|
||
By
From the Laboratory of Molecular Immunology, Center for Neurologic Diseases, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts 02115
The frequency of clonally expanded and persistent T cells recognizing the immunodominant
autoantigenic peptide of myelin basic protein (MBP)p85-99 was directly measured ex vivo in
subjects with typical relapsing remitting multiple sclerosis (MS). T cells expressing mRNA
transcripts encoding T cell receptor (TCR)-
and -
chains found in T cell clones previously
isolated from these subjects recognizing the MBPp85-99 epitope were examined. In contrast to
frequencies of 1 in 105-106 as measured by limiting dilution analysis, estimates of the T cell frequencies expressing MBPp85-99-associated TCR chain transcripts were as high as 1 in 300. These high frequencies were confirmed by performing PCR on single T cells isolated by flow
cytometry. MBPp85-99 TCR transcripts were present in IL-2 receptor
-positive T cells
which were induced to undergo Fas-mediated cell death upon antigen stimulation. These data
demonstrate that at least a subpopulation of patients with MS can have a very high frequency of
activated autoreactive T cells.
Multiple sclerosis (MS)1 is a chronic inflammatory disease characterized by lymphocytic infiltration and demyelination in the central nervous system (CNS) thought
to be initiated by activated T cells recognizing myelin components of the CNS (1). T cells with high affinity receptors recognizing myelin basic protein (MBP) and proteolipid protein (PLP) are part of the normal T cell repertoire
and are present in the blood of MS patients as well as in
healthy individuals with comparable frequencies of 1 in ~105-106 T cells, as revealed by limiting dilution analysis
(LDA; 6-8). However, determination of the frequency of
antigen-specific T cells in LDA assays is based upon the
ability of these cells to proliferate in response to antigen.
Thus, estimated frequencies are confounded by the need to
grow short term T cell lines and do not allow detection of
antigen-specific T cells that respond to antigen by means of
cytokine production in the absence of proliferation (9).
Moreover, investigations using cloning techniques that preferentially allow the growth of activated T cells have
suggested that autoreactive T cells from MS patients are activated in vivo as compared to the autoreactive T cells from
normal individuals, and that the precursor frequencies of in
vivo activated T cells responding to MBP or PLP are in fact
higher in MS patients (10, 11). Thus, different T cell cloning strategies may influence the calculated frequency of autoreactive T cells.
The MBPp85-99 epitope is one of the immunodominant epitopes of MBP (6, 7, 12). We have previously determined the TCR sequences of clonally persistent MBPp8599-reactive T cells both in patients with MS and in normal
individuals (13). This enabled us to develop methods to directly estimate the frequency of MBPp85-99-reactive T cells
by measuring mRNA transcripts encoding the TCR- In contrast to frequencies of one in 105 to 106 as measured by LDA, estimates of the T cell frequencies expressing MBPp85-99 associated TCR chain transcripts were as
high as 1 in 300. MBPp85-99-associated TCR transcripts
were present in IL-2 receptor MBPp85-99-reactive T Cell Clones.
Investigations were approved
by the human subjects committee of the Brigham and Women's
Hospital (Boston, MA). MBPp85-99-reactive clones from the
subjects (two patients with relapsing remitting MS and two normal control subjects) were established previously and T cell receptor sequences published (13). In brief, amino acid TCR- PCR Amplification of TCR Chains.
mRNA extractions were
performed using the RNAzol B method (Teltest, Inc., Friendswood, TX). RNA was coprecipitated with 5 µg of tRNA (Sigma
Chemical Co., St. Louis, MO) in isopropanol overnight at Colony Hybridization.
PCR products were purified using PCR
purification system (Promega Corp.). Purified PCR reactions
were ligated into pCRII vectors (TA cloning system; Invitrogen,
San Diego, CA) in the presence of T4 ligase by incubation at
14°C overnight. 50 µl of competent bacteria (INV Specificity of Junctional Region Probes.
The probes bound exclusively to the sequences present in the original T cell clones.
cDNA from the original T cell clones were used to examine
probe hybridization conditions. The T cell clones Ob.1A12 and
Ob.2F3 from patient Ob differ by only three nucleotides in the N
region (one amino acid), sharing the same V DNA Sequence Analysis.
Bacterial colonies were expanded by
overnight culture in 3 ml of LB-ampicillin medium. Plasmids were
isolated using Magic minipreps as described by the manufacturer
(Promega Corp.). Double stranded DNA was sequenced using the
sequenase protocol (U.S. Biochem. Corp., Cleveland, OH) with
[35S]dATP as a radioactive tracer and the internal primer: 5 Culture of Whole Mononuclear Cells.
Whole mononuclear cells
(WMNC) were separated by a Ficoll gradient centrifugation, and
106 cells were incubated in 24-well plates with either native peptide MBPp85-99 (amino acid sequence ENPVVHFFKNIVTPR,
93K) or MBPp85-99 with amino acid substitutions at position 93 (93L, 93A, 93R, peptides synthesized by Biopolymer Laboratory,
Harvard Medical School) at a final concentration 10 µM, anti-CD3
mAb (OKT3, 1:1,000), or no stimuli in growth medium (RPMI
1640 medium supplemented with 10% autologous serum, 2 mM
L-glutamine, 10 mM Hepes 100 U/100 µg/ml penicillin/streptomycin; all from BioWhittaker Inc., Walkersville, MD). After 7 d,
cells cultured with MBP peptides were restimulated with 106 antigen-pulsed autologous blood WMNC prepared by incubating
autologous antigen-presenting cells with the appropriate peptide for
2 h followed by three washes in medium and irradiation (5,000 rads). On day 9, 10% IL-2 (Human T-Stim; Collaborative Biomedical Products, Bedford, MA) -containing medium was added to
each tube. On day 14, the cultures were harvested and mRNA was
extracted.
and
-
chains ex vivo in peripheral blood without in vitro manipulation. Moreover, the ability to directly measure frequencies of MBPp85-99-reactive T cells allowed us to functionally
examine the response of autoreactive T cells to antigen.
(IL-2R
)-positive T cells
which were induced to undergo Fas-mediated cell death upon antigen stimulation. These data demonstrate that measurements of T cell frequencies by short-term T cell cloning
and thymidine incorporation, as is used by LDA, do not allow for correct estimates of activated antigen-reactive T
cells. Additionally, at least a subpopulation of patients with
MS can have a very high frequency of activated autoreactive T cells.
and
-
chain junctional region sequences were as follows: patient Ob,
clone Ob.2F3 V
3.1-TDATSGTYKYIFGTGTRLKVLA-C
,
V
2.1-RDLTSGSLNEQFFGPGTRLTVL-C
; patient Hy, clone
Hy.1G11 V
3.1-TDTGGSYIPTFGRGTSLIVHP-C
, V
17.1TSGSYNEQFFGPGTRLTVL-C
, clone Hy.2B6 V
3.1-TDAGGQNFVFGPGTRLSVLP-C
, V
17.1-TDWSSYNEQFFGPGTRLTVL-C
, clone Hy.2E11 V
3.1-TDSGGSYIPTFGRGTSLIVHP-C
, V
4-PSGQGTYGYTFGSGTRLTVV-C
; control
Nb, clone Nb17.8 V
8-ASISDDMRFGAGTRLTVKP-C
, V
12YSPLGNEQFFGPGTRLTVL-C
; control Jl, clone NSJl5 V
18SGYNNNDMRFGAGTRLTVKP-C
, V
21-LTVGSYNEQFGPGTRLTVL-C
, clone NSJl 14.5 V
18-SGSNDYKLSFGAGTTVTVRA-C
, V
14-SSIPGQPQHFGDGTRLSIL-C
. The
third complementarity-determing region (CDR3) probes were named according to the first three amino acids in the NH2-terminal sequence of the junctional region.
20°C.
After washing with 70% ethanol, pellets were air dried and resuspended in double distilled (dd) H2O. First strand cDNA synthesis
was primed with oligo(deoxythimidine; dT) in 11 µl reaction and
the samples heated to 70°C for 10 min. 4 µl of 5× buffer, 2 µl
0.1M dithiothreithiol, and 1 µl each of 10 mM deoxynucleotide
triphosphate (dNTPs), 33 U of RNAsin, and 200 U of moloney
murine leukemia virus reverse transcriptase (all from Promega
Corp., Madison, WI) were then added. cDNA synthesis was carried
out at 42°C for 60 min, and ddH2O was added to a final volume
of 200 µl. 10 µl was used for each PCR. 50-µl PCR reactions contained 0.25 µg of forward and reverse primer, 1U of Taq polymerase, and 20 µl of a mix containing dNTPs and Taq buffer (Perkin-Elmer Corp., Branchburg, NJ). Amplifications were done for 35 cycles by using the following temperature profile: 94°C denaturation for 1 min, 60°C annealing for 2 min, and 72°C extension for
3 min with a final extension step at 72°C for 10 min. Sequences of primers were: V
3, 5
- GGA GTG TCT TTG GTG ATT
CTA TGG CTT CAA - 3
; V
8, 5
- CGA GCT TTA TTT
ATG TAC TTG TGG CTG CAG - 3
; V
18, 5
- TGT CAG
GCA ATG ACA AGG GAA GCA ACA AAG - 3
; C
reverse
primer, 5
- TTG TTG CTC CAG GCC ACA GCA CTG
TTG CTC - 3
; V
17.1, 5
- TTT CAG AAA GGA GAT ATA
GCT GAA GGG TAC - 3
; C
reverse primer, 5
- GGC AGA
CAG GAC CCC TTG CTG GTA GGA CAC -3
; C
internal
primer: 5
- TGT GCA CCT CCT TCC CAT TCA CCC ACC AGC - 3
; Amplified products were analyzed on 1% agarose gels stained with ethidium bromide.
F
; Invitrogen) were then transformed with ligation products and screened for
inserts on X-galactosidase-ampicillin containing luria broth (LB)
agar medium (GIBCO BRL, Gaithersburg, MD). After overnight
culture at 37°C, white colonies were transferred into 96-well flatbottom plates containing 200 µl LB medium with 50 mg/liter of
ampicillin. Plates were incubated for an additional 18 h at 37°C
and several replicas of each plate were made. DNA was bound to
nitrocellulose (GIBCO BRL) by standard procedures followed by
hybridization with the appropriate V
or CDR3 region-specific probes. Oligonucleotide probes were endlabeled with the use of
-32ATP and T4 polynucleotide kinase. Hybridizations were performed for 18 h at 37°C in a buffer containing 6 × SSC/0.05%
pyrophosphate/5× Denhardt/0.1mg/ml of denatured salmon
sperm DNA. After hybridizations filters were washed with 6 × SSC/0.05% pyrophosphate at 55-65°C and exposed on Kodak
film. TCR-
CDR3 probe sequences were: patient Ob, ObTDA 5
- ACG GAC GCA ACC TCA GGA ACC TAC AAA
TAC - 3
; patient Hy, Hy-TDA 5
- ACG GAC GCA GGA
GGT CAG AAT TTT GTC TTT - 3
, Hy-TDT 5
- ACG
GAT ACA GGA GGA AGC TAC ATA CCT ACC - 3
, HyTDS 5
- GCT ACG GAC TCA GGA GGA AGC TAC ATA - 3
; control Jl, Jl-SSI 5
- CTG AGT TCA ATT ATG GTG
GTG CTA CA - 3
, Jl-SGS 5
- G GCT CTG AGT GGT TCT
AAC GAC - 3
; control Nb, Nb-ASI 5
- TGT GCA GCA
AGT ATT AGT GAT GAC A - 3
. TCR-
CDR3 probe sequences were: patient Hy, Hy-TDW 5
- ACT GAC TGG AGC
TCC TAC AAT GAG CA - 3
, Hy-TSG 5
- ACT AGC GGC
TCC TAC AAT GAA CAG TTC TT - 3
.
3.1 and J
40 TCRs
(4). The probe specific for clone Ob.2F3 (Ob-TDA probe) hybridized to V
3.1 amplified cDNA from that T cell clone, but
did not crosshybridize to Ob.1A12, thus demonstrating the probe's
specificity. For patient Hy, two CDR3 region probes were designed; one hybridized exclusively to the CDR3 region with an
N
-J
region beginning with TDA (Hy-TDA probe), whereas the other probe was designed to hybridize to the CDR3 region with an N
-J
region beginning with TDT (Hy-TDT probe). This
latter probe crosshybridized to the CDR3 region from another MBP
reactive T cell clone sequence with an N
-J
region beginning with
TDS, which was a less frequently observed MBP-reactive T cell
clone in this patient. The CDR3 probes were specific for each patient as the probe from patient Ob did not hybridize with T cells
stimulated with MBPp85-99 from patient Hy and vice versa (data
not shown). The two Jl-SSI and Jl-SGS probes designed for identification of the different V
18-bearing clones of control Jl did
not crosshybridize, and the Nb-ASI probe for control Nb
MBPp85-99-reactive T cell clones similarly hybridized with the
appropriate TCR-
chain.
- CTT GTC ACT GGA TTT AGA GTC TCT CAG CTG - 3
for TCR-
chain and 5
- TGT GCA CCT CCT TCC CAT
TCA CCC ACC AGC - 3
for TCR-
chain.
Cell Staining and Sorting.
WMNC were incubated with mouse
anti-TCR V
17.1 chain mAb (clone E17.5F3; Immunotech,
Westbrook, ME) for 30 min at 4°C. Indirect staining was followed by incubation with goat anti-mouse IgG and IgM Fab
fragments conjugated with FITC (Tago Immunologicals, Camarillo, CA). Anti-CD3 mAb and mouse IgG (both a gift from Coulter Corp., Miami, FL) were used as positive and negative controls. V
17.1-positive and -negative populations were sorted on a
Coulter Sorter (type EPICS). For sorting IL-2R
-positive and
IL-2R
-negative T cell populations, WMNC were stained with
FITC-conjugated anti-IL-2R
mAb (Coulter Corp.).
Single-sided PCR Amplification.
The RNA pellet was resuspended in 18 µl of water and annealed with 15 µl oligo(dT) for
10 min at 70°C. cDNA synthesis was performed in a reaction containing 12 µl of 5× buffer, 6 µl of 0.1 M dithiothreithiol, 3 µl of
RNAsin, 5 µl of reverse transcriptase (all from Promega), and 3 µl of
dNTPs (Pharmacia, Uppsala, Sweden) for 1 h at 42°C. cDNA was
precipitated with 1/10 volume of 3 M ammonium acetate and
2 volumes of ethanol at
70°C. The cDNA pellet was washed in
70% ethanol and air dried. Aliquots of cDNA were homopolymer tailed with terminal deoxynucleotidyltransferase and deoxycytosine triphosphate. Second strand synthesis was carried out
using Taq polymerase and an oligo-(dG) primer (5
- GATAGTCGACGGGGGGGGGG - 3
).
Single Cell PCR.
Single TCR-V
17.1-expressing cells were
directly sorted onto V-bottom 96-well plates containing 150 µl of
PBS. Cells were then centrifuged and 5 µl of ddH2O was added
to each well followed by boiling for 5 min. First strand cDNA
synthesis was performed as described. The entire cDNA reaction
was used for the first 35 cycles of PCR with the V
3.1-specific
primer together with the C
-specific primer. 2 µl of amplification reaction was reamplified for the additional 35 cycles of PCR
with an internal C
primer (5
- CTT GTC ACT GGA TTT AGA
GTC TCT CAG CTG - 3
) and the same V
3.1-specific primer.
Spiking Experiment.
Increasing numbers of the T cell clone
Hy1G11 were spiked into 500,000 WMNC from peripheral
blood of subject Ob resuspended in 1.0 ml of RPMI. The mRNA
was extracted and the frequency of V
3 transformants hybridizing to the Hy-TDT probe was measured as described above. The
frequency of V
3-positive T cells was measured by anchor PCR as
described above. The expected versus the measured frequency of
T cells expressing the Hy CDR3-TDT were plotted.
We analyzed the TCR-
chain sequences of MBPp85-99-reactive
T cell clones isolated from the MS patients and normal
subjects. The MS patients chosen were those previously
shown to have clonally expanded and persistent MBPp8599-reactive T cells. The controls chosen had equal frequencies of MBPp85-99-reactive T cell clones, as measured
by LDA (13). The MBPp85-99-reactive T cell clones studied from the MS patients used V
3.1 chains, whereas V
18
and V
8 chains were used in the T cell clones from the controls. We measured the frequency of TCR-
sequences associated with MBPp85-99-reactive T cells directly in the
peripheral blood by PCR amplification of TCR-
chains
followed by subcloning and colony hybridization analysis.
Over 10,000 TCR-
transformants were screened for
binding of the V
- and CDR3-specific probes. Probes
were designed to bind the CDR3 coding regions of the
TCR-
chains under stringent hybridization conditions,
and the specificites of the probes were confirmed on the
original T cell clones. The CDR3 region probes were
named according to the first three amino acids in the NH2terminal sequence of the junctional region.
Using this approach, we could identify TCR-V
chains
expressed in MBPp85-99-reactive T cells in MS patients
(Table 1, Fig. 1 A). Specifically, the percentage of V
3.1positive transformants hybridizing with the Ob-TDA probe
was 0.8% of V
3.1 chains expressed in patient Ob; the percentages were 1.6% for probe Hy-TDA and 2.4% for probe
Hy-TDT of V
3.1 chains expressed in patient Hy (Table 1).
Repeated experiments measuring the percentage of transformants hybridizing with either probe over a two-yr time
interval yielded similar frequencies (Table 1). As expected,
there was no crosshybridization of Hy probes with Ob
transformants or of Ob probes with Hy transformants. The
sequencing of 20 transformants expressing a TCR-
chain
that hybridized to the Ob-TDA probe in patient Ob and
25 transformants that hybridized to either the Hy-TDA or
Hy-TDT probes in patient Hy, demonstrated the same
TCR-
sequence as that expressed in the original MBPreactive T cell clones. As expected, DNA from 20 random
transformants that did not hybridize to the CDR3 probes contained different TCR-
junctional region sequences. In
control subjects, after screening TCR-
transformants with
Jl-SSI and Jl-SGS probes for Jl and Nb-ASI probe for Nb,
we were unable to detect any sequences associated with recognition of MBPp85-99 in peripheral blood T cells (Table 1).
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3.1 transformants expressing the
CDR3 region sequence present in an MBPp85-99-reactive T cell clone
in MS patient Ob. (A) A representative experiment is shown, using mRNA
from peripheral blood lymphocytes. cDNA was synthesized and amplified
with V
3.1- and C
-specific primers. PCR products were ligated into
pCRII vectors and competent Escherichia coli were transformed with ligation products. Transformants were grown in 96-well plates and were transferred to nitrocellulose paper in duplicates. Blots were hybridized with either
V
3.1 probe (bottom) or a specific Ob-TDA probe recognizing TCRV
3.1 junctional region sequence expressed in a previously isolated
MBP-reactive T cell clone (top). (B) The same peripheral blood lymphocytes from subject Ob were stimulated with MBPp85-99 for 7 d, followed by restimulation with antigen-pulsed WMNC and, on day 9, the
addition of IL-2. On day 14, mRNA was extracted from the antigenstimulated T cells and the proportion of transformants hybridizing with the
Ob-TDA-specific probe after V
3.1 chain amplification was measured.
PCR Analysis of TCR Can Specifically Measure Clonal Expansion of Antigen-specific T Cells.
It was important to show
that the assay could specifically detect antigen-induced
clonal expansion of T cells. This necessarily required in
vitro rather than in vivo experiments where WMNC were stimulated either nonspecifically by cross-linking the TCR
with anti-CD3 mAb or with the specific antigen MBPp8599. 14 d after stimulation with MBPp85-99, the percentage
of TCR-V
3.1 transformants expressing junctional region
sequences present in the specific MBPp85-99-reactive T cell
clones studied went from 0.8 to 90.2% in patient Ob and
from a total of 4.0 to 86.4% in patient Hy for Hy-TDA and
Hy-TDT sequences combined (Fig. 1 B and Table 2 A). This
increase was antigen specific as it was not seen upon antibody-mediated CD3 cross-linking. In contrast, none of
the previously observed TCR-
sequences expressed in
MBPp85-99-reactive T cell clones were found in controls
Nb and Jl.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
A further control was performed to demonstrate the assay's specificity and sensitivity. WMNC were stimulated with
either MBPp85-99 or with analogue peptides substituted at
position 93, a TCR contact residue. We found that while
stimulation of WMNC with the native peptide induced
marked increases in clonal expansion of the T cells as measured by the assay, stimulation of WMNC with MBPp8599 with a single amino acid substitution markedly diminishes this expansion (Table 2 B). Interestingly, these data
with PCR amplification and colony hybridization of mRNA
isolated after stimulation of WMNC with the analogue peptides reflects experiments with in vitro culture of WMNC
with analogue peptides followed by T cell cloning. That is,
T cell clones generated with MBPp85-99 stimulation crossreacted with MBPp85-99 (93K
R) and (93K
L) peptides, but not (93K
A) peptides (14). Furthermore, TCR
sequences of the T cell clones that were found to be crossreactive with the MBPp85-99(93R) and MBPp85-99(93L)
peptides used the Hy-TDS sequence that was also detected
in this assay using PCR amplification, followed by colony hybridization. In total, these data demonstrate the very
high specificity of this assay in detecting antigen-specific
clonal expansion of peripheral blood T cells.
Assuming that each T cell expressing V
3.1 in the peripheral blood contributes equally to
the PCR amplification product using the V
3.1-C
primer
pairs, the frequency of transformants with the TCR-
sequence associated with MBPp85-99 reactivity should reflect
the frequency of circulating T cells expressing that TCR-
chain. To estimate the frequency of all T cells with the
TCR-
chain expressed in MBPp85-99-reactive T cells, it
was necessary to determine the proportion of T cells using
V
3.1 among all V
chains expressed. This was done by
amplifying TCR-
transcripts from WMNC using a modification of the rapid amplification of cDNA ends and anchored PCR methods. The percentage of V
3.1 chains among all TCR-
chains in unstimulated WMNC was 5.1%
in patient Ob and 8.1% in patient Hy. The frequency of circulating MBP-reactive T cells in unstimulated WMNC was
estimated by multiplying the frequency of V
3.1 among all
V
chains by the frequency of specific CDR3 sequences
expressed in the amplified TCR-V
3.1 chains associated with recognition of MBPp85-99 (Table 1). Thus, the estimated frequency of T cells recognizing MBPp85-99 in unstimulated WMNC of patient Ob was 3.9 × 10
4 and in
patient Hy 3.2 × 10
3 (1.3 × 10
3 for the Hy-TDA sequence, and 1.9 × 10
3 for the Hy-TDT sequence).
and -
Chains on T Cells Specific for
MBPp85-99.
A series of experiments were performed to
determine whether expanded clonotypes bearing Hy-TDA
or Hy-TDT sequences are paired exclusively with V
3.1
and V
17.1 chains as in the original MBPp85-99 reactive
clones. First, WMNC cultured for 14 d with MBPp85-99 were sorted into V
17.1-positive and V
17.1-negative populations, and examined for expression of V
3.1-Hy-TDA
or Hy-TDT sequences. The same frequencies of Hy-TDA
and Hy-TDT sequences in the V
17.1-positive population
(45.5% for TDA and 47.3% for TDT) and the unsorted population were observed, while there were no Hy-TDA-
or Hy-TDT-detectable sequences in the V
17.1-negative
population. These results indicated that after antigen stimulation, TCR-V
3.1 chain Hy-TDA and Hy-TDT sequences
associated with MBPp85-99 reactivity are paired only with
V
17.1 chains. Secondly, in the experiments using anchor PCR in which all V
chains were amplified, CDR3 probes
recognizing sequences present in the TCR-V
3.1 chains
of MBP reactive T cell clones from both patients Hy and
Ob did not hybridize with transformants that expressed different V
chains (data not shown), confirming that the
CDR3 sequences are only associated with the V
3.1 chains. Lastly, the definitive experiment to prove correct pairing of TCR-
and -
chains associated with MBPp85-99 reactivity before antigen stimulation required PCR amplification of both TCR-
and -
chains from T cells isolated
directly from peripheral blood at limiting dilution. Our attempts to simultaneously amplify V
17.1 chains from the
same single cell expressing V
3.1 Hy-TDA and Hy-TDT sequences were unsuccessful due to the lower efficiency of
the V
17.1-C
PCR despite multiple attempts to increase
the efficiency of the amplification procedure. However, this
analysis was successfully performed on V
17.1-positive
cells sorted by flow cytometry at 10 cells/well where the
corresponding TCR-
chain sequence identified in the
previously isolated MBP reactive T cell clones (V
17.1-TSG sequence identified in clone Hy.1G11) was found with the
V
3.1 Hy-TDT sequence in the same well. In total, these
data strongly suggest that there is predominantly correct
pairing of TCR-
and -
chains associated with MBPreactive T cells isolated directly from peripheral blood.
Chain Sequences.
A second approach was used to confirm the high frequencies of MBPp85-99-reactive T cells circulating in blood from subjects with MS. Single T cells expressing V
17.1 were sorted by
flow cytometry directly into single wells. PCR using seminested primers for the V
3.1 chains followed by probing
with Hy-TDA- and Hy-TDT-labeled probes was performed
on each individual mRNA sample extracted from a single
T cell. Out of a total of 192 wells with single V
17-positive T cells that were sorted by flow cytometry, 161 gave
an appropriate PCR product. 3 of the 161 single cells analyzed hybridized to the Hy-TDA probe and 1 hybridized
to the Hy-TDT probe (Table 3). The use of the correct
TCR-
chain in the Hy-TDT- or Hy-TDA-positive transformants was confirmed by sequencing. As 5.3% of the
T cells expressed V
17.1 as measured by flow cytometry, the
frequency of T cells expressing V
17.1 chains and TCR-
chain sequences found in MBPp85-99-reactive T cells was
calculated to be 1.3 × 10
3 (for Hy-TDA and Hy-TDT
sequences combined), comparable to the 3.2 × 10
3 calculated by examination of WMNC by PCR and colony hybridization (Table 4). In total, these data confirm the high
frequency of circulating MBPp85-99-reactive T cells and
exclude the possibility that this was secondary to increased
amounts of TCR mRNA transcripts in activated MBPp8599-reactive T cells or to preferential amplification of the
particular V
chain.
|
||||||||||||||||||||||||||||||
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
A third approach where MBP-reactive T cells were spiked into peripheral blood T cells from
another subject was used to confirm the high frequencies of
MBP-reactive T cells observed in the blood. Increasing numbers of the T cell clone Hy1G11 were spiked into 500,000 WMNC from peripheral blood of subject Ob, mRNA was
extracted, and the frequency of V
3 transformants hybridizing to the Hy-TDT probe measured. The frequency of
V
3-positive T cells measured by anchor PCR were multiplied by the percent of transformants that hybridized to
the Hy-TDT probe. A total of 795 V
3-positive transformants were analyzed at predicted frequencies between 2 × 10
6 and 2 × 10
2. The expected versus the measured frequency of T cells expressing the Hy CDR3-TDT were
plotted (Fig. 2). At predicted frequencies of 2 x 10
5, there
was no detectable hybridization to the 133 V
3 transformants examined. This likely represents the lower limit of
detection of the assay with examination of ~125 transformants. The assay was less precise at a predicted frequency
of 2 × 10
4 where sampling errors may occur; in this experiment, there were 2 of 187 positive transformants. Although at very high numbers of spiked T cell clones, the
assay may have slightly underestimated the frequency of
MBP-reactive T cells, at predicted frequencies of 2 × 10
3
MBP-reactive T cells, which we observed in peripheral
blood of MS patients, the measured frequency in the spiking assay was in close agreement (1.12 × 10
3).
3 transformants hybridizing to the Hy-TDT probe was measured and the expected versus the measured frequency of T cells expressing the Hy CDR3-TDT were plotted.
Fas-mediated Activation Induced Cell Death of IL-2R
+
MBP-reactive T Cells
There was an ~1,000-fold higher
frequency of MBP-reactive T cells calculated by direct PCR
and colony hybridization as compared to LDA and these
data are summarized in Table 4. The high frequency of
MBP-reactive T cells in the peripheral blood of the patients with MS as compared to the normal individuals was
puzzling considering that the frequency of T cells as calculated by LDA was similar. These data suggested that the
frequency of MBP-reactive T cells as calculated by LDA
was accurate in the normal subjects, but may have been
grossly underestimated in the patients with MS. On the basis of findings that activated cells are more prone to antigen-induced cell death (15), we hypothesized that subpopulations of autoreactive T cells in patients with MS may
express IL-2R
, and thus may undergo apoptosis in LDA
conditions leading to a lower calculated frequency. In this
regard, Pelfrey et al. have demonstrated that MBP-reactive
T cell lines from patients with MS are highly susceptible to
activation-induced cell death (16). The activation state of
MBPp85-99-reactive T cells could be examined by measuring the frequency of TCR-V
3.1 transformants obtained from IL-2R
-positive and -negative populations that hybridized to either the Hy-TDA or Hy-TDT probes. We
measured the distribution of Hy-TDA and Hy-TDT clonotypes in IL-2R
-positive and -negative populations on two
different time points, 3 mo apart. On the first time point
tested, we found increased frequency of Hy-TDA sequence in IL-2R
-positive population, whereas on the
second time point we could not detect any V
3.1 transformants expressing Hy-TDA sequence. In contrast, there was
an equal distribution of V
3.1 Hy-TDT sequence among
IL-2R
-positive and -negative populations on the two
time points tested (Table 5).
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
To determine whether self antigen could induce selective loss of autoreactive T cells, WMNC were cultured with
increasing concentrations of MBPp85-99 peptide and the
frequency of TCR-V
3.1 transformants hybridizing to either the Hy-TDA or Hy-TDT probes was measured before and after 72 h of culture. Note that the measurement of Hy-CDR3 frequencies before incubation with MBP were
performed from three separate cultures and represent both
IL-2R-positive and -negative populations. There was an
almost total loss of transformants expressing the Hy-TDT sequence, whereas no changes were observed in transformants
expressing the Hy-TDA sequence (Fig. 3, A and B). Interestingly, as described above, at this time point, Hy-TDA sequence was only found in IL-2R
-negative population.
Since it has been demonstrated that antigen stimulation of
activated T cells expressing IL-2R
induces apoptosis mediated by expression of Fas (CD95) and Fas ligand on the
T cell surface (17), we examined whether antigen stimulation of peripheral blood T cells in the presence of blocking anti-CD95 mAb selectively inhibited the loss of TCRV
3.1 Hy-TDT-expressing T cells. As shown in Fig. 3 B,
anti-CD95 mAbs totally blocked the MBPp85-99-induced
loss of transformants hybridizing to Hy-TDT probe while
having no effect on the frequency of Hy-TDA transformants. As T cells with the TCR-V
3.1-Hy-TDT sequence
expressed IL-2R
, these data indicate that the low frequency of MBPp85-99-reactive T cells as measured by
LDA was partly due to Fas-mediated apoptosis. The initiation of immunotherapy that altered the frequency of MBPreactive T cells precluded this analysis of activated T cells in
subject Ob.
3.1 transformants hybridizing
to Hy-TDA and Hy-TDT
probes was determined on day 0 (prestimulation) and after 72 h of
culture with 0, 0.5, 5, or 50 µM
MBPp85-99 either with control
antibody alone (1,000 ng/ml isotype control antibody), or with
500 ng/ml or 1,000 ng/ml of
anti-CD95 mAb (clone ZB4; Immunotech). (A) Frequency of
Hy-TDA-positive transformants
and (B) Hy-TDT-positive transformants. A total of 1,660 transformants were analyzed. The day 0 prestimulation values were 1.1%
for Hy-TDA transformants and
3.4% for Hy-TDT transformants.
We measured the frequency of clonally expanded and persistent T cells recognizing the immunodominant MBPp8599 epitope in subjects with typical relapsing remitting MS.
Single T cells expressing mRNA transcripts encoding TCR-
and -
chains found in T cell clones previously isolated
from these subjects recognizing the MBPp85-99 epitope
were examined. In contrast to frequencies of 1 in 105 to 106
as measured by LDA, estimates of the T cell frequencies expressing TCR chain transcripts associated with MBPp8599 recognition were as high as 1 in 300.
In retrospect, the high frequencies of MBPp85-99-reactive T cells with presumed chronic stimulation is perhaps not surprising. Subjects with HTLV-I and HIV infection have high frequencies of virus reactive T cells as measured ex vivo in peripheral blood using direct cytotoxicity assays (25- 27). In contrast, the LDA analysis of CTL frequencies in HIV-infected patients which requires T cell expansion leads to an 100-fold underestimate of CTL effector frequency. Since direct cytotoxicity measurements do not require cell growth, frequency measurements based on function would not be affected by antigen-induced apoptosis.
McMichael and co-workers used a similar assay as reported here to measure the frequencies of HIV gag-reactive T cells as calculated by PCR analysis of TCR chains of HIVspecific CTL clones. The frequency of HIV-reactive T cells using direct cytotoxicity assays was almost identical to that calculated by PCR, whereas the frequency as measured by LDA underestimated the frequency of HIV-reactive T cells (27). Moreover, the high frequency of HIV-reactive T cells as measured by PCR was confirmed using multimeric peptide-MHC complexes that bound antigen-specific T cells (28). Specifically, MHC class I-A2 tetramers with HIV gag or pol peptide were used to identify HIV specific CD8+ in seropositive donors. Flow cytometric analysis revealed a high frequency of antigen specific CD8+ cells (0.77%) that supported frequency estimation based on the PCR method. Moreover, the high frequencies of MBPp85-99-reactive T cells in the subjects with MS are similar to the frequencies of cytochrome C reactive T cells calculated in mice using direct PCR measurement after immunization with antigen (29, 30). Thus, the frequency of circulating MBP-reactive T cells in active MS patients appears to be on the same order of magnitude as that observed with both MHC class I- and II-restricted recall antigens.
The high frequency of MBP-reactive T cells may reflect
chronic stimulation of MBP-reactive T cells in the CNS. It
is also possible that repeated challenges by cross-reactive
microbes may induce selective T cell activation over time.
The MBP reactive T cell clones expressing different TCR-
chains had similar dose response curves to MBPp85-99, yet
exhibited markedly different fine specificities for peptides
with different TCR contact residues. Moreover, these
MBPp85-99-reactive T cell clones have been shown to
recognize different cross-reactive viruses (31). Since only one
of the MBPp85-99-reactive T cell populations was activated on a second time point tested, as measured by IL-2R
chain expression, these data suggest that at this time point,
the MBPp85-99-reactive T cells expressing the Hy-TDT
CDR3 sequence were activated by a cross-reactive antigen
and not the native MBPp85-99 sequence. Fluctuation of
the MBPp85-99-specific clone with a CDR3-TDA sequence among IL-2R
-positive and -negative populations over a
time of 3 mo could also support such a possibility. Use of
this approach to examine other subjects over longer periods
of time may allow the determination of events that lead to
the activation of autoreactive T cells in humans.
Culture of peripheral blood T cells with MBPp85-99 appeared to induce Fas-mediated apoptosis of activated T cells. In this regard, there was a modest, approximately threefold, increase in the frequency of MBPp85-99-reactive T cells as measured by LDA in preliminary experiments when cultured in the presence of anti-CD95 mAb. While this may partly explain the low frequency of antigen-reactive T cells as measured by LDA, clearly other factors may also play a role. For example, it is possible that subpopulations of MBPp8599-reactive T cells may represent regulatory T cells which are difficult to grow (32). Changes in culture conditions with the addition of other growth factors may also allow the expansion and measurement of greater numbers of circulating autoreactive T cells.
In interpreting these data, it is important to point out the limitations of extrapolating these data to all patients with MS. Sophisticated immunologic experiments in humans are greatly hampered by the outbred genotype of subjects. Thus, specific primers and probes for TCRs must be generated for each subject. Secondly, the patients with MS analyzed in these experiments were selected for further investigation because of previously demonstrated clonal expansion and clonal persistence of MBP-reactive T cells, and we do not believe that these data can be extrapolated to all subjects with the disease. The two normal subjects also had demonstrated the highest degree of clonal expansion observed in any of our control subjects, albeit not to the same degree as our subjects with MS (13). In fact, it is possible that MS is a heterogeneous disease where different myelin antigens are of importance in each individual. Nevertheless, these analyses of MBP-reactive T cells provide the first direct evidence for clonal expansion of MBP-reactive T cells in patients with MS and demonstrate that direct amplification of TCR chains can be used to quantitate circulating autoreactive T cells. Moreover, these data demonstrate that at least a subpopulation of patients with MS can have a very high frequency of activated autoreactive T cells which undergo Fas-mediated apoptosis upon antigen stimulation.
Address correspondence to Dr. David A. Hafler, Laboratory of Molecular Immunology, Brigham and Women's Hospital and Harvard Medical School, 221 Longwood Ave., Boston, MA 02115.
Received for publication 2 December 1996 and in revised form 21 February 1997.
1 Abbreviations used in this paper: CDR3, third-complementarity-determining region; CNS, central nervous system; dd, double distilled; dNTP, deoxynucleotide triphosphate; dT, deoxythimidine; IL-2R
, IL-2 receptor
; LB, luria broth; LDA, limiting dilution analysis; MBP, myelin basic
protein; MS, multiple sclerosis; PLP, proteolipid protein; WMNC, whole
mononuclear cells.
We would like to thank Drs. P. Höllsberg and A. Dressel for helpful discussions. The technical help of Jason Hafler is appreciated.
This work was supported by grants from the National Institutes of Health grant RO1-NS24247, Program Project grant AR 43220, and National Multiple Sclerosis Society grants. L.J. Ausubel is a Howard Hughes predoctoral fellow.
| 1. | Adams, R.D., and R.L. Sidman. 1968. Demyelinative diseases. In Introduction to Neuropathology. McGraw-Hill Inc., New York. 149-170. |
| 2. |
Prineas, J.W., and
C.S. Raine.
1976.
Electron microscopy
and immunoperoxidase studies of early multiple sclerosis lesions.
Neurology.
26:
29-32
|
| 3. | Prineas, J.W., and R.G. Wright. 1978. Macrophages, lymphocytes, and plasma cells in the perivascular compartment in chronic multiple sclerosis lesions. Lab. Invest. 38: 409-421 [Medline]. |
| 4. | Booss, J., M.M. Esiri, and W.W. Tourtellotte. 1983. Immunohistochemical analysis of T-lymphocyte subsets in the central nervous system in chronic progressive multiple sclerosis. J. Neurol. Sci. 62: 19-32 . |
| 5. | Hafler, D.A., and H.L. Weiner. 1995. Immunologic mechanisms and therapy in multiple sclerosis. Immunol. Rev. 144: 75-107 [Medline]. |
| 6. | Martin, R., D. Jaraquemada, M. Flerlage, J.R. Richert, J. Whitaker, E.O. Long, D.E. McFarlin, and H.F. McFarland. 1990. Fine specificity and HLA restriction of myelin basic protein-specific cytotoxic T cell lines from multiple sclerosis patients and healthy individuals. J. Immunol. 145: 540-548 [Abstract]. |
| 7. | Ota, K., M. Matsui, E.L. Milford, G.A. Mackin, H.L. Weiner, and D.A. Hafler. 1990. T-cell recognition of an immunodominant myelin basic protein epitope in multiple sclerosis. Nature (Lond.). 346: 183-187 [Medline]. |
| 8. |
Pette, M.,
K. Fujita,
D. Wilkinson,
D.M. Altmann,
J. Trowsdale,
G. Giegerich,
A. Hinkkanen,
J.T. Epplen,
L. Kappos, and
H. Wekerle.
1990.
Myelin autoreactivity in multiple sclerosis:
recognition of myelin basic protein in the context of HLA-DR2
products by T lymphocytes of multiple sclerosis patients and
healthy donors.
Proc. Natl. Acad. Sci. USA.
87:
7968-7972
|
| 9. |
Windhagen, A.,
D.E. Anderson,
A. Carrizosa,
R.E. Williams, and
D.A. Hafler.
1996.
IL-12 induces human T cells secreting IL-10 with IFN .
J. Immunol.
157:
1127-1131
[Abstract].
|
| 10. |
Allegretta, M.,
J.A. Nicklas,
J. Sriram, and
R.J. Albertini.
1990.
T cells responsive to myelin basic protein in patients
with multiple sclerosis.
Science (Wash. DC).
247:
718-721
|
| 11. |
Zhang, J.,
S. Markovic-Plese,
B. Lacet,
J. Raus,
H.L. Weiner, and
D.A. Hafler.
1994.
Increased frequency of interleukin
2-responsive T cells specific for myelin basic protein and proteolipid protein in peripheral blood and cerebrospinal fluid of
patients with multiple sclerosis.
J. Exp. Med.
179:
973-984
|
| 12. |
Ben-Nun, A.,
A.C. Liblau,
L. Cohen,
D. Lehmann,
E. Tournier-Lasserve,
A. Rosenzweig,
J.W. Zhang,
J.C. Raus, and
M.A. Bach.
1991.
Restricted T-cell receptor V gene
usage by myelin basic protein-specific T-cell clones in multiple sclerosis: predominant genes vary in individuals.
Proc.
Natl. Acad. Sci. USA
88:
2466-2470
|
| 13. | Wucherpfennig, K.W., J. Zhang, K. Witek, Y. Modabber, K. Ota, and D.A. Hafler. 1994. Clonal expansion and persistence of human T cells specific for an immunodominant myelin basic protein peptide. J. Immunol. 152: 5581-5592 [Abstract]. |
| 14. |
Wucherpfennig, K.W.,
A. Sette,
S. Southwood,
C. Oseroff,
M. Matsui,
J.L. Strominger, and
D.A. Hafler.
1994.
Structural requirements for binding of an immunodominant myelin basic protein peptide to DR2 isotypes and for its recognition by human T cell clones.
J. Exp. Med.
179:
279-290
|
| 15. | Wesselborg, S., O. Janssen, and D. Kabelitz. 1993. Induction of activation-driven death (apoptosis) in activated but not resting peripheral blood cells. J. Immunol. 150: 4338-4345 [Abstract]. |
| 16. | Pelfrey, C.M., L.R. Tranquill, S.A. Boehme, H.F. McFarland, and M.J. Lenardo. 1995. Two mechanisms of antigenspecific apoptosis of myelin basic protein (MBP)-specific T lymphocytes derived from multiple sclerosis patients and normal individuals. J. Immunol. 154: 6191-6202 [Abstract]. |
| 17. |
Alderson, M.R.,
T.W. Tough,
T. Davis-Smith,
S. Braddy,
B. Falk,
K.A. Schooley,
R.G. Goodwin,
C.A. Smith,
F. Ramsdell, and
D.H. Lynch.
1995.
Fas ligand mediates activationinduced cell death in human T lymphocytes.
J. Exp. Med.
181:
71-77
|
| 18. |
Critchfield, J.M.,
M.K. Racke,
J.C. Zuniga-Pflucker,
B. Cannella,
C.S. Raine,
J. Goverman, and
M.J. Lenardo.
1994.
T cell deletion in high antigen dose therapy of autoimmune
encephalitis.
Science (Wash. DC).
263:
1139-1143
|
| 19. |
Griffith, T.S.,
T. Brunner,
S.M. Fletcher,
D.R. Green, and
T.A. Ferguson.
1995.
Fas ligand-induced apoptosis as a
mechanism of immune privilege.
Science (Wash. DC).
270:
1189-1192
|
| 20. | Zheng, L., G. Fisher, R.E. Miller, J. Peschon, D.H. Lynch, and M.J. Lenardo. 1995. Induction of apoptosis in mature T cells by tumor necrosis factor. Nature (Lond.). 377: 348-351 [Medline]. |
| 21. | Ju, S.-T., D.J. Panka, H. Cui, R. Ettinger, E.-K. Maan, D.H. Sherr, B.Z. Stanger, and A. Marshak-Rothstein. 1995. Fas (CD95)/FasL interactions required for programmed cell death after T cell activation. Nature (Lond.). 373: 444-448 [Medline]. |
| 22. | Brunner, T., R.J. Mogil, D. LaFace, N.J. Yoo, A. Mahboubi, F. Echeverri, S.J. Martin, W.R. Force, D.H. Lynch, and C.F. Ware. 1995. Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature (Lond.). 373: 441-444 [Medline]. |
| 23. | Dhein, J., H. Walczak, C. Baumler, K.M. Debatin, and P.H. Krammer. 1995. Autocrine T-cell suicide mediated by Apo1/(Fas/CD95). Nature (Lond.). 373: 438-441 [Medline]. |
| 24. |
Lenardo, M.J..
1996.
Fas and the art of lymphocyte maintenance.
J. Exp. Med.
183:
721-724
|
| 25. | Jacobson, S., S. Hisatoshi, D.E. McFarlin, A.S. Fauci, and S. Koenig. 1990. Circulating CD8+ cytotoxic T lymphocytes specific for HTLV-1 pX in patients with HTLV-I associated neurological disease. Nature (Lond.). 348: 245-248 [Medline]. |
| 26. |
Elovaara, I.,
S. Koenig,
A.Y. Brewah,
R.M. Woods,
T. Lehky, and
S. Jacobson.
1993.
High human T cell lymphotropic virus type 1 (HTLV-1)-specific precursor cytotoxic T lymphocyte frequencies in patients with HTLV-1-associated neurological disease.
J. Exp. Med.
177:
1567-1573
|
| 27. |
Moss, P.A.H.,
S.L. Rowland-Jones,
P.M. Frodsham,
S. McAdam,
P. Giangrande,
A. McMicheal, and
J.I. Bell.
1995.
Persistent
high frequency of human immunodeficiency virus-specific
cytotoxic T cells in peripheral blood of infected donors.
Proc.
Natl. Acad. Sci. USA.
92:
5773-5777
|
| 28. |
Altman, J.D.,
P.A.H. Moss,
P.J.R. Goulder,
D.H. Barouch,
M.G. McHeyzer-Williams,
J.I. Bell,
A.J. McMicheal, and
M.M. Davis.
1996.
Phenotypic analysis of antigen-specific T
lymphocytes.
Science (Wash. DC).
274:
94-96
|
| 29. | Cochet, M., C. Pannetier, A. Regnault, S. Darche, C. Leclerc, and P. Kourilsky. 1992. Molecular detection and in vivo analysis of the specific T cell response to a protein antigen. Eur. J. Immunol. 22: 2639-2647 [Medline]. |
| 30. |
McHeyzer-Williams, M.G., and
M.M. Davis.
1995.
Antigenspecific development of primary and memory T cells in vivo.
Science (Wash. DC).
268:
106-111
|
| 31. | Wucherpfennig, K.W., and J.L. Strominger. 1995. Molecular mimicry in T cell-mediated autoimmunity: viral peptides activate human T cell clones specific for myelin basic protein. Cell. 80: 695-705 [Medline]. |
| 32. |
Fukaura, H.,
S.C. Kent,
M.J. Pietrusewicz,
S.J. Khoury,
H.L. Weiner, and
D.A. Hafler.
1996.
Induction of circulating myelin basic protein and proteolipid protein-specific transforming growth factor- 1-secreting Th3 T cells by oral administration of myelin in multiple sclerosis patients.
J. Clin. Invest.
98:
70-77
[Medline].
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|