (RT)– PCR, cloned, and sequenced from a pool of bone marrow cells derived from 51 donors (Clontech, Palo Alto, CA), as well as from DCs derived from a single donor.
 |
Results and Discussion
|
|---|
The HP-F1 mAb Recognizes a Novel Inhibitory MHC Class I Receptor Encoded by ILT2.
KIRs and CD94/NKG2A receptors do not completely explain class I recognition by a number of NK cell clones (6, 10). This is illustrated by a representative NK cell line, called NKL (Fig. 1 a). NKL-mediated lysis of the class I deletion mutant 721.221 is inhibited by transfection of HLA-B*2702, -B*2705 and -B*5101 genes into 721.221, although NKL does not express a p70 KIR specific for these HLA-B molecules. NKL-mediated lysis is also inhibited by HLA-A*0301, -B*0702, -Cw*0301 and -G1 transfected cells. This inhibition is not entirely accounted for by the CD94–NKG2A heterodimer expressed by NKL, since cytolysis of HLA-A*0301, -B*0702, and -G1 transfectants is only partially reconstituted by an anti-CD94 mAb. In an attempt to find additional inhibitory receptor(s) on NKL, we generated anti-NKL mAbs and selected those capable of restoring lysis of class I transfectants. Among them, the HP-F1 mAb reconstituted cytolysis of HLA-B*2702, -B*2705, and -B*5101 transfectants and, in combination with an anti-CD94 mAb, restored lysis of HLA-A*0301, -B*0702, and -G1 transfectants (Fig. 1 a).


View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1 (a) The HP-F1 mAb reconstitutes NK cell–mediated lysis of HLA class I transfectants. Lysis of the class I–negative mutant cell line 721.221 by NKL is inhibited upon transfection of HLA-B*2702, -B*2705, -B*5101, -A*0301, -B*0702, -Cw*0301, and -G1 alleles in 721.221 (white bars), regardless of the presence of a control antibody (C218, anti-CD56, IgG1). F(ab')2 fragments of the HP-F1 mAb (black bars) completely reconstitute lysis of HLA-B*2702, -B*2705, and -B*5101 transfectants. F(ab')2 fragments of the anti-CD94 HP-3B1 mAb (gray bars) reconstitute lysis of the HLA-Cw*0301 transfectant almost completely. A combination of both HP-F1 and HP-3B1 mAbs (hatched bars) is necessary to reconstitute lysis of HLA-A*0301, -B*0702, and -G1 transfectants. The anti–class I HP-1F7 mAb (vertical bars) reconstitutes lysis of all of the class I transfectants. Cytotoxicity was determined in a standard 4 h 51Cr-release assay. NKL expresses the CD94–NKG2A heterodimer but no KIRs, as determined by cell surface staining with Z199 (anti–CD94– NKG2A heterodimer), HP-3E4, GL183, EB6 (anti-p58 KIRs), DX9, 5.133 (anti-p70 and -p70/140 KIRs) mAbs, and by RT-PCR. (b) HP-F1 mAb inhibits CD16-dependent redirected lysis of P815 cells by NKL. 51Cr-labeled P815 cells were preincubated for 15 min with anti-CD16 alone, with HP-F1 (5–10 µg/ml), or with HP-3B1 (anti-CD94, 5 µg/ml). In control samples, cells were incubated with medium, with anti-CD56 mAb (IgG1), or with HP-F1 (5–10 µg/ml). After incubation, NKL cells were added at different effector/target ratios. HP-F1 significantly reduced CD16-mediated lysis of P815 cells, mimicking the ligand of an inhibitory receptor. HP-F1 mAb also reduced the low basal lysis of P815 by NKL in the absence of anti-CD16. Similar results were obtained with the anti-CD94 mAb.
| |
Further demonstration that the HP-F1 mAb recognizes an inhibitory receptor on NKL was obtained by rADCC experiments (Fig. 1 b) (28). The FcR+ P815 murine mastocytoma cell line was efficiently killed by NKL in the presence of an anti-CD16 mAb, which binds the FcR on target cells and the triggering receptor CD16 on effector cells. When the HP-F1 mAb was added in the assay together with the anti-CD16 mAb, lysis was reduced. Thus, under these conditions, HP-F1 appears to mimic the ligand of an inhibitory receptor, resulting in blocking of CD16 stimulation.
In PBMCs, the HP-F1 antigen was detected not only on a fraction of NK cells,
/β and
/
T cells (as previously observed for KIRs) but, strikingly, also on almost all CD19+ B cells and CD14+ monocytes (Fig. 2). In addition, the HP-F1 mAb stained HLA-DRhigh DCs derived from CD34+ hematopoietic precursors, as well as DCs and macrophages derived from purified monocytes under appropriate culture conditions (Fig. 2 and data not shown). In immunoprecipitation experiments from different cell types, the HP-F1 mAb detected a prominent band of
110 kD under both nonreducing (not shown) and reducing conditions, and of
90 kD after N-deglycosylation of the immunoprecipitates (Fig. 3, left). Its cellular distribution along with biochemical analyses indicated that the HP-F1 antigen differs from previously identified KIRs but is similar to a recently cloned candidate inhibitory receptor, termed ILT2 (13). The predicted ILT2 glycoprotein is characterized by an extracellular region of four Ig-SF domains and a cytoplasmic tail containing four tyrosine-based motifs similar to the ITIMs of KIRs that recruit SHP-1 phosphatase upon phosphorylation (29–33). Specific staining (not shown) and immunoprecipitation (Fig. 3, right) of ILT2-transfected COS cells with the HP-F1 mAb demonstrated that the HP-F1 antigen does indeed correspond to the ILT2-encoded glycoprotein.
ILT2 Binds MHC Class I Molecules, Delivers a Negative Signal that Is Sufficient to Inhibit Cellular Activation, and Recruits SHP-1 Phosphatase.
To provide direct evidence that ILT2 is a receptor for HLA–class I molecules, we analyzed binding of a soluble ILT2–IgG1 fusion protein to class I transfectants in 721.221 by flow cytometry. HLA-B*2702, -B*2705, -A*0301, -G1, and -Cw*0301 transfectants and 721.221 cells were incubated with ILT2–IgG1 and stained with anti–human IgG antibody. As shown in Fig. 4, ILT2 bound HLA-A, -B, and -G1 transfectants but not HLA-Cw3 transfectants or 721.221 cells. These data provide formal demonstration that ILT2 is a receptor for HLA–class I molecules, apparently with a broad specificity.

View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4 ILT2 soluble protein binds HLA-A, -B, and -G1 transfectants. HLA-B*2702, -B*2705, -A*0301, -G1, and -Cw*0301 transfectants in 721.221 and untransfected cells were incubated with a soluble ILT2– IgG1 fusion protein, followed by a PE-labeled goat anti–human IgG antibody. Binding was assessed by FACS® analysis. HLA class I expression of the transfectants was determined in the same experiment by FACS® analysis using the w6/32 mAb (IgG2a; American Type Culture Collection). MFI were as follows: 721.221, 121; HLA-B*2702, 2128; -B*2705, 3045; -A*0301, 3854; -G1, 1084; -Cw*0301, 1582. The binding pattern did not correlate with the level of class I expression on the transfectants.
| |
To further demonstrate that ILT2 delivers a negative signal and is sufficient to inhibit cell activation triggered via a stimulatory receptor, ILT2 cDNA was stably transfected in the RBL cell line, which constitutively expresses the FcR for IgE (Fc
RI; reference 34). As shown in Fig. 5, ILT2-transfected RBL cells released serotonin when triggered through the Fc
RI with mouse IgE bound to a plastic surface. Conversely, serotonin secretion was clearly inhibited by cocross-linking of Fc
RI with ILT2 using mouse IgE and the HP-F1 antibody [or its F(ab')2 fragments] coated on plastic. These results indicate that recruitment of ILT2 to a stimulatory receptor by antibody ligation can inhibit cellular activation.

View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 5 Inhibition of IgE-induced serotonin release in ILT2-transfected RBL cells. Transfected and control cells were stimulated with purified mouse IgE (20 µg/ml) alone and in combination with either HP-F1 [20 µg/ml of whole antibody or F(ab')2 fragments] or with the isotype-matched antibody HP-1F7 [20 µg/ml of whole antibody or F(ab')2 fragments] immobilized on plastic. The percentage of serotonin release, as compared to total and spontaneous release, was determined after 1 h at 37°C. The expression of ILT2 on transfected RBL cells was assessed by indirect immunofluorescence with HP-F1 mAb (not shown).
| |
It has been shown that negative signaling through KIRs is mediated by recruitment of SHP phosphatases upon tyrosine phosphorylation of cytoplasmic ITIMs (29–33), whereas it does not involve association of SHIP phosphatase (35). The cytoplasmic tail of ILT2 contains four tyrosine-based motifs similar to those found in KIR, although only one of them fits the V/I-x-Y-x-x-L motif that has been proposed to be required for SHP-1 binding (36). To determine whether ILT2 recruits SHP phosphatases, ILT2 was immunoprecipitated from NKL cells and from the B cell line C1R either unstimulated or stimulated with pervanadate, which has been shown to induce substantial tyrosine phosphorylation of cellular substrates (37). Immunoprecipitates were immunoblotted with anti–SHP-1, anti–SHP-2 and anti-SHIP antibodies. As shown in Fig. 6, ILT2 was associated with SHP-1 after treatment with pervanadate, whereas no association was detected with SHP-2 and SHIP (data not shown).

View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 6 ILT2 is associated with SHP-1. NKL cells and the EBV-transformed B cell line C1R were incubated for 10 min at 37°C either with medium alone or with pervanadate. ILT2 was then immunoprecipitated with the HP-F1 mAb and immunoprecipitates were separated by SDS-PAGE and immunoblotted with anti–SHP-1 antibody. Whole cell lysate is included as a positive control. SHP-1 was recruited to ILT2 after cell stimulation with pervanadate.
| |
ILT2 Inhibits Superantigen-dependent T Cell–mediated Cytotoxicity.
We next tested whether ILT2 mediates functional inhibition in cell types other than NK cells. CD8+ T cells kill MHC class II+ APCs pulsed with bacterial superantigens, which bind the variable region of the TCR-β chain (Vβ) on T cells. We investigated whether this superantigen-dependent cell-mediated cytotoxicity is inhibited by interaction between ILT2 on T cells and class I on APCs. HP-F1+ T cells were sorted and cloned; T cell clones were then selected for expression of Vβ2, which binds the toxic shock syndrome toxin–1 (TSST-1) superantigen, and for lack of KIR expression. T cell–mediated cytotoxicity was tested against either 721.221 cells or an HLA-B*2705 transfectant of 721.221 pulsed with different concentrations of TSST-1. Both target cells expressed equivalent levels of MHC class II molecules. Results from a representative clone are shown in Fig. 7. The OKT8-24 T cell clone efficiently killed TSST-1–coated 721.221, whereas cytolytic activity was significantly reduced against TSST-1–pulsed HLA-B*2705 transfectants. Cytolysis of TSST-1–coated HLA-B*2705 transfectants was partially reconstituted in the presence of F(ab')2 fragments of the HP-F1 mAb. These results indicate that ILT2–class I interaction, like KIR–class I interaction, inhibits superantigen-dependent T cell–mediated cytotoxicity and may explain previous reports of KIR– T cells inhibited by HLA-B27 molecules (38).

View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 7 ILT2-class I interaction inhibits TSST-1–mediated T cell cytotoxicity. HP-F1+ T cell clones were generated from the peripheral blood of a healthy donor and selected for expression of TCR-Vβ2 and for lack of KIR expression. T cell clones were then tested in a 4-h 51Cr-release assay for cytotoxicity against the class I–negative B lymphoblastoid cell line 721.221 cells or 721.221 cells stably transfected with HLA-B*2705, in the presence of serial dilutions of TSST-1 at an effector/target ratio of 20:1. The T cell clone OKT8-24 killed 721.221 in the presence of TSST-1, but did not kill B*2705-transfected cells. F(ab')2 fragments of the HP-F1 mAb partially restored the lysis, while F(ab')2 fragments of the isotype-matched anti-CD56 mAb had no effect.
| |
It is noteworthy that although all of the tested HP-F1+/ p70 KIR– T cell and NK cell clones derived from different donors were inhibited by HLA-B*2705, the inhibitory function of ILT2 was not always confirmed by reconstitution of cytolysis with the HP-F1 mAb. In addition, the HP-F1 mAb did not inhibit many NK cell clones in rADCC (data not shown). It is possible that ILT2 is characterized by structural heterogeneity and that the HP-F1 mAb efficiently recognizes only some ILT2 isoforms. Alternatively, ILT2 expression may be modulated after activation of NK and T cells or by in vitro culture conditions.
ILT2 Inhibits Ca2+ Mobilization Triggered via the B Cell Antigen Receptor and HLA-DR in B And Myelomonocytic Cells.
To explore the regulatory role of ILT2 in B cell activation, we tested whether ILT2 can inhibit Ca2+ mobilization triggered via the B cell antigen receptor. Cocross-linking of ILT2 with surface IgG induced a complete extinction of the increased [Ca2+]i triggered through surface IgG in the EBV-transformed B cell line C1R (Fig. 8, a and b), while only a slight reduction was detected in peripheral B cells (data not shown). Since C1R has a very low level of class I expression, the HP-F1 mAb might be able to compete more effectively with self–class I molecules for binding with ILT2 and to recruit it to the B cell receptor in cross-linking experiments. Similarly, we obtained a moderate downregulation of Ca2+ mobilization triggered through HLA-DR in monocytes, macrophages, and DCs (Fig. 8, c and d, and data not shown). Together, these results demonstrate that ILT2 can modulate signaling in B cells and myelomonocytic cells. However, the physiological functions regulated by class I–ILT2 interactions in these cell types have yet to be defined.


View larger version (94K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 8 Intracellular Ca2+ mobilization induced by anti–human IgG antibodies in the EBV-B cell line C1R (a) is inhibited upon crosslinking with ILT2 (b). Similarly, the increased [Ca2+]i triggered through HLA-DR by the 3.8 B1 mAb in monocytes (c) and dendritic cells (not shown) is downregulated, although to a lesser extent, when ILT2 is coligated with HLA-DR (d). HP-1F7 is an isotype-matched control antibody.
| |
Myelomonocytic Cells Express ILT2 Homologs (ILT4 and ILT5) that Are Significantly Diverse.
To investigate whether HP-F1 recognizes structurally distinct isoforms of ILT2, we amplified, cloned, and sequenced ILT2 cDNA from NK, T, B, and myeloid cells derived from one individual. By this approach we identified one ILT2 variant with six amino acid differences (most likely an allelic form) and two alternatively spliced forms, one of which encoded a molecule with a truncated cytoplasmic tail lacking ITIMs. (ILT2a, ILT2b, and ILT2c are available EMBL/GenBank/ DDBJ under accession numbers AF009005, AF009006, and AF009007, respectively.) These variants were not selectively expressed in different cell types. Importantly, cDNA amplification from myelomonocytic cells yielded two cDNA clones that were more diverse, called ILT4 and ILT5, also encoding glycoproteins characterized by four extracellular Ig-SF domains and ITIM-containing cytoplasmic tails (Fig. 9). These glycoproteins are homologous to ILT2 and map to human chromosome 19, but are not recognized by the HP-F1 mAb and are selectively expressed on myelomonocytic cells as assessed by RT-PCR (data not shown). These results suggest that ILT2 may be the prototype and most broadly expressed member of a family of structurally and functionally similar receptors with different MHC specificities and tissue distribution.

View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 9 Alignment of ILTs with four Ig-SF extracellular domains. The alignment was generated by the Clustal method using Lasergene analysis software. (DNASTAR, Inc., Madison, WI). Amino acid sequences were aligned with ILT2. Amino acid variants are indicated. Gaps (dashes) were introduced to maximize homologies. Amino acids are numbered on the right side. SS, signal sequence; EC, extracellular domain; TM, transmembrane domain; CY, cytoplasmic domain.
| |
Analysis of structural variability of ILT2, ILT4, and ILT5 in the population revealed that ILT5, as compared to ILT2 and ILT4, is characterized by a striking diversity. Amplification and sequencing of ILT5 cDNA from a pool of cells derived from different individuals yielded 15 distinct cDNAs, whereas only 1 ILT5 cDNA clone was amplified from a single donor. This result suggests that ILT5 may be extensively polymorphic, with amino acid variants clustered in several distinct regions of the extracellular domains (Fig. 10). Genomic studies will be required to establish whether all of the cloned ILT5 variants are encoded by different alleles of the same locus, or by different loci. We also identified 6 alternatively spliced forms of ILT4 and ILT5 cDNAs, some of which encode glycoproteins with a short cytoplasmic tail that lacks ITIMs, and one cDNA, termed ILT6, which lacks transmembrane and cytoplasmic regions, and may encode a soluble receptor. (ILT4, ILT5, and ILT6 cDNAs are available from EMBL/ GenBank/DDBJ under the following accession numbers: ILT4-cl1, AF000574; ILT4-cl17, AF011566; ILT4-cl26, AF011565; ILT5-cl16, AF000575; ILT5-cl17.6, AF009634; ILT5-cl17.7, AF009635; ILT5-cl17.8, AF009636; ILT5-cl17.10, AF009632; ILT5-cl17.11, AF009633; ILT5-cl19, AF009637; ILT5-cl22, AF009638; ILT5-cl31, AF009639; ILT5-cl33, AF009640; ILT5-cl36, AF009641; ILT5-cl40, AF009642; ILT5-cl41, AF009644; ILT5-cl6, AF009643; ILT5-cl17.18, AF031554; ILT5-cl17.23, AF031555; ILT5-cl17.30, AF031556; ILT5-clDC.1, AF031553; and ILT6, AF014923.

View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 10 Diversity of the extracellular region of ILT5. 15 variants of ILT5 were identified from a pool of bone marrow cells derived from 51 donors, while only 1 variant (clone DC.1) was detected from a single donor. Amino acid variants are clustered in variable regions (underlined). ILT5-cl41 is prematurely truncated as a consequence of an alternative splicing which generates a stop codon. D1–D4, extracellular domains.
| |
Concluding Remarks.
Our results demonstrate that inhibitory MHC class I receptors are not restricted to NK cells and T cell subsets, but at least one such receptor is found in all cell types involved in immune responses. Although the role of inhibitory receptors for MHC class I molecules in the regulation of NK and T cell cytotoxicity is well established, their function in B and myelomonocytic cells is intriguing. In B cells, ILT2–class I interactions might regulate the B cell triggering threshold, ensuring that B cells are activated only upon encountering the specific antigen. Interestingly, ILT2 is present in almost all peripheral B cells, but is weakly expressed or undetectable in tonsillar B cells (data not shown), suggesting that ILT2 may be expressed by B cells only before antigenic stimulation, whereas it may be downregulated in activated B cells. In myelomonocytic cells, ILT2 may modulate the inflammatory response to microbial challenges, thereby regulating cytokine production and preventing damage of normal tissue. In addition, ILT2 may be involved in the control of cytotoxicity by monocyte-macrophages, enabling them to recognize tumor cells that have lost expression of class I molecules (39–41). Finally, since inhibitory receptors define a threshold that must be overcome by stimulatory signals to trigger cell activation, an alteration of this regulatory mechanism may contribute to the pathophysiology of chronic inflammatory autoimmune disorders.
 |
Acknowledgments
|
|---|
We thank Roberto Biassoni, Daniel Geraghty, Charles T. Lutz, and Peter Parham for the kind gift of HLA– class I transfectants; Mark Coggeshall, Lorenzo and Alessandro Moretta, and Lewis L. Lanier for mAbs; Kerry S. Campbell for helpful discussions; Mark Dessing and Annette Pickert for expert technical advice in FACS® and Ca2+ flux analyses; and Siamak Bahram, Kerry S. Campbell, Susan Gilfillan, Antonio Lanzavecchia, Ton Rolink, and Raul Torres (Basel Institute for Immunology) for reviewing the manuscript.
Submitted: 14 July 1997
Revised: 19 August 1997
The Basel Institute for Immunology was founded and is supported by Hoffmann-La Roche Ltd., Basel, Switzerland. The work at Hospital de la Princesa is supported by grants SAF96/0335 (Plan Nacional I+D) and PL950062 (European Commission). M. Llano is the recipient of a fellowship from the Fundacion Rich.
1 Abbreviations used in this paper: DC, dendritic cell; ILT, Ig-like transcript; ITIM, immunoreceptor tyrosine-based inhibitory motifs; KIR, killer cell inhibitory receptor; RBL, rat basophilic leukemia; rADCC, reverse antibody-dependent cell-mediated cytoxicity; SF, superfamily; TSST, toxic shock syndrome toxin.
 |
References
|
|---|
1 Ljunggren HG & Karre K. In search of the missing self ': MHC molecules and NK cell recognition, Immunol Today, 1990, 11, 237–244.[Medline]
2 Yokoyama WM & Seaman WE. The Ly-49 and NKR-P1 gene families encoding lectin-like receptors on natural killer cells: the NK gene complex, Annu Rev Immunol, 1993, 11, 613–635.[Medline]
3 Lanier LL & Phillips JH. Inhibitory MHC class I receptor on NK cells and T cells, Immunol Today, 1996, 17, 86–91.[Medline]
4 Raulet DH & Held W. Natural killer cell receptors: the offs and ons of NK cell recognition, Cell, 1995, 82, 697–700.[Medline]
5 Moretta A, Bottino C, Vitale M, Pende D, Biassoni R, Mingari MC & Moretta L. Receptors for HLA class–I molecules in human natural killer cells, Annu Rev Immunol, 1996, 14, 619–648.[Medline]
6 Lanier LL. Natural killer cells: from no receptors to too many, Immunity, 1997, 6, 371–378.[Medline]
7 Phillips JH, Chang C, Mattson J, Gumperz JE, Parham P & Lanier LL. CD94 and a novel associated protein (94AP) form a NK cell receptor involved in the recognition of HLA-A, HLA-B, and HLA-C allotypes, Immunity, 1996, 5, 163–172.[Medline]
8 Lazetic S, Chang C, Houchins JP, Lanier LL & Phillips JH. Human natural killer cell receptors involved in MHC class I recognition are disulfide-linked heterodimers of CD94 and NKG2 subunits, J Immunol, 1996, 157, 4741–4745.[Abstract]
9 Carretero M, Cantoni C, Bellón T, Bottino C, Biassoni R, Rodriguez A, Perez-Villar JJ, Moretta L, Moretta A & López-Botet M. The CD94 and NKG2-A C type lectins covalently assemble to form a natural killer cell inhibitory receptor for HLA class I molecules, Eur J Immunol, 1997, 27, 563–567.[Medline]
10 Perez-Villar JJ, Melero I, Navarro F, Carretero M, Bellón T, Llano M, Colonna M, Geraghty DE & López-Botet M. The CD94/NKG2-A inhibitory receptor complex is involved in natural killer cell–mediated recognition of cells expressing HLA-G1, J Immunol, 1997, 158, 5736–5743.[Abstract]
11 López-Botet M, Perez-Villar JJ, Carretero M, Rodriguez A, Melero I, Bellón T, Llano M & Navarro F. Structure and function of the CD94 C-type lectin receptor complex involved in recognition of HLA class I molecules, Immunol Rev, 1997, 155, 165–174.[Medline]
12 Söderström, K., B. Corliss, L.L. Lanier, and J.H. Phillips. CD94/NKG2 is the predominant inhibitory receptor involved in recognition of HLA-G by decidual and peripheral blood NK cells. J. Immunol. 159:1072–1075.
13 Samaridis J & Colonna M. Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: structural evidence for new stimulatory and inhibitory pathways, Eur J Immunol, 1996, 27, 660–665.
14 Cella M, Dohring C, Samaridis J, Dessing M, Brockhaus M, Lanzavecchia A & Colonna M. A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing, J Exp Med, 1997, 185, 1743–1751.[Abstract/Free Full Text]
15 Thomas ML. Of ITAMs and ITIMs: turning on and off the B cell antigen receptor, J Exp Med, 1995, 181, 1953–1956.[Free Full Text]
16 Zemmour J, Little AM, Schendel DJ & Parham P. The HLA-A,B "negative" mutant cell line C1R expresses a novel HLA-B35 allele, which also has a point mutation in the translation initiation codon, J Immunol, 1992, 148, 1941–1948.[Abstract]
17 Shimizu Y, Geraghty DE, Koller BH, Orr HT & DeMars R. Transfer and expression of three cloned human non–HLA-A,B,C class I major histocompatibility complex genes in mutant lymphoblastoid cells, Proc Natl Acad Sci USA, 1988, 85, 227–231.[Abstract/Free Full Text]
18 Robertson MJ, Cochran KJ, Cameron C, Le JM, Tantravahi R & Ritz J. Characterization of a cell line, NKL, derived from an aggressive human natural killer cell leukemia, Exp Hematol, 1996, 24, 406–415.[Medline]
19 Cella M, Longo A, Ferrara GB, Strominger JL & Colonna M. NK3-specific natural killer cells are selectively inhibited by Bw4-positive HLA alleles with isoleucine 80, J Exp Med, 1994, 180, 1235–1242.[Abstract/Free Full Text]
20 Caux C, Dezutter-Dambuyant C, Schmitt D & Banchereau J. GM-CSF and TNF-
cooperate in the generation of dendritic Langherans cells, Nature (Lond), 1992, 360, 258–261.[Medline]
21 Sallusto F & Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony–stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor
, J Exp Med, 1994, 179, 1109–1118.[Abstract/Free Full Text]
22 Bender A, Sapp M, Schuler G, Steinman RM & Bhardwaj N. Improved methods for the generation of dendritic cells from non proliferating progenitors in human blood, J Immunol Methods, 1996, 196, 121–135.[Medline]
23 Romani N, Reider D, Heuer M, Ebner S, Kampgen E, Eibl B, Niederwieser D & Schuler G. Generation of mature dendritic cells from human blood. An improved method with special regard to clinical applicability, J Immunol Methods, 1996, 196, 137–151.[Medline]
24 Traunecker A, Oliveri F & Karjalainen K. Myeloma based expression system for production of large mammalian proteins, Trends Biotechnol, 1991, 9, 109–113.[Medline]
25 Döhring C & Colonna M. Human natural killer cell inhibitory receptors bind to HLA class I molecules, Eur J Immunol, 1996, 26, 365–369.[Medline]
26 Valitutti S, Dessing M & Lanzavecchia A. Role of cAMP in regulating cytotoxic T lymphocyte adhesion and motility, Eur J Immunol, 1993, 23, 790–795.[Medline]
27 Colonna M & Samaridis J. Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells, Science (Wash DC), 1995, 268, 405–408.[Abstract/Free Full Text]
28 Perez-Villar JJ, Melero I, Rodriguez A, Carretero M, Aramburu J, Sivori S, Orengo AM, Moretta A & López-Botet M. Functional ambivalence of the Kp43 (CD94) NK cell–associated surface antigen, J Immunol, 1995, 154, 5779–5788.[Abstract]
29 Burshtyn DN, Scharenberg AM, Wagtmann N, Rajagopalan S, Berrada K, Yi T, Kinet JP & Long EO. Recruitment of tyrosine phosphatase HCP by the killer cell inhibitor receptor, Immunity, 1996, 4, 77–85.[Medline]
30 Olcese L, Lang P, Vely F, Cambiaggi A, Marguet D, Blery M, Hippen KL, Biassoni R, Moretta A, Moretta L, Cambier JC & Vivier E. Human and mouse killer-cell inhibitory receptors recruit PTP1C and PTP1D protein tyrosine phosphatases, J Immunol, 1996, 156, 4531–4534.[Abstract]
31 Campbell KS, Dessing M, López-Botet M, Cella M & Colonna M. Tyrosine phosphorylation of a human killer inhibitory receptor recruits protein tyrosine phosphatase 1C, J Exp Med, 1996, 184, 93–100.[Abstract/Free Full Text]
32 Fry AM, Lanier LL & Weiss A. Phosphotyrosines in the killer cell inhibitory receptor motif of NKB1 are required for negative signaling and for association with protein tyrosine phosphatase 1C, J Exp Med, 1996, 184, 295–300.[Abstract/Free Full Text]
33 Binstadt BA, Brumbaugh KM, Dick CJ, Scharenberg AM, Williams BL, Colonna M, Lanier LL, Kinet J-P, Abraham RT & Leibson PJ. Sequential involvement of Lck and SHP-1 with MHC-recognizing receptors on NK cells inhibits FcR-initiated tyrosine kinase activation, Immunity, 1996, 5, 629–638.[Medline]
34 Daeron M, Latour S, Malbec O, Espinosa E, Pina P, Pasmans S & Fridman WH. The same tyrosine-based inhibition motif, in the intracytoplasmic domain of Fc gamma RIIB, regulates negatively BCR-, TCR-, and FcR-dependent cell activation, Immunity, 1995, 3, 635–646.[Medline]
35 Ono M, Okada H, Bolland S, Yanagi S, Kurosaki T & Ravetch JV. Deletion of SHIP or SHP-1 reveals two distinct pathways for inhibitory signaling, Cell, 1997, 90, 293–301.[Medline]
36 Burshtyn DN, Yang W, Yi T & Long EO. A novel phosphotyrosine motif with a critical amino acid at position -2 for the SH2 domain–mediated activation of the tyrosine phosphatase SHP-1, J Biol Chem, 1997, 272, 13066–13072.[Abstract/Free Full Text]
37 O'Shea JJ, McVicar DW, Bailey TL, Burns C & Smyth MJ. Activation of human peripheral blood T lymphocytes by pharmacological induction of protein-tyrosine phosphorylation, Proc Natl Acad Sci USA, 1992, 89, 10306–10310.[Abstract/Free Full Text]
38 Phillips JH, Gumperz JE, Parham P & Lanier LL. Superantigen-dependent, cell-mediated cytotoxicity inhibited by MHC class I receptors on T lymphocytes, Science (Wash DC), 1995, 268, 403–405.[Abstract/Free Full Text]
39 Philip R & Epstein LB. Tumour necrosis factor as immunomodulator and mediator of monocyte cytotoxicity induced by itself,
-interferon and interleukin-1, Nature (Lond), 1986, 323, 86–89.[Medline]
40 Ortaldo JR, Mason LH, Mathieson BJ, Liang SM, Flick DA & Herberman RB. Mediation of mouse natural cytotoxic activity by tumour necrosis factor, Nature (Lond), 1986, 321, 700–702.[Medline]
41 Feinman R, Henriksen-DeStefano D, Tsujimoto M & Vilcek J. Tumor necrosis factor is an important mediator of tumor cell killing by human monocytes, J Immunol, 1987, 138, 635–640.[Abstract]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
-
Pfistershammer, K., Lawitschka, A., Klauser, C., Leitner, J., Weigl, R., Heemskerk, M. H. M., Pickl, W. F., Majdic, O., Bohmig, G. A., Fischer, G. F., Greinix, H. T., Steinberger, P.
(2009). Allogeneic disparities in immunoglobulin-like transcript 5 induce potent antibody responses in hematopoietic stem cell transplant recipients. Blood
114: 2323-2332
[Abstract]
[Full Text]
-
Hershkovitz, O., Rosental, B., Rosenberg, L. A., Navarro-Sanchez, M. E., Jivov, S., Zilka, A., Gershoni-Yahalom, O., Brient-Litzler, E., Bedouelle, H., Ho, J. W., Campbell, K. S., Rager-Zisman, B., Despres, P., Porgador, A.
(2009). NKp44 Receptor Mediates Interaction of the Envelope Glycoproteins from the West Nile and Dengue Viruses with NK Cells. J. Immunol.
183: 2610-2621
[Abstract]
[Full Text]
-
Li, D., Wang, L., Yu, L., Freundt, E. C., Jin, B., Screaton, G. R., Xu, X.-N.
(2009). Ig-Like Transcript 4 Inhibits Lipid Antigen Presentation through Direct CD1d Interaction. J. Immunol.
182: 1033-1040
[Abstract]
[Full Text]
-
Atwal, J. K., Pinkston-Gosse, J., Syken, J., Stawicki, S., Wu, Y., Shatz, C., Tessier-Lavigne, M.
(2008). PirB is a Functional Receptor for Myelin Inhibitors of Axonal Regeneration. Science
322: 967-970
[Abstract]
[Full Text]
-
Mori, Y., Tsuji, S., Inui, M., Sakamoto, Y., Endo, S., Ito, Y., Fujimura, S., Koga, T., Nakamura, A., Takayanagi, H., Itoi, E., Takai, T.
(2008). Inhibitory Immunoglobulin-Like Receptors LILRB and PIR-B Negatively Regulate Osteoclast Development. J. Immunol.
181: 4742-4751
[Abstract]
[Full Text]
-
Yawata, M., Yawata, N., Draghi, M., Partheniou, F., Little, A.-M., Parham, P.
(2008). MHC class I-specific inhibitory receptors and their ligands structure diverse human NK-cell repertoires toward a balance of missing self-response. Blood
112: 2369-2380
[Abstract]
[Full Text]
-
Moreau, P., Contu, L., Alba, F., Lai, S., Simoes, R., Orru, S., Carcassi, C., Roger, M., Rabreau, M., Carosella, E. D.
(2008). HLA-G Gene Polymorphism in Human Placentas: Possible Association of G*0106 Allele with Preeclampsia and Miscarriage. Biol. Reprod.
79: 459-467
[Abstract]
[Full Text]
-
Morel, E., Bellon, T.
(2008). HLA Class I Molecules Regulate IFN-{gamma} Production Induced in NK Cells by Target Cells, Viral Products, or Immature Dendritic Cells through the Inhibitory Receptor ILT2/CD85j. J. Immunol.
181: 2368-2381
[Abstract]
[Full Text]
-
Hershkovitz, O., Zilka, A., Bar-Ilan, A., Abutbul, S., Davidson, A., Mazzon, M., Kummerer, B. M., Monsoengo, A., Jacobs, M., Porgador, A.
(2008). Dengue Virus Replicon Expressing the Nonstructural Proteins Suffices To Enhance Membrane Expression of HLA Class I and Inhibit Lysis by Human NK Cells. J. Virol.
82: 7666-7676
[Abstract]
[Full Text]
-
Yang, Z., Bjorkman, P. J.
(2008). Structure of UL18, a peptide-binding viral MHC mimic, bound to a host inhibitory receptor. Proc. Natl. Acad. Sci. USA
105: 10095-10100
[Abstract]
[Full Text]
-
Liang, S., Ristich, V., Arase, H., Dausset, J., Carosella, E. D., Horuzsko, A.
(2008). Modulation of dendritic cell differentiation by HLA-G and ILT4 requires the IL-6--STAT3 signaling pathway. Proc. Natl. Acad. Sci. USA
105: 8357-8362
[Abstract]
[Full Text]
-
Carosella, E. D., Favier, B., Rouas-Freiss, N., Moreau, P., LeMaoult, J.
(2008). Beyond the increasing complexity of the immunomodulatory HLA-G molecule. Blood
111: 4862-4870
[Abstract]
[Full Text]
-
Silva, A., Andrews, D. M., Brooks, A. G., Smyth, M. J., Hayakawa, Y.
(2008). Application of CD27 as a marker for distinguishing human NK cell subsets. Int Immunol
20: 625-630
[Abstract]
[Full Text]
-
Young, N. T., Waller, E. C. P., Patel, R., Roghanian, A., Austyn, J. M., Trowsdale, J.
(2008). The inhibitory receptor LILRB1 modulates the differentiation and regulatory potential of human dendritic cells. Blood
111: 3090-3096
[Abstract]
[Full Text]
-
Tedla, N., Lee, C.-W., Borges, L., Geczy, C. L., Arm, J. P.
(2008). Differential expression of leukocyte immunoglobulin-like receptors on cord blood-derived human mast cell progenitors and mature mast cells. J. Leukoc. Biol.
83: 334-343
[Abstract]
[Full Text]
-
Lebbink, R. J., van den Berg, M. C. W., de Ruiter, T., Raynal, N., van Roon, J. A. G., Lenting, P. J., Jin, B., Meyaard, L.
(2008). The Soluble Leukocyte-Associated Ig-Like Receptor (LAIR)-2 Antagonizes the Collagen/LAIR-1 Inhibitory Immune Interaction. J. Immunol.
180: 1662-1669
[Abstract]
[Full Text]
-
Occhino, M., Ghiotto, F., Soro, S., Mortarino, M., Bosi, S., Maffei, M., Bruno, S., Nardini, M., Figini, M., Tramontano, A., Ciccone, E.
(2008). Dissecting the Structural Determinants of the Interaction between the Human Cytomegalovirus UL18 Protein and the CD85j Immune Receptor. J. Immunol.
180: 957-968
[Abstract]
[Full Text]
-
Maffei, M., Ghiotto, F., Occhino, M., Bono, M., De Santanna, A., Battini, L., Gusella, G. L., Fais, F., Bruno, S., Ciccone, E.
(2008). Human Cytomegalovirus Regulates Surface Expression of the Viral Protein UL18 by Means of Two Motifs Present in the Cytoplasmic Tail. J. Immunol.
180: 969-979
[Abstract]
[Full Text]
-
Wagner, C. S., Walther-Jallow, L., Buentke, E., Ljunggren, H.-G., Achour, A., Chambers, B. J.
(2008). Human cytomegalovirus-derived protein UL18 alters the phenotype and function of monocyte-derived dendritic cells. J. Leukoc. Biol.
83: 56-63
[Abstract]
[Full Text]
-
Wagner, C. S., Ljunggren, H.-G., Achour, A.
(2008). Immune Modulation by the Human Cytomegalovirus-Encoded Molecule UL18, a Mystery Yet to Be Solved. J. Immunol.
180: 19-24
[Abstract]
[Full Text]
-
Lee, D. J., Sieling, P. A., Ochoa, M. T., Krutzik, S. R., Guo, B., Hernandez, M., Rea, T. H., Cheng, G., Colonna, M., Modlin, R. L.
(2007). LILRA2 Activation Inhibits Dendritic Cell Differentiation and Antigen Presentation to T Cells. J. Immunol.
179: 8128-8136
[Abstract]
[Full Text]
-
Lichterfeld, M., Kavanagh, D. G., Williams, K. L., Moza, B., Mui, S. K., Miura, T., Sivamurthy, R., Allgaier, R., Pereyra, F., Trocha, A., Feeney, M., Gandhi, R. T., Rosenberg, E. S., Altfeld, M., Allen, T. M., Allen, R., Walker, B. D., Sundberg, E. J., Yu, X. G.
(2007). A viral CTL escape mutation leading to immunoglobulin-like transcript 4 mediated functional inhibition of myelomonocytic cells. JEM
204: 2813-2824
[Abstract]
[Full Text]
-
Mizrahi, S., Yefenof, E., Gross, M., Attal, P., Ben Yaakov, A., Goldman-Wohl, D., Maly, B., Stern, N., Katz, G., Gazit, R., Sionov, R. V., Mandelboim, O., Chaushu, S.
(2007). A phenotypic and functional characterization of NK cells in adenoids. J. Leukoc. Biol.
82: 1095-1105
[Abstract]
[Full Text]
-
Banerjee, P., Feuer, G., Barker, E.
(2007). Human T-Cell Leukemia Virus Type 1 (HTLV-1) p12I Down-Modulates ICAM-1 and -2 and Reduces Adherence of Natural Killer Cells, Thereby Protecting HTLV-1-Infected Primary CD4+ T Cells from Autologous Natural Killer Cell-Mediated Cytotoxicity despite the Reduction of Major Histocompatibility Complex Class I Molecules on Infected Cells. J. Virol.
81: 9707-9717
[Abstract]
[Full Text]
-
Gruda, R., Achdout, H., Stern-Ginossar, N., Gazit, R., Betser-Cohen, G., Manaster, I., Katz, G., Gonen-Gross, T., Tirosh, B., Mandelboim, O.
(2007). Intracellular Cysteine Residues in the Tail of MHC Class I Proteins Are Crucial for Extracellular Recognition by Leukocyte Ig-Like Receptor 1. J. Immunol.
179: 3655-3661
[Abstract]
[Full Text]
-
Ward, J., Bonaparte, M., Sacks, J., Guterman, J., Fogli, M., Mavilio, D., Barker, E.
(2007). HIV modulates the expression of ligands important in triggering natural killer cell cytotoxic responses on infected primary T-cell blasts. Blood
110: 1207-1214
[Abstract]
[Full Text]
-
Huynh, O. A., Hampartzoumian, T., Arm, J. P., Hunt, J., Borges, L., Ahern, M., Smith, M., Geczy, C. L., McNeil, H. P., Tedla, N.
(2007). Down-regulation of leucocyte immunoglobulin-like receptor expression in the synovium of rheumatoid arthritis patients after treatment with disease-modifying anti-rheumatic drugs. Rheumatology (Oxford)
46: 742-751
[Abstract]
[Full Text]
-
Masuda, A., Nakamura, A., Maeda, T., Sakamoto, Y., Takai, T.
(2007). Cis binding between inhibitory receptors and MHC class I can regulate mast cell activation. JEM
204: 907-920
[Abstract]
[Full Text]
-
Prod'homme, V., Griffin, C., Aicheler, R. J., Wang, E. C. Y., McSharry, B. P., Rickards, C. R., Stanton, R. J., Borysiewicz, L. K., Lopez-Botet, M., Wilkinson, G. W. G., Tomasec, P.
(2007). The Human Cytomegalovirus MHC Class I Homolog UL18 Inhibits LIR-1+ but Activates LIR-1- NK Cells. J. Immunol.
178: 4473-4481
[Abstract]
[Full Text]
-
Wagner, C. S., Riise, G. C., Bergstrom, T., Karre, K., Carbone, E., Berg, L.
(2007). Increased Expression of Leukocyte Ig-Like Receptor-1 and Activating Role of UL18 in the Response to Cytomegalovirus Infection. J. Immunol.
178: 3536-3543
[Abstract]
[Full Text]
-
van der Meer, A., Lukassen, H.G.M., van Cranenbroek, B., Weiss, E.H., Braat, D.D.M., van Lierop, M.J., Joosten, I.
(2007). Soluble HLA-G promotes Th1-type cytokine production by cytokine-activated uterine and peripheral natural killer cells. Mol Hum Reprod
13: 123-133
[Abstract]
[Full Text]
-
Ehrchen, J., Steinmuller, L., Barczyk, K., Tenbrock, K., Nacken, W., Eisenacher, M., Nordhues, U., Sorg, C., Sunderkotter, C., Roth, J.
(2007). Glucocorticoids induce differentiation of a specifically activated, anti-inflammatory subtype of human monocytes. Blood
109: 1265-1274
[Abstract]
[Full Text]
-
Trichet, V., Benezech, C., Dousset, C., Gesnel, M.-C., Bonneville, M., Breathnach, R.
(2006). Complex Interplay of Activating and Inhibitory Signals Received by V{gamma}9V{delta}2 T Cells Revealed by Target Cell beta2-Microglobulin Knockdown. J. Immunol.
177: 6129-6136
[Abstract]
[Full Text]
-
Guma, M., Budt, M., Saez, A., Brckalo, T., Hengel, H., Angulo, A., Lopez-Botet, M.
(2006). Expansion of CD94/NKG2C+ NK cells in response to human cytomegalovirus-infected fibroblasts. Blood
107: 3624-3631
[Abstract]
[Full Text]
-
Le Rond, S., Azema, C., Krawice-Radanne, I., Durrbach, A., Guettier, C., Carosella, E. D., Rouas-Freiss, N.
(2006). Evidence to Support the Role of HLA-G5 in Allograft Acceptance through Induction of Immunosuppressive/ Regulatory T Cells.. J. Immunol.
176: 3266-3276
[Abstract]
[Full Text]
-
Hernandez-Caselles, T., Martinez-Esparza, M., Perez-Oliva, A. B., Quintanilla-Cecconi, A. M., Garcia-Alonso, A., Alvarez-Lopez, D. M. R., Garcia-Penarrubia, P.
(2006). A study of CD33 (SIGLEC-3) antigen expression and function on activated human T and NK cells: two isoforms of CD33 are generated by alternative splicing. J. Leukoc. Biol.
79: 46-58
[Abstract]
[Full Text]
-
Lafon, M., Prehaud, C., Megret, F., Lafage, M., Mouillot, G., Roa, M., Moreau, P., Rouas-Freiss, N., Carosella, E. D.
(2005). Modulation of HLA-G Expression in Human Neural Cells after Neurotropic Viral Infections. J. Virol.
79: 15226-15237
[Abstract]
[Full Text]
-
Kirwan, S. E., Burshtyn, D. N.
(2005). Killer Cell Ig-Like Receptor-Dependent Signaling by Ig-Like Transcript 2 (ILT2/CD85j/LILRB1/LIR-1). J. Immunol.
175: 5006-5015
[Abstract]
[Full Text]
-
Carr, W. H., Pando, M. J., Parham, P.
(2005). KIR3DL1 Polymorphisms That Affect NK Cell Inhibition by HLA-Bw4 Ligand. J. Immunol.
175: 5222-5229
[Abstract]
[Full Text]
-
Kuroki, K., Tsuchiya, N., Shiroishi, M., Rasubala, L., Yamashita, Y., Matsuta, K., Fukazawa, T., Kusaoi, M., Murakami, Y., Takiguchi, M., Juji, T., Hashimoto, H., Kohda, D., Maenaka, K., Tokunaga, K.
(2005). Extensive polymorphisms of LILRB1 (ILT2, LIR1) and their association with HLA-DRB1 shared epitope negative rheumatoid arthritis. Hum Mol Genet
14: 2469-2480
[Abstract]
[Full Text]
-
Vely, F., Vivier, E.
(2005). Natural Killer Cell Receptor Signaling Pathway in Mammals. Sci Signal
2005: cm7-cm7
[Abstract]
[Full Text]
-
Merlo, A., Tenca, C., Fais, F., Battini, L., Ciccone, E., Grossi, C. E., Saverino, D.
(2005). Inhibitory Receptors CD85j, LAIR-1, and CD152 Down-Regulate Immunoglobulin and Cytokine Production by Human B Lymphocytes. CVI
12: 705-712
[Abstract]
[Full Text]
-
Tenca, C., Merlo, A., Merck, E., Bates, E. E. M., Saverino, D., Simone, R., Zarcone, D., Trinchieri, G., Grossi, C. E., Ciccone, E.
(2005). CD85j (Leukocyte Ig-Like Receptor-1/Ig-Like Transcript 2) Inhibits Human Osteoclast-Associated Receptor-Mediated Activation of Human Dendritic Cells. J. Immunol.
174: 6757-6763
[Abstract]
[Full Text]
-
Hunt, J. S., Petroff, M. G., McIntire, R. H., Ober, C.
(2005). HLA-G and immune tolerance in pregnancy. FASEB J.
19: 681-693
[Abstract]
[Full Text]
-
Draghi, M., Yawata, N., Gleimer, M., Yawata, M., Valiante, N. M., Parham, P.
(2005). Single-cell analysis of the human NK cell response to missing self and its inhibition by HLA class I. Blood
105: 2028-2035
[Abstract]
[Full Text]
-
Pende, D., Spaggiari, G. M., Marcenaro, S., Martini, S., Rivera, P., Capobianco, A., Falco, M., Lanino, E., Pierri, I., Zambello, R., Bacigalupo, A., Mingari, M. C., Moretta, A., Moretta, L.
(2005). Analysis of the receptor-ligand interactions in the natural killer-mediated lysis of freshly isolated myeloid or lymphoblastic leukemias: evidence for the involvement of the Poliovirus receptor (CD155) and Nectin-2 (CD112). Blood
105: 2066-2073
[Abstract]
[Full Text]
-
Vales-Gomez, M., Shiroishi, M., Maenaka, K., Reyburn, H. T.
(2005). Genetic Variability of the Major Histocompatibility Complex Class I Homologue Encoded by Human Cytomegalovirus Leads to Differential Binding to the Inhibitory Receptor ILT2. J. Virol.
79: 2251-2260
[Abstract]
[Full Text]
-
Anfossi, N., Doisne, J.-M., Peyrat, M.-A., Ugolini, S., Bonnaud, O., Bossy, D., Pitard, V., Merville, P., Moreau, J.-F., Delfraissy, J.-F., Dechanet-Merville, J., Bonneville, M., Venet, A., Vivier, E.
(2004). Coordinated Expression of Ig-Like Inhibitory MHC Class I Receptors and Acquisition of Cytotoxic Function in Human CD8+ T Cells. J. Immunol.
173: 7223-7229
[Abstract]
[Full Text]
-
McIntire, R. H., Morales, P. J., Petroff, M. G., Colonna, M., Hunt, J. S.
(2004). Recombinant HLA-G5 and -G6 drive U937 myelomonocytic cell production of TGF-{beta}1. J. Leukoc. Biol.
76: 1220-1228
[Abstract]
[Full Text]
-
Appel, H., Kuon, W., Kuhne, M., Hulsmeyer, M., Kollnberger, S., Kuhlmann, S., Weiss, E., Zeitz, M., Wucherpfennig, K., Bowness, P., Sieper, J.
(2004). The Solvent-Inaccessible Cys67 Residue of HLA-B27 Contributes to T Cell Recognition of HLA-B27/Peptide Complexes. J. Immunol.
173: 6564-6573
[Abstract]
[Full Text]
-
Aguilar, H., Alvarez-Errico, D., Garcia-Montero, A. C., Orfao, A., Sayos, J., Lopez-Botet, M.
(2004). Molecular Characterization of a Novel Immune Receptor Restricted to the Monocytic Lineage. J. Immunol.
173: 6703-6711
[Abstract]
[Full Text]
-
Guma, M., Angulo, A., Vilches, C., Gomez-Lozano, N., Malats, N., Lopez-Botet, M.
(2004). Imprint of human cytomegalovirus infection on the NK cell receptor repertoire. Blood
104: 3664-3671
[Abstract]
[Full Text]
-
Sloane, D. E., Tedla, N., Awoniyi, M., MacGlashan, D. W. Jr, Borges, L., Austen, K. F., Arm, J. P.
(2004). Leukocyte immunoglobulin-like receptors: novel innate receptors for human basophil activation and inhibition. Blood
104: 2832-2839
[Abstract]
[Full Text]
-
Ikehara, Y., Ikehara, S. K., Paulson, J. C.
(2004). Negative Regulation of T Cell Receptor Signaling by Siglec-7 (p70/AIRM) and Siglec-9. J. Biol. Chem.
279: 43117-43125
[Abstract]
[Full Text]
-
Vitale, M., Carlomagno, S., Falco, M., Pende, D., Romeo, E., Rivera, P., Chiesa, M. D., Mavilio, D., Moretta, A.
(2004). Isolation of a novel KIR2DL3-specific mAb: comparative analysis of the surface distribution and function of KIR2DL2, KIR2DL3 and KIR2DS2. Int Immunol
16: 1459-1466
[Abstract]
[Full Text]
-
Bonaparte, M. I., Barker, E.
(2004). Killing of human immunodeficiency virus-infected primary T-cell blasts by autologous natural killer cells is dependent on the ability of the virus to alter the expression of major histocompatibility complex class I molecules. Blood
104: 2087-2094
[Abstract]
[Full Text]
-
Rubio, G., Ferez, X., Sanchez-Campillo, M., Galvez, J., Marti, S., Verdu, R., Hernandez-Caselles, T., Garcia-Penarrubia, P.
(2004). Cross-linking of MHC class I molecules on human NK cells inhibits NK cell function, segregates MHC I from the NK cell synapse, and induces intracellular phosphotyrosines. J. Leukoc. Biol.
76: 116-124
[Abstract]
[Full Text]
-
Barrow, A. D., Astoul, E., Floto, A., Brooke, G., Relou, I. A. M., Jennings, N. S., Smith, K. G. C., Ouwehand, W., Farndale, R. W., Alexander, D. R., Trowsdale, J.
(2004). Cutting Edge: TREM-Like Transcript-1, a Platelet Immunoreceptor Tyrosine-Based Inhibition Motif Encoding Costimulatory Immunoreceptor that Enhances, Rather than Inhibits, Calcium Signaling via SHP-2. J. Immunol.
172: 5838-5842
[Abstract]
[Full Text]
-
LeMaoult, J., Krawice-Radanne, I., Dausset, J., Carosella, E. D.
(2004). HLA-G1-expressing antigen-presenting cells induce immunosuppressive CD4+ T cells. Proc. Natl. Acad. Sci. USA
101: 7064-7069
[Abstract]
[Full Text]
-
Saverino, D., Ghiotto, F., Merlo, A., Bruno, S., Battini, L., Occhino, M., Maffei, M., Tenca, C., Pileri, S., Baldi, L., Fabbi, M., Bachi, A., De Santanna, A., Grossi, C. E., Ciccone, E.
(2004). Specific Recognition of the Viral Protein UL18 by CD85j/LIR-1/ILT2 on CD8+ T Cells Mediates the Non-MHC-Restricted Lysis of Human Cytomegalovirus-Infected Cells. J. Immunol.
172: 5629-5637
[Abstract]
[Full Text]
-
van der Meer, A., Lukassen, H.G.M., van Lierop, M.J.C., Wijnands, F., Mosselman, S., Braat, D.D.M., Joosten, I.
(2004). Membrane-bound HLA-G activates proliferation and interferon-{gamma} production by uterine natural killer cells. Mol Hum Reprod
10: 189-195
[Abstract]
[Full Text]
-
Markel, G., Mussaffi, H., Ling, K.-L., Salio, M., Gadola, S., Steuer, G., Blau, H., Achdout, H., de Miguel, M., Gonen-Gross, T., Hanna, J., Arnon, T. I., Qimron, U., Volovitz, I., Eisenbach, L., Blumberg, R. S., Porgador, A., Cerundolo, V., Mandelboim, O.
(2004). The mechanisms controlling NK cell autoreactivity in TAP2-deficient patients. Blood
103: 1770-1778
[Abstract]
[Full Text]
-
Toyama-Sorimachi, N., Tsujimura, Y., Maruya, M., Onoda, A., Kubota, T., Koyasu, S., Inaba, K., Karasuyama, H.
(2004). Ly49Q, a member of the Ly49 family that is selectively expressed on myeloid lineage cells and involved in regulation of cytoskeletal architecture. Proc. Natl. Acad. Sci. USA
101: 1016-1021
[Abstract]
[Full Text]
-
Friese, M. A., Platten, M., Lutz, S. Z., Naumann, U., Aulwurm, S., Bischof, F., Buhring, H.-J., Dichgans, J., Rammensee, H.-G., Steinle, A., Weller, M.
(2003). MICA/NKG2D-Mediated Immunogene Therapy of Experimental Gliomas. Cancer Res.
63: 8996-9006
[Abstract]
[Full Text]
-
Lieto, L. D., Borrego, F., You, C.-h., Coligan, J. E.
(2003). Human CD94 Gene Expression: Dual Promoters Differing in Responsiveness to IL-2 or IL-15. J. Immunol.
171: 5277-5286
[Abstract]
[Full Text]
-
Belkin, D., Torkar, M., Chang, C., Barten, R., Tolaini, M., Haude, A., Allen, R., Wilson, M. J., Kioussis, D., Trowsdale, J.
(2003). Killer Cell Ig-Like Receptor and Leukocyte Ig-Like Receptor Transgenic Mice Exhibit Tissue- and Cell-Specific Transgene Expression. J. Immunol.
171: 3056-3063
[Abstract]
[Full Text]
-
Zambello, R., Falco, M., Chiesa, M. D., Trentin, L., Carollo, D., Castriconi, R., Cannas, G., Carlomagno, S., Cabrelle, A., Lamy, T., Agostini, C., Moretta, A., Semenzato, G., Vitale, M.
(2003). Expression and function of KIR and natural cytotoxicity receptors in NK-type lymphoproliferative diseases of granular lymphocytes. Blood
102: 1797-1805
[Abstract]
[Full Text]
-
Gonen-Gross, T., Achdout, H., Gazit, R., Hanna, J., Mizrahi, S.'a., Markel, G., Goldman-Wohl, D., Yagel, S., Horejsi, V., Levy, O., Baniyash, M., Mandelboim, O.
(2003). Complexes of HLA-G Protein on the Cell Surface Are Important for Leukocyte Ig-Like Receptor-1 Function. J. Immunol.
171: 1343-1351
[Abstract]
[Full Text]
-
Ishitani, A., Sageshima, N., Lee, N., Dorofeeva, N., Hatake, K., Marquardt, H., Geraghty, D. E.
(2003). Protein Expression and Peptide Binding Suggest Unique and Interacting Functional Roles for HLA-E, F, and G in Maternal-Placental Immune Recognition. J. Immunol.
171: 1376-1384
[Abstract]
[Full Text]
-
Shiroishi, M., Tsumoto, K., Amano, K., Shirakihara, Y., Colonna, M., Braud, V. M., Allan, D. S. J., Makadzange, A., Rowland-Jones, S., Willcox, B., Jones, E. Y., van der Merwe, P. A., Kumagai, I., Maenaka, K.
(2003). Human inhibitory receptors Ig-like transcript 2 (ILT2) and ILT4 compete with CD8 for MHC class I binding and bind preferentially to HLA-G. Proc. Natl. Acad. Sci. USA
100: 8856-8861
[Abstract]
[Full Text]
-
Achdout, H., Arnon, T. I., Markel, G., Gonen-Gross, T., Katz, G., Lieberman, N., Gazit, R., Joseph, A., Kedar, E., Mandelboim, O.
(2003). Enhanced Recognition of Human NK Receptors After Influenza Virus Infection. J. Immunol.
171: 915-923
[Abstract]
[Full Text]
-
Stewart, C. A., van Bergen, J., Trowsdale, J.
(2003). Different and Divergent Regulation of the KIR2DL4 and KIR3DL1 Promoters. J. Immunol.
170: 6073-6081
[Abstract]
[Full Text]
-
Urdahl, K. B., Liggitt, D., Bevan, M. J.
(2003). CD8+ T Cells Accumulate in the Lungs of Mycobacterium tuberculosis-Infected Kb-/-Db-/- Mice, But Provide Minimal Protection. J. Immunol.
170: 1987-1994
[Abstract]
[Full Text]
-
Borges, L., Kubin, M., Kuhlman, T.
(2003). LIR9, an immunoglobulin-superfamily-activating receptor, is expressed as a transmembrane and as a secreted molecule. Blood
101: 1484-1486
[Abstract]
[Full Text]
-
Moreau, P., Mouillot, G., Rousseau, P., Marcou, C., Dausset, J., Carosella, E. D.
(2003). HLA-G gene repression is reversed by demethylation. Proc. Natl. Acad. Sci. USA
100: 1191-1196
[Abstract]
[Full Text]
-
Ibrahim, E. C., Allory, Y., Commo, F., Gattegno, B., Callard, P., Paul, P.
(2003). Altered Pattern of Major Histocompatibility Complex Expression in Renal Carcinoma: Tumor-Specific Expression of the Nonclassical Human Leukocyte Antigen-G Molecule Is Restricted to Clear Cell Carcinoma While Up-Regulation of Other Major Histocompatibility Complex Antigens Is Primarily Distributed in All Subtypes of Renal Carcinoma. Am. J. Pathol.
162: 501-508
[Abstract]
[Full Text]
-
Radaev, S., Kattah, M., Zou, Z., Colonna, M., Sun, P. D.
(2002). Making Sense of the Diverse Ligand Recognition by NKG2D. J. Immunol.
169: 6279-6285
[Abstract]
[Full Text]
-
Feldhahn, N., Schwering, I., Lee, S., Wartenberg, M., Klein, F., Wang, H., Zhou, G., Wang, S. M., Rowley, J. D., Hescheler, J., Kronke, M., Rajewsky, K., Kuppers, R., Muschen, M.
(2002). Silencing of B Cell Receptor Signals in Human Naive B Cells. JEM
196: 1291-1305
[Abstract]
[Full Text]
-
Chwae, Y.-J., Chang, M. J., Park, S. M., Yoon, H., Park, H.-J., Kim, S. J., Kim, J.
(2002). Molecular Mechanism of the Activation-Induced Cell Death Inhibition Mediated by a p70 Inhibitory Killer Cell Ig-Like Receptor in Jurkat T Cells. J. Immunol.
169: 3726-3735
[Abstract]
[Full Text]
-
Guerra, N., Michel, F., Gati, A., Gaudin, C., Mishal, Z., Escudier, B., Acuto, O., Chouaib, S., Caignard, A.
(2002). Engagement of the inhibitory receptor CD158a interrupts TCR signaling, preventing dynamic membrane reorganization in CTL/tumor cell interaction. Blood
100: 2874-2881
[Abstract]
[Full Text]
-
Farag, S. S., Fehniger, T. A., Ruggeri, L., Velardi, A., Caligiuri, M. A.
(2002). Natural killer cell receptors: new biology and insights into the graft-versus-leukemia effect. Blood
100: 1935-1947
[Abstract]
[Full Text]
-
Nikolova, M., Musette, P., Bagot, M., Boumsell, L., Bensussan, A.
(2002). Engagement of ILT2/CD85j in Sezary syndrome cells inhibits their CD3/TCR signaling. Blood
100: 1019-1025
[Abstract]
[Full Text]
-
Dulphy, N., Rabian, C., Douay, C., Flinois, O., Laoussadi, S., Kuipers, J., Tamouza, R., Charron, D., Toubert, A.
(2002). Functional modulation of expanded CD8+ synovial fluid T cells by NK cell receptor expression in HLA-B27-associated reactive arthritis. Int Immunol
14: 471-479
[Abstract]
[Full Text]
-
Miller, I., Hatzivassiliou, G., Cattoretti, G., Mendelsohn, C., Dalla-Favera, R.
(2002). IRTAs: a new family of immunoglobulinlike receptors differentially expressed in B cells. Blood
99: 2662-2669
[Abstract]
[Full Text]
-
Bellon, T., Kitzig, F., Sayos, J., Lopez-Botet, M.
(2002). Mutational Analysis of Immunoreceptor Tyrosine-Based Inhibition Motifs of the Ig-Like Transcript 2 (CD85j) Leukocyte Receptor. J. Immunol.
168: 3351-3359
[Abstract]
[Full Text]
-
Markel, G., Lieberman, N., Katz, G., Arnon, T. I., Lotem, M., Drize, O., Blumberg, R. S., Bar-Haim, E., Mader, R., Eisenbach, L., Mandelboim, O.
(2002). CD66a Interactions Between Human Melanoma and NK Cells: A Novel Class I MHC-Independent Inhibitory Mechanism of Cytotoxicity. J. Immunol.
168: 2803-2810
[Abstract]
[Full Text]
-
Rieger, L., Hofmeister, V., Probe, C., Dietl, J., Weiss, E.H., Steck, T., Kammerer, U.
(2002). Th1- and Th2-like cytokine production by first trimester decidual large granular lymphocytes is influenced by HLA-G and HLA-E. Mol Hum Reprod
8: 255-261
[Abstract]
[Full Text]
-
Tedla, N., Gibson, K., McNeil, H. P., Cosman, D., Borges, L., Arm, J. P.
(2002). The Co-Expression of Activating and Inhibitory Leukocyte Immunoglobulin-Like Receptors in Rheumatoid Synovium. Am. J. Pathol.
160: 425-431
[Abstract]
[Full Text]
-
Urosevic, M., Willers, J., Mueller, B., Kempf, W., Burg, G., Dummer, R.
(2002). HLA-G protein up-regulation in primary cutaneous lymphomas is associated with interleukin-10 expression in large cell T-cell lymphomas and indolent B-cell lymphomas. Blood
99: 609-617
[Abstract]
[Full Text]
-
Kim, N., Takami, M., Rho, J., Josien, R., Choi, Y.
(2002). A Novel Member of the Leukocyte Receptor Complex Regulates Osteoclast Differentiation. JEM
195: 201-209
[Abstract]
[Full Text]
-
Saverino, D., Merlo, A., Bruno, S., Pistoia, V., Grossi, C. E., Ciccone, E.
(2002). Dual Effect of CD85/Leukocyte Ig-Like Receptor-1/Ig-Like Transcript 2 and CD152 (CTLA-4) on Cytokine Production by Antigen-Stimulated Human T Cells. J. Immunol.
168: 207-215
[Abstract]
[Full Text]
-
Hurks, H. M. H., Valter, M. M., Wilson, L., Hilgert, I., van den Elsen, P. J., Jager, M. J.
(2001). Uveal Melanoma: No Expression of HLA-G. IOVS
42: 3081-3084
[Abstract]
[Full Text]
-
Allen, R. L., Raine, T., Haude, A., Trowsdale, J., Wilson, M. J.
(2001). Cutting Edge: Leukocyte Receptor Complex-Encoded Immunomodulatory Receptors Show Differing Specificity for Alternative HLA-B27 Structures. J. Immunol.
167: 5543-5547
[Abstract]
[Full Text]
-
Canavez, F., Young, N. T., Guethlein, L. A., Rajalingam, R., Khakoo, S. I., Shum, B. P., Parham, P.
(2001). Comparison of Chimpanzee and Human Leukocyte Ig-Like Receptor Genes Reveals Framework and Rapidly Evolving Genes. J. Immunol.
167: 5786-5794
[Abstract]
[Full Text]
-
Devergne, O., Coulomb-L'Hermine, A., Capel, F., Moussa, M., Capron, F.
(2001). Expression of Epstein-Barr Virus-Induced Gene 3, an Interleukin-12 p40-Related Molecule, throughout Human Pregnancy : Involvement of Syncytiotrophoblasts and Extravillous Trophoblasts. Am. J. Pathol.
159: 1763-1776
[Abstract]
[Full Text]