|
||
By



From the * Icos Corporation, Bothell, Washington 98021; and
Istituto di Ricerche Farmacologiche
"Mario Negri", I-20157 Milan, Italy
A cDNA encoding a novel human chemokine was isolated by random sequencing of cDNA clones from human monocyte-derived macrophages. This protein has been termed macrophagederived chemokine (MDC) because it appears to be synthesized specifically by cells of the macrophage lineage. MDC has the four-cysteine motif and other highly conserved residues characteristic of CC chemokines, but it shares <35% identity with any of the known chemokines. Recombinant MDC was expressed in Chinese hamster ovary cells and purified by heparin- Sepharose chromatography. NH2-terminal sequencing and mass spectrophotometry were used to verify the NH2 terminus and molecular mass of recombinant MDC (8,081 dalton). In microchamber migration assays, monocyte-derived dendritic cells and IL-2-activated natural killer cells migrated to MDC in a dose-dependent manner, with a maximal chemotactic response at 1 ng/ml. Freshly isolated monocytes also migrated toward MDC, but with a peak response at 100 ng/ml MDC. Northern analyses indicated MDC is highly expressed in macrophages and in monocyte-derived dendritic cells, but not in monocytes, natural killer cells, or several cell lines of epithelial, endothelial, or fibroblast origin. High expression was also detected in normal thymus and less expression in lung and spleen. Unlike most other CC chemokines, MDC is encoded on human chromosome 16. MDC is thus a unique member of the CC chemokine family that may play a fundamental role in the function of dendritic cells, natural killer cells, and monocytes.
Chemokines comprise a family of secreted proteins that
attract and activate a variety of cell types, generally
augmenting the immune response (reviewed in references
1). Chemokines have been classified into two subfamilies
based on the relative positions of the first two of four conserved cysteine residues. In the CC subfamily, the first two
cysteines are adjacent, whereas in the CXC subfamily, they
are separated by one amino acid. The CC chemokines usually act on monocytes, T lymphocytes, and in some cases,
eosinophils, basophils, or mast cells. In contrast, the CXC
chemokines generally act upon neutrophils. Further, the chemokines macrophage inflammatory protein (MIP)1-1 The repertoire of known human CC chemokines is
expanding rapidly and now includes MIP-1 The present study describes the cloning and characterization of a novel human CC chemokine, macrophage-derived
chemokine (MDC). MDC is not closely related to the
other chemokines and has not been previously identified in
the publicly available databases. MDC is produced by macrophages and dendritic cells, and it is chemotactic for monocytes, monocyte-derived dendritic cells, and IL-2-activated
natural killer cells.
Isolation of a cDNA-encoding MDC.
RNA Stat-60 (Tel-Test,
Inc., Friendswood, TX) was used to isolate poly (A+) RNA from
monocyte-derived macrophages from a normal human donor. cDNA generated from this RNA (Invitrogen Copy Kit; Invitrogen, San Diego, CA) was inserted into the mammalian expression
vector pRc/CMV (Invitrogen) and used to transform Escherichia
coli XL1-blue bacteria (Stratagene Corp., La Jolla, CA) (36). Plasmid DNA was isolated from randomly chosen individual transformants (Wizard miniprep purification system; Promega Corp., Madison, WI). Approximately 300-500 bp of each end of the plasmid
inserts were sequenced on an automated sequencer (model 373;
Applied Biosystems, Foster City, CA) and compared to the GenBank "nr" database using the BLAST (37) program (National Center
for Biotechnology Information, Bethesda, MD, E-mail: Blast{at}ncbi.nlm.nih.gov). Among several hundred clones sequenced, one clone,
designated pMP390, was identified as a unique sequence that contained significant homology to CC chemokines. To facilitate
complete sequencing, the 2.9-kb insert of pMP390 was subcloned into the vector pBluescript SK
(4),
stromal-derived factor (5, 6), and Exodus (7) have been implicated in the regulation of hematopoiesis.
, MIP-1
,
RANTES, I-309, monocyte chemotactic proteins 1, 2, and 3 (MCP-1, -2, -3; 8-13), and the recently described chemokines MCP-4 (14), eotaxin (17, 18), HCC-1 (19), thymus
and activation regulated chemokine (TARC) (20), and Exodus (7). These proteins are 70-100 amino acids in length and
have 25-70% identity with each other. Chemokines act
through G protein-coupled receptors, which have a characteristic seven-transmembrane structure. Five CC chemokine
receptors have been described: CCR-1 (21, 22) binds MIP1
, RANTES, and MCP-3 (23, 24); CCR-2 binds MCP-1
(25), MCP-3 (26), and MCP-4 (14); CCR-3 (18, 27)
binds eotaxin, MCP-3, RANTES, and MCP-4 (15); CCR-4
(28) binds MIP-1
, RANTES, and MCP-1; and CCR-5 (29,
30) binds MIP-1
, MIP-1
, and RANTES. In addition, macrophage-tropic strains of HIV appear to require one of these
receptors, primarily CCR-5, as a cofactor for infection (31).
(Stratagene) and subjected to nested deletion (Erase-a-Base System; Promega Corp.).
80°C
on Kodak XAR-5 film (Rochester, NY) with intensifying screens
(Amersham, Arlington Heights, IL).
Production of Recombinant MDC.
PCR was used to amplify a
fragment containing the entire coding region of the MDC cDNA
clone (Fig. 1, bases 1-403), using the primers 5
-GACCAA
GCTTGAGACATACAGGACAGAGCA and 5
-TGGATCTA
GAAGTTGGCACAGGCTTCTGG. Restriction sites added to
the primers are underlined. The PCR mix contained 0.2 µg of
pMP390 plasmid DNA, 1.5 mM MgCl2, 50 mM KCl, 10 mM
Tris, pH 8.4, 0.2 mM each dNTP, 10 µg/ml each primer, and
0.5 µl Taq polymerase (5 U/µl) (Boehringer Mannheim). The reactions were incubated for 4 min at 94°C, followed by 30 cycles of denaturation for 15 s at 94°C, annealing for 15 s at 60°C, and extension for 30 s at 72°C. The PCR fragment was cloned
into the expression vector pDC1, a derivative of pRc/CMV in
which the neomycin phosphotransferase gene had been replaced
by the mouse dihydrofolate reductase gene from the vector
pSV2-dhfr (vector #37146; American Type Culture Collection,
Rockville, MD). The pDC1/MDC plasmid was linearized by restriction digestion within the vector sequence and electroporated
into the Chinese hamster ovary (CHO) cell line DG44, which
lacks the dihydrofolate reductase gene (39). Cells were electroporated in a 0.4-cm cuvette using a gene pulser (Bio Rad Labs.,
Hercules, CA) at 290 volts, 960 µF. Transfectants were selected
by growth in
-medium (Catalogue No. 12000; GIBCO BRL,
Gaithersburg, MD) plus 10% dialyzed FCS (Hyclone Labs., Logan, UT) in the absence of hypoxanthine and thymidine. Cells
from several hundred transfected colonies were pooled and replated
in
-medium containing 20 nM methotrexate (Sigma Chemical
Co., St. Louis, MO). Colonies surviving this round of selection
were isolated and expanded in
-medium containing 0.2-1.0% dialyzed FCS. MDC was isolated from the culture medium by passage over heparin-Sepharose CL-6B (Pharmacia, Uppsala, Sweden). The column was washed with 0.2 M NaCl in 20 mM Tris,
pH 8, and eluted with 0.6 M NaCl in 20 mM Tris, pH 8. The
eluted material was fractionated on an 18% acrylamide SDSPAGE gel (Novex, San Diego, CA) and electroblotted to polyvinylidene fluoride membrane (Millipore Corp., Bedford, MA).
The band corresponding to MDC was sequenced on an automated sequencer (model 473A; Applied Biosystems).
The mature form of MDC protein (Fig. 1) was chemically synthesized by Gryphon Sciences (San Francisco, CA) using t-butyloxycarbonyl chemistries on a peptide synthesizer (430A; Applied Biosystems). Lyophilized protein was dissolved at 10 mg/ml in 4 mM HCl and immediately diluted to 0.1 mg/ml in PBS plus 0.1% BSA for storage at
80°C.
Production of MDC Antibodies. A PCR fragment encoding a thrombin cleavage site and the mature form of MDC was inserted into the vector pGEX-3X (Pharmacia). XL-1 blue bacteria (Stratagene) were transformed with the resulting plasmid to generate a GST-MDC fusion protein. The protein was isolated from inclusion bodies, digested with thrombin (Sigma Chemical Co.), and fractionated by preparative SDS-PAGE (Tris glycine, 18% acrylamide). A gel slice containing the MDC fragment was excised and emulsified with adjuvant for immunization of rabbits for polyclonal sera or mice for monoclonal sera. mAbs were obtained from fusions of mouse spleen cells with NS-1 myeloma cells, according to standard protocols (40).
Cell Culture.
The human cell lines A549 (lung epithelial; CCL185; American Type Culture Collection), T84 (colon epithelial;
CCL-248; American Type Culture Collection), and IMR-90 (lung
fibroblast; CCL-186; American Type Culture Collection) were
obtained. Cells were cultured in DME (GIBCO BRL) supplemented with 10% FCS (Hyclone Labs.), 25 mM Hepes, penicillin,
and streptomycin. Immortalized human umbilical vein endothelial cells (I-HUVECs) were obtained (Dr. Jay Nelson, University
of Oregon, Eugene, OR) and cultured in RPMI (GIBCO BRL)
supplemented with 10% FCS (Hyclone Labs.), 400 µg/ml G418
(GIBCO BRL), 1 U/ml heparin (Sigma Chemical Co.), and 30 µg/ml endothelial cell growth factor (Collaborative Biomedical Products, Bedford, MA). A549 and IMR-90 cells were grown to
70-80% confluency and cultured in the presence or absence of 10 ng/ml TNF-
(R & D Syst. Inc., Minneapolis, MN) for 6 h. T84
cells were treated for 1 d with TNF-
(5 ng/ml), TGF-
(1 ng/ml;
R & D Syst. Inc.), or interferon-
(200 U/ml; PeproTech,
Rocky Hill, NJ). For Northern blotting, monocytes were isolated
from PBMC using histopaque gradients (Sigma Chemical Co.)
and adherence to tissue culture plastic. Cells were cultured for 6 d
to allow differentiation into macrophages (41).
and CD3
.
Migration Assay. Cell migration was evaluated using a chemotaxis microchamber technique, as previously described (42). 27µl aliquots of chemoattractant solution or control medium (RPMI 1640 with 1% FCS) were added to the lower wells of a chemotaxis chamber (NeuroProbe, Captain John, MD). A polycarbonate filter (5 µm pore size; NeuroProbe) was layered onto the wells and covered with a silicon gasket and top plate. For migration of natural killer cells, the filters were coated with 200 µg/ ml gelatin and 10 µg/ml fibronectin. 50 µl of cell suspension (0.7-1.5 × 106/ml) were seeded in the upper chamber. The chamber was incubated at 37°C in a humidified chamber in the presence of 5% CO2 for 1.5 to 2 h. After incubation, filters were removed and stained with Diff-Quik (Baxter s.p.a., Rome, Italy). Five high power oil-immersion fields (100×) were counted. Results are expressed as the mean number of migrated cells. Each experiment was performed in triplicate.
Northern Blotting.
The probe for Northern hybridizations was
generated by PCR amplification of bases 102-461 of the MDC
cDNA sequence using the primers 5
-TCTATCTAGAGGCCCCTACGGCGCCAACATGGAAG and 5
-AATGGATCCACAGCACGGAGGTGACCAAG. Restriction sites added to the
primers are underlined. The fragment was gel purified and labeled
with [32P]CTP and [32P]TTP (DuPont New England Nuclear,
Boston, MA) by random priming (Boehringer Mannheim). RNA
was isolated from cell lines and cultured macrophages using RNA
Stat-60 (Tel-Test, Inc.). Total RNA (20 µg) was fractionated on
0.8% agarose formaldehyde gels, transferred to nitrocellulose, hybridized, and washed under stringent conditions as described (38).
Autoradiographs were exposed at
80°C with intensifying screens
for 3 h (glyceraldehyde phosphate dehydrogenase [GAPDH] and
MDC) or 8 h (MCP-1). Multiple tissue Northern blots (Clontech, Palo Alto, CA) were probed and washed under stringent conditions according to the manufacturer's recommendations.
Films were exposed at
80°C with intensifying screens for 16 h.
Chromosome Localization.
Hybrid mouse or hamster cell lines
containing a single human chromosome (Coriell Institute, Camden, NJ) were screened by PCR for the presence of the MDC
gene. Reaction conditions were as described above, using 0.5 µg
of genomic DNA from each cell line as templates with the primers 5
-TATTGGATCCGTTCTAGCTCCCTGTTCTCC and
5
-CCAAGAATTCCTGCAGCCACTTTCTGGGCTC, which
amplify bases 676-1,042 of the MDC cDNA sequence (Fig. 1).
The identity of the PCR product from the positive cell line was
verified by hybridization to an internal oligonucleotide complementary to bases 246-266 of the MDC cDNA.
Computer Analysis.
Protein comparisons (Fig. 2) were performed with the GeneWorks program (IntelliGenetics, Mountain
View, CA).
Random clones from a human macrophage cDNA library
were partially sequenced and electronically compared to
the GenBank Non-Redundant (nr) database of sequences
(our manuscript in preparation). One clone contained a sequence that encoded a peptide with >30% identity to portions of RANTES, MIP-1
, and MIP-1
. This fragment
was used to screen the same macrophage library for additional clones. The sequence of the full-length cDNA obtained is presented in Fig. 1. It contains an open reading
frame of 93 amino acids that encodes a novel CC chemokine,
designated MDC. The cDNA is considerably longer than
that of other chemokines, and it includes three Alu repeats
in the 3
noncoding region.
MDC has 28-34% amino acid identity with other CC
chemokines. It contains the characteristic four-cysteine motif
in addition to nine other residues that are very highly conserved in this family (Fig. 2). Comparison with other chemokines also suggests the first 24 amino acids of MDC constitute a leader sequence, which is consistent with von Heijne's
rules governing signal cleavage (45). To confirm the predicted NH2 terminus of the mature peptide, the MDC cDNA
was cloned into an expression vector for stable transfection of CHO cells. Protein was purified from culture supernatants by heparin-Sepharose chromatography and gel fractionation (Fig. 3). NH2-terminal sequencing of the band
migrating at the expected position of MDC yielded the sequence GPYGANMEDSV, confirming the predicted NH2
terminus of the mature protein. Amino acid analysis and
mass spectrophotometry of the mature protein were consistent with the predicted amino acid composition and molecular weight (8,081 dalton) (data not shown).
MDC Gene Expression in Human Cells.
Because the MDC clone was isolated from a human macrophage cDNA library, its expression during differentiation of monocytes into macrophages was examined. Human monocytes from a single donor were cultured on a series of tissue culture plates, and cells from individual plates were harvested after 0, 2, 4, or 6 d. Under these conditions, monocytes differentiate into macrophages by day 6 (36, 41). A Northern blot of RNA from the cells harvested at each time point was probed with the MDC cDNA. No signal was detectable in RNA from freshly isolated monocytes, whereas a very strong signal was generated from cells that had differentiated into macrophages after 6 d of culture (Fig. 4 A).
stimulation; PBMC without and with stimulation by PHA and PMA; and
monocyte derived macrophages after 6 d in culture. After probing with
MDC, the filter was stripped and probed sequentially with MCP-1 and GAPDH.
MDC gene expression was examined further by treating the human cell line HL60 with either 1% DMSO or 50 ng/ml PMA. Treatment with DMSO induces differentiation of HL60 cells into a granulocytic cell type, whereas PMA induces their differentiation toward the macrophage lineage (46). After 3 d of PMA treatment, the macrophagelike cells clearly expressed MDC message, although the level of expression was less than that of monocyte-derived macrophages (Fig. 4 B). No MDC expression was seen after 1 d of PMA treatment or in untreated cells, nor was expression detectable in the granulocytic cells generated by treatment with DMSO for 1 or 3 d.
Northern blotting was also used to examine the expression of MDC in dendritic cells and natural killer cells derived from human PBMC (see Materials and Methods). High expression was observed in dendritic cells, which are of the mononuclear phagocyte lineage, whereas no MDC message was detectable in natural killer cells (Fig. 4 C). However, both of these cell types were capable of chemotaxis in response to MDC (see below).
Other human cell types analyzed for expression of MDC
were unstimulated cultures of the lung epithelial line A549,
the lung fibroblast line IMR90, I-HUVEC, and PBMC. In
addition, to test the effect of proinflammatory cytokines on
MDC expression, the A549, IMR90, and I-HUVECs were
treated with TNF-
(10 ng/ml), and the PBMCs were
treated with PHA (1 µg/ml) plus PMA (30 ng/ml). MDC
mRNA was not detectable in the unstimulated cells by
Northern analysis, and treatment with the cytokines did not
induce MDC expression (Fig. 4 D). Induction of MCP-1
expression was readily apparent after these treatments.
To correlate the expression of MDC protein with MDC
mRNA, mAbs raised against recombinant MDC were used
for Western analysis of culture supernatants from monocytederived macrophages and epithelial cell lines (Fig. 5). The results confirmed that the macrophages secreted MDC protein
into the medium, whereas the epithelial cells did not. MDC
protein expression was not affected by treatment of the macrophages with low density lipoprotein (LDL) or oxidized LDL.
MDC Gene Expression in Human Tissues.
The expression
pattern of MDC in normal human tissues was studied by
Northern analysis. Greatest MDC gene expression was observed in the thymus, with much weaker expression in spleen
and lung (Fig. 6). Very faint expression of MDC was seen
in the small intestine, and no expression was detected in brain,
colon, heart, kidney, liver, ovary, pancreas, placenta, prostate, skeletal muscle, testis, or peripheral blood leukocytes.
Biological Activity of MDC.
The mature form of MDC was chemically synthesized for use in biological assays. Synthetic chemokines have been shown to fold correctly and retain the biological activity of the natural species (47). To confirm that synthetic MDC was in fact correctly folded, formation of the disulfide bridges was confirmed by peptide mapping. The behavior of chemically synthesized MDC was identical to that of CHO-derived MDC in the following procedures: SDS-PAGE, heparin-Sepharose chromatography, and immunoprecipitation and Western blotting with mAbs or polyclonal antibodies raised against recombinant MDC (data not shown).
A microchamber migration assay was used to study the
chemotactic activity of MDC upon dendritic cells and IL-2-
activated natural killer cells, both derived from human
PBMC. Both of these cell types migrated toward MDC
with a bell-shaped dose-response curve. Migration became
significant at 0.1 ng/ml (P <0.05) and reached a maximum
at 1 ng/ml MDC (P <0.01) (Fig. 7). At the optimal concentration of 1 ng/ml, the number of dendritic cells that
migrated to MDC was 87 ± 18% (n = 7) of that responding to 100 ng/ml MCP-3, a reference chemoattractant for
dendritic cells (42).
A similar assay was used to measure the chemotactic response of PBMC to MDC. Significant migration occurred
at 1 ng/ml MDC (P <0.05), and the response peaked at
100 ng/ml (Fig. 8). Under these conditions, only monocytes had migrated through the filter. The peak number of
cells was equivalent to that migrating to 100 ng/ml MCP-3
(data not shown).
Under similar assay conditions, MDC was not chemotactic for neutrophils at concentrations up to 1 µg/ml (data not shown).
Chromosome Localization.PCR was used to screen for the MDC gene in genomic DNA isolated from a set of mouse-human or hamster-human chimeric cell lines, each of which retains a single human chromosome. The expected PCR product was produced only from the line containing human chromosome 16. The identity of the PCR band was confirmed by hybridization with an internal MDC oligonucleotide (data not shown).
We have described the cloning and activity of a novel
human CC chemokine, MDC. This sequence was not previously represented in the Expressed Sequence Tags (dbest)
or Non-Redundant (nr) databases of GenBank. The amino
acid sequence of MDC suggests that it is a member of the
CC chemokine family, but it is not closely related to any of
the known chemokines. The length of the 3
noncoding region is unusually long and contains multiple Alu repeats.
The size of the MDC transcript corresponds well to the
size of the cDNA (Figs. 4 and 5), confirming that the entire
cDNA is transcribed.
Our results indicate that MDC has a very specific pattern of expression. It was highly expressed by fully differentiated macrophages and monocyte-derived dendritic cells, but it was not expressed by freshly isolated monocytes, granulocytic cells, or natural killer cells (Fig. 4). The timing of MDC expression in macrophages cultured in vitro appears to be similar to that of the transferrin receptor, which is also strongly upregulated late in macrophage differentiation (6 d after plating; 50). The kinetics of induction of other macrophage-specific products is quite different. For example, platelet activating factor acetylhydrolase is highly upregulated by day 2 (36), and chitinase is strongly induced beginning at day 9 (51).
The activity and expression pattern of MDC have several
implications in the function of dendritic cells. Immature
dendritic cells are rapidly recruited to sites of inflammatory
stimulation and are highly proficient in antigen uptake. After antigenic stimulation, they are again mobilized and migrate to draining lymph nodes. During this process of maturation, they lose their ability to process and present
soluble antigen and become extemely potent stimulators of
T lymphocytes (52). Consequently, dendritic cells have
been implicated in organ transplant rejection, HIV infection, asthma, and induction of tolerance (56). Because MDC
is highly expressed by dendritic cells and is also chemotactic
for them, it may play an autocrine role in their accumulation at sites of inflammation. In addition, several other
chemokines, including MCP-3, MIP-1
, and RANTES,
are chemotactic for immature dendritic cells (42), but do
not induce their maturation (Sozzani, S., and P. Allavena,
unpublished data). Thus, chemokines may play a major role
in the initial influx of immature dendritic cells. Administration of TNF-
also leads to accumulation of dendritic cells
in vivo (57); however, this effect may be indirectly mediated by factors induced by TNF-
, including CC chemokines. Unlike the chemokines, TNF-
induces maturation
of dendritic cells, decreasing their antigen uptake and increasing their ability to stimulate T cells (43).
The high expression of MDC in the thymus suggests it has an additional (or alternate) function in T cell development. One possible role is to attract or retain dendritic cells in the thymus to enhance stimulation of T cells. In addition, MDC may be chemotactic for T cells themselves and thereby aid in their aggregation with dendritic cells. Notably, the CC chemokine TARC, which is specifically chemotactic for T cells, has a tissue-specific expression pattern that is nearly identical to that of MDC, with very high expression in the thymus (20). TARC, which is ~32% identical to MDC, is also the only other chemokine known to be encoded on chromosome 16 (58). The effect of MDC on T cells is currently being investigated.
Natural killer cells recognize a broad range of cytolytic
targets and are believed to be involved in defense against
viral infection, destruction of tumor cells, and regulation of
hematopoiesis. The means by which they select a specific
target cell is poorly understood, but their activity appears to
involve an extensive set of cytokines that includes interleukins, interferons, and chemokines (59, 60). Granule exocytosis or chemotaxis of natural killer cells has been demonstrated in response to many CC chemokines, such as MCP-1,
-2, and -3 (49, 61, 62), MIP-1
(63), MIP-1
(49), and
RANTES (61). Further, these cells respond to the CXC
chemokines IP-10 (63) and IL-8 (64), and migrate toward the C chemokine, lymphotactin (65). Our results indicate that MDC likewise induces directed migration of IL-2-activated
natural killer cells, with an effective concentration in the low
nanomolar range.
Monocytes also exhibited a dose-dependent chemotactic response to MDC. The magnitude of the response was similar to that of monocyte-derived dendritic cells and activated natural killer cells, but it occurred at a 100-fold higher concentration of MDC (Fig. 8). Thus, in vivo production of MDC may first attract dendritic cells or natural killer cells, and further accumulation of MDC may cause a subsequent influx of monocytes.
Induction of MDC expression does not follow the pattern typically observed for chemokines. These genes are generally not constitutively expressed, but they can be strongly
induced by cytokine treatment (e.g., TNF-
induction of
MCP-1; Fig. 4). In marked contrast, induction of MDC
was not detected after proinflammatory stimulation of
PBMC with PHA plus PMA or stimulation of lung epithelial cells (A549), lung fibroblast cells (IMR90), or I-HUVEC
with TNF-
(Figs. 4 and 5). Similarly, treatment with LDL
seemed to have little effect on production of MDC protein
by macrophages, although a transient rise in MDC mRNA
expression may not have been detected in this study. LDL
treatment of macrophages appears to have diverse effects on
production of other chemokines, either enhancing or quenching expression, depending on the activation state of
the cells and modifications to the lipoprotein (66, 67).
The receptor responsible for binding MDC is not known, but preliminary results indicate it does not signal through the cloned chemokine receptors CCR1 or CCR2 (data not shown). Analysis of the receptors expressed by dendritic cells and natural killer cells may reveal the molecule(s) responsible for binding MDC. The chemotactic activity of MDC for these cells suggests that it may be clinically relevant in various physiological processes, including induction of immune responses and elimination of pathogenic microbes.
Address correspondence to Patrick W. Gray, ICOS Corp., 22021 20th Ave. SE, Bothell, WA 98021.
Received for publication 11 February 1997.
P. Allavena, S. Sozzani, and A. Mantovani were supported by Project AIDS, Istituto Superiore Sanitá, and Associazione Italiana per la Recerca sul Cancro.The authors wish to thank Christi Wood for DNA sequencing, Hai Le Trong for protein sequencing, Reyna Simon and Michael Siani for synthesis and chemical analysis of MDC, Mitch Fahning for production of mAbs, and Darcy Clark for supernatants from LDL-treated macrophages.
| 1. | Oppenheim, J.J.. 1993. Overview of chemokines. Adv. Exp. Med. Biol. 351: 183-186 [Medline]. |
| 2. | Baggiolini, M., B. Dewald, and B. Moser. 1994. Interleukin-8 and related chemotactic cytokines-CXC and CC chemokines. Adv. Immunol. 55: 97-179 [Medline]. |
| 3. | Schall, T.J.. 1991. Biology of the RANTES/SIS cytokine family. Cytokine. 3: 165-183 [Medline]. |
| 4. |
Eaves, C.J.,
J.D. Cashman,
S.D. Wolpe, and
A.C. Eaves.
1993.
Unresponsiveness of primitive chronic myeloid leukemia cells to macrophage inflammatory protein 1 , an inhibitor of primitive normal hematopoietic cells.
Proc. Natl. Acad.
Sci. USA.
90:
12015-12019
|
| 5. |
Tashiro, K.,
H. Tada,
R. Heilker,
M. Shirozu,
T. Nakano, and
T. Honjo.
1993.
Signal sequence trap: a cloning strategy
for secreted proteins and type I membrane proteins.
Science
(Wash. DC).
261:
600-603
|
| 6. | Nagasawa, T., S. Hirota, K. Tachibana, N. Takakura, S. Nishikawa, Y. Kitamura, N. Yoshida, H. Kikutani, and T. Kishimoto. 1996. Defects of B-cell lymphopoiesis and bonemarrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature (Lond.). 382: 635-638 [Medline]. |
| 7. | Hromas, R., P. Gray, D. Chantry, R. Godiska, M. Krathwohl, K. Fife, G.I. Belle, J. Takeda, S. Aronica, M. Gordon et al. 1997. Cloning and characterization of Exodus, a novel beta chemokine. Blood. In press. |
| 8. |
Nakao, M.,
H. Nomiyama, and
K. Shimada.
1990.
Structures
of human genes coding for cytokine LD78 and their expression.
Mol. Cell. Biol.
10:
3646-3658
|
| 9. | Brown, K.D., S.M. Zurawski, T.R. Mosmann, and G. Zurawski. 1989. A family of small inducible proteins secreted by leukocytes are members of a new superfamily that includes leukocyte and fibroblast-derived inflammatory agents, growth factors, and indicators of various activation processes. J. Immunol. 142: 679-687 [Abstract]. |
| 10. | Schall, T.J., J. Jongstra, B.J. Dyer, J. Jorgensen, C. Clayberger, M.M. Davis, and A.M. Krensky. 1988. A human T cell-specific molecule is a member of a new gene family. J. Immunol. 141: 1018-1025 [Abstract]. |
| 11. | Miller, M.D., S. Hata, R. de Waal, Malefyt, and M.S. Krangel. 1989. A novel polypeptide secreted by activated human T lymphocytes. J. Immunol. 143: 2907-2916 [Abstract]. |
| 12. |
Matsushima, K.,
C.G. Larsen,
G.C. DuBois, and
J.J. Oppenheim.
1989.
Purification and characterization of a novel
monocyte chemotactic and activating factor produced by a
human myelomonocytic cell line.
J. Exp. Med.
169:
1485-1490
|
| 13. |
Van Damme, J.,
P. Proost,
J.-P. Lenaerts, and
G. Opdenakker.
1992.
Structural and functional identification of two human, tumor-derived monocyte chemotactic proteins (MCP-2
and MCP-3) belonging to the chemokine family.
J. Exp.
Med.
176:
59-65
|
| 14. |
Uguccioni, M.,
P. Loetscher,
U. Forssmann,
B. Dewald,
H. Li,
S. Hensche,
Lima,
Y. Li,
B. Kreider,
G. Garotta,
M. Thelen, et al
.
1996.
Monocyte chemotactic protein 4 (MCP4), a novel structural and functional analogue of MCP-3 and
eotaxin.
J. Exp. Med.
183:
2379-2384
|
| 15. | Garcia-Zepeda, E.A., C. Combadiere, M.E. Rothenber, M.N. Sarafi, F. Lavigne, Q. Hamid, P.M. Murphy, and A.D. Luster. 1996. Human monocyte chemoattractant protein (MCP)-4 is a novel CC chemokine with activities on monocytes, eosinophils, and basophils induced in allergic and nonallergic inflammation that signals through the CC chemokine receptors (CCR)-2 and -3. J. Immunol. 157: 5613-5626 [Abstract]. |
| 16. | Godiska, R., D. Chantry, C.J. Raport, V.L. Schweickart, H. LeTrong, and P.W. Gray. 1997. Monocyte chemotactic protein-4: tissue-specific expression and signaling through CC chemokine receptor-2. J. Leukocyte Biol. In press. |
| 17. |
Kitaura, M.,
T. Nakajima,
T. Imai,
T. Harada,
C. Combadiere,
H.L. Tiffany,
P.M. Murphy, and
O. Yoshie.
1996.
Molecular cloning of human eotaxin, an eosinophil-selective
CC chemokine, and identification of a specific eosinophil eotaxin receptor, CC chemokine receptor 3.
J. Biol. Chem.
271:
7725-7730
|
| 18. |
Daugherty, B.L.,
S.J. Siciliano,
J.A. DeMartino,
L. Malkowitz,
A. Sirotina, and
M.S. Springer.
1996.
Cloning, expression, and
characterization of the human eosinophil eotaxin receptor.
J.
Exp. Med.
183:
2349-2354
|
| 19. |
Schulz-Knappe, P.,
H.-J. Mägert,
B. Dewald,
M. Meyer,
Y. Cetin,
M. Kubbies,
J. Tomeczkowski,
K. Kirchhoff,
M. Raida,
K. Adermann, et al
.
1996.
HCC-1, a novel chemokine from
human plasma.
J. Exp. Med.
183:
295-299
|
| 20. |
Imai, T.,
T. Yoshida,
M. Baba,
M. Nishimura,
M. Kakizaki, and
O. Yoshie.
1996.
Molecular cloning of a novel T cell-
directed CC chemokine expressed in thymus by signal sequence trap using Epstein-Barr virus vector.
J. Biol. Chem.
271:
21514-21521
|
| 21. |
Gao, J.L.,
D.B. Kuhns,
H.L. Tiffany,
D. McDermott,
X. Li,
U. Francke, and
P.M. Murphy.
1993.
Structure and functional expression of the human macrophage inflammatory
protein 1 /RANTES receptor.
J. Exp. Med.
177:
1421-1427
|
| 22. | Neote, K., D. DiGregorio, J.Y. Mak, R. Horuk, and T.J. Schall. 1993. Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor. Cell. 72: 415-425 [Medline]. |
| 23. |
Combadiere, C.,
S.K. Ahuja,
J. Van Damme,
H.L. Tiffany,
J.L. Gao, and
P.M. Murphy.
1995.
Monocyte chemoattractant protein-3 is a functional ligand for CC chemokine receptors 1 and 2B.
J. Biol. Chem.
270:
29671-29675
|
| 24. |
Ben-Baruch, A.,
L. Xu,
P.R. Young,
K. Bengali,
J.J. Oppenheim, and
J.M. Wang.
1995.
Monocyte chemotactic protein-3
(MCP3) interacts with multiple leukocyte receptors. C-C
CKR1, a receptor for macrophage inflammatory protein-1
/RANTES, is also a functional receptor for MCP3.
J. Biol.
Chem.
270:
22123-22128
|
| 25. | Proost, P., A. Wuyts, and J. Van Damme. 1996. Human monocyte chemotactic proteins-2 and -3: structural and functional comparison with MCP-1. J. Leukocyte Biol. 59: 67-74 [Abstract]. |
| 26. | Franci, C., L.M. Wong, J. Van Damme, P. Proost, and I.F. Charo. 1995. Monocyte chemoattractant protein-3, but not monocyte chemoattractant protein-2, is a functional ligand of the human monocyte chemoattractant protein-1 receptor. J. Immunol. 1545: 6511-6517 . |
| 27. |
Ponath, P.D.,
S. Qin,
T.W. Post,
J. Wang,
L. Wu,
N.P. Gerard,
W. Newman,
C. Gerard, and
C.R. Mackay.
1996.
Molecular cloning and characterization of a human eotaxin receptor expressed selectively on eosinophils.
J. Exp. Med.
183:
2437-2448
|
| 28. |
Power, C.A.,
A. Meyer,
K. Nemeth,
K.B. Bacon,
A.J. Hoogewerf,
A.E. Proudfoot, and
N. Wells.
1995.
Molecular
cloning and functional expression of a novel CC chemokine
receptor cDNA from a human basophilic cell line.
J. Biol.
Chem.
270:
19495-19500
|
| 29. |
Raport, C.J.,
J. Gosling,
V.L. Schweickart,
P.W. Gray, and
I.F. Charo.
1996.
Molecular cloning and functional characterization of a novel human CC chemokine receptor (CCR5)
for RANTES, MIP-1 , and MIP-1 .
J. Biol. Chem.
271:
17161-17166
|
| 30. |
Combadiere, C.,
S.K. Ahuja,
H.L. Tiffany, and
P.M. Murphy.
1996.
Cloning and functional expression of CC CKR5,
a human monocyte CC chemokine receptor selective for
MIP-1 , MIP-1 , and RANTES.
J. Leukocyte Biol.
60:
147-152
[Abstract].
|
| 31. | Deng, H.-K., R. Liu, W. Ellmeier, S. Choe, U. Derya, M. Burkhart, P. DiMarzio, S. Marmon, R.E. Sutton, C.M. Hill, et al . 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature (Lond.). 381: 661-666 [Medline]. |
| 32. |
Alkhatib, G.,
C. Combadiere,
C.C. Broder,
Y. Feng,
P.E. Kennedy,
P.M. Murphy, and
E.A. Berger.
1996.
CC CKR5:
a RANTES, MIP-1 , MIP-1 receptor as a fusion cofactor
for macrophage-tropic HIV-1.
Science (Wash. DC).
272:
1955-1958
[Abstract].
|
| 33. | Dragic, T., V. Litwin, G.P. Allaway, S.R. Martin, Y. Haung, K.A. Nagashima, C. Cayanan, P.J. Maddon, R.A. Koup, J.P. Moore, et al . 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature (Lond.). 381: 667-673 [Medline]. |
| 34. |
Choe, H.,
M. Farzan,
Y. Sun,
N. Sullivan,
B. Rollins,
P.D. Ponath,
L. Wu,
C.R. Mackay,
G. LaRosa,
W. Newman, et al
.
1996.
The -chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell.
85:
1135-1148
[Medline].
|
| 35. | Doranz, B.J., J. Rucker, J. Yi, R.J. Smyth, M. Samson, S.C. Peiper, M. Parmentier, R.G. Collman, and R.W. Doms. 1996. A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR2b as fusion cofactors. Cell. 85: 1149-1158 [Medline]. |
| 36. | Tjoelker, L.W., C. Wilder, C. Eberhardt, D.M. Stafforini, G. Dietsch, B. Schimpf, S. Hooper, H. Le Trong, L.S. Cousens, G.A. Zimmerman, et al . 1995. Anti-inflammatory properties of a platelet-activating factor acetylhydrolase. Nature (Lond.). 374: 549-552 [Medline]. |
| 37. | Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-412 [Medline]. |
| 38. | Godiska, R., D. Chantry, G.N. Dietsch, and P.W. Gray. 1995. Chemokine expression in murine experimental allergic encephalomyelitis. J. Neuroimmunol. 5805: 167-176 . |
| 39. | Urlaub, G., P.J. Mitchell, E. Kas, L.A. Chasin, V.L. Funanage, T.T. Myoda, and J. Hamlin. 1986. Effect of gamma rays at the dihydrofolate reductase locus: deletions and inversions. Somatic Cell Mol. Genet. 12: 555-566 [Medline]. |
| 40. | Sambrook, J., E.F. Fritsch, and T. Maniatis. 1987. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. |
| 41. |
Stafforini, D.M.,
M.R. Elstad,
T.M. McIntyre,
G.A. Zimmerman, and
S.M. Prescott.
1990.
Human macrophages secrete platelet-activating factor acetylhydrolase.
J. Biol. Chem.
265:
9682-9687
|
| 42. | Sozzani, S., F. Sallusto, W. Luini, D. Zhou, L. Piemontli, P. Allavena, J. VanDamme, S. Valitutti, A. Lanzavecchia, and A. Mantovani. 1995. Migration of dendritic cells in response to formyl peptides, C5a and a distinct set of chemokines. J. Immunol. 155: 3292-3295 [Abstract]. |
| 43. |
Sallusto, F., and
A. Lanzavecchia.
1994.
Efficient presentation
of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor
plus interleukin 4 and downregulated by tumor necrosis factor- .
J. Exp. Med.
179:
1109-1118
|
| 44. | Allavena, P., G. Bianchi, P. Giardina, N. Polentarutti, D. Zhou, M. Introna, S. Sozzani, and A. Mantovani. 1996. Migratory response to human NK cells to monocyte-chemotactic proteins. Methods (Orlando). 10: 145-149 . [Medline] |
| 45. |
von Heijne, G..
1986.
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res.
14:
4683-4690
|
| 46. |
Perussia, B.,
D. Lebman,
S.H. Ip,
G. Rovera, and
G. Trinchieri.
1981.
Terminal differentiation surface antigens of myelomonocytic cells are expressed in human promyelocytic
leukemia cells (HL60) treated with chemical inducers.
Blood.
58:
836-843
|
| 47. |
Clark-Lewis, I.,
B. Dewald,
M. Loetscher,
B. Moser, and
M. Baggiolini.
1994.
Structural requirements for interleukin-8
function identified by design of analogs and CXC chemokine
hybrids.
J. Biol. Chem.
269:
16075-16081
|
| 48. |
Gong, J.H., and
I. Clark-Lewis.
1995.
Antagonists of monocyte chemoattractant protein 1 identified by modification of
functionally critical NH2-terminal residues.
J. Exp. Med.
181:
631-640
|
| 49. | Loetscher, P., M. Seitz, I. Clark-Lewis, M. Baggiolini, and B. Moser. 1996. Activation of NK cell by CC chemokines. J. Immunol. 156: 322-327 [Abstract]. |
| 50. | Hirata, T., P.B. Bitterman, J.F. Mornex, and R.G. Crystal. 1986. Expression of the transferrin receptor gene during the process of mononuclear phagocyte maturation. J. Immunol. 136: 1339-1345 [Abstract]. |
| 51. |
Boot, R.G.,
H.G. Renkema,
A. Strijland,
A. Jan van Zonneveld, and
J.M.F.G. Aerts.
1995.
Cloning of a cDNA encoding chitotriosidase, a human chitinase produced by macrophages.
J. Biol. Chem.
270:
26252-26256
|
| 52. | Steinman, R.M.. 1991. The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9: 271-296 [Medline]. |
| 53. | Romani, N., and G. Schuler. 1992. The immunologic properties of epidermal Langerhans cells as a part of the dendritic cell system. Springer Semin. Immunopathol. 13: 265-279 [Medline]. |
| 54. | Austyn, J.M.. 1992. Antigen uptake and presentation by dendritic leukocytes. Semin. Immunol. 4: 227-236 [Medline]. |
| 55. |
Austyn, J.M..
1996.
New insights into the mobilization and
phagocytic activity of dendritic cells.
J. Exp. Med.
183:
1287-1292
|
| 56. | Caux, C., Y.-J. Liu, and J. Banchereau. 1995. Recent advances in the study of dendritic cells and follicular dendritic cells. Immunol. Today. 16: 23-25 . |
| 57. | Cumberbatch, M., and I. Kimber. 1992. Dermal tumour necrosis factor-alpha induces dendritic cell migration to draining lymph nodes, and possibly provides one stimulus for Langerhans' cell migration. Immunology. 75: 257-263 [Medline]. |
| 58. | Nomiyama, H., T. Imai, J. Kusuda, R. Miura, D.F. Callen, and O. Yoshie. 1997. Assignment of the human CC chemokine gene TARC (SCYA17) to chromosome 16q13. Genomics. In press. |
| 59. |
Robertson, M.J., and
J. Ritz.
1990.
Biology and clinical relevance of human natural killer cells.
Blood.
76:
2421-2438
|
| 60. | Trinchieri, G.. 1989. Biology of natural killer cells. Adv. Immunol. 47: 187-376 [Medline]. |
| 61. | Maghazachi, A.A., A. Al-Aoukaty, and T.J. Schall. 1994. C-C chemokines induce the chemotaxis of NK and IL-2 activated NK cells. Role for G proteins. J. Immunol. 153: 4969-4977 [Abstract]. |
| 62. | Allavena, P., G. Bianchi, D. Zhou, J. Van Damme, P. Jîlek, S. Sozzani, and A. Mantovani. 1994. Induction of natural killer cell migration by monocyte chemotactic protein-1, -2 and -3. Eur. J. Immunol. 24: 3233-3236 [Medline]. |
| 63. |
Taub, D.D.,
T.J. Sayers,
C.R.D. Carter, and
J.R. Ortaldo.
1995.
and chemokines induce NK cell migration and
enhance NK cell mediated cytolysis.
J. Immunol.
155:
3877-3888
[Abstract].
|
| 64. | Sebok, K., D. Woodside, A. Al-Aoukaty, A.D. Ho, S. Gluck, and A.A. Maghazachi. 1993. IL-8 induces the locomotion of human IL-2-activated natural killer cells. J. Immunol. 150: 1524-1534 [Abstract]. |
| 65. | Bianchi, G., S. Sozzani, A. Zlotnik, A. Mantovani, and P. Allavena. 1996. Migratory response of human natural killer cells to lymphotactin. Eur. J. Immunol. 26: 3238-3241 [Medline]. |
| 66. |
Wang, N.,
I. Tabas,
R. Winchester,
S. Ravalli,
L.E. Rabbani, and
A. Tall.
1996.
Interleukin 8 induced by cholesterol loading of macrophages and expressed by macrophage foam cells
in human atheroma.
J. Biol. Chem.
271:
8837-8842
|
| 67. | Hamilton, T.A., and J.A. Major. 1996. Oxidized LDL potentiates LPS-induced transcription of the chemokine KC gene. J. Leukocyte Biol. 59: 940-947 [Abstract]. |
| 68. | Claverie, J.-M., and W. Makalowski. 1994. Alu alert. Nature (Lond.). 371: 752 [Medline]. |
This article has been cited by other articles:
-Chemokine MDC and HIV-1 Infection. Science
281: 487a-487
-Chemokine MDC. Science
278: 695-698
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|