|
||
By
From the Michael Heidelberger Division of Immunology, Department of Pathology and Kaplan Comprehensive Cancer Center, New York University Medical Center, New York 10016
T cell costimulation, particularly by the B7 family members B7-1 and B7-2, plays a critical role in regulating T cell-mediated immunity. Two molecules on T cells, CD28 and CTLA-4, are known to bind to B7. It has been suggested that CD28-B7 interaction promotes T cell response, whereas B7-CTLA-4 interaction downregulates T cell clonal expansion. However, the proposed responses of individual receptors to B7 have not been verified directly. Here, we report that B7-1 promotes clonal expansion of CD28-deficient T cells, and that the CD28-independent costimulatory activity is mediated by CTLA-4, as it is completely blocked by intact and Fab of anti-CTLA-4 mAb. In addition, a mutant B7-1 molecule, B7W88 >A, which has lost binding to CD28 but retained significant CTLA-4 binding activity, promotes T cell clonal expansion. Furthermore, while presence of CD28 enhances T cell response to B7-1, such response is also completely blocked by anti-CTLA-4 mAb. Taken together, our results demonstrate that B7-CTLA-4 interaction promotes T cell clonal expansion, and that optimal T cell response to B7 is achieved when both CD28 and CTLA-4 interact with B7. These results establish an important function of CTLA-4 in promoting T cell activation, and suggest an alternative interpretation of the function of CTLA-4 in T cell activation.
Cell surface costimulatory molecules, of which B7 family members are known as prototypes, play an important role in T cell responses (1). Two T cell surface molecules, CD28 and CTLA-4, bind B7 with different affinity
(5). Most T cells can express both receptors, although their
expression appears to be differentially regulated (9). In
addition, both receptors may initiate signal transduction, as
they are associated with an overlapping but perhaps distinct
set of molecules involved in regulating cell growth (12). However, the function of the individual receptors is still
unclear.
It has been proposed that B7-CD28 interaction delivers
a positive signal, whereas B7-CTLA-4 interaction delivers
a negative signal for T cell responses (9, 10). This hypothesis
is based on two lines of evidence. First, targeted mutation
of CTLA-4 causes lethal lymphoproliferative disease (18,
19). Second, depending on experimental models, anti-
CTLA-4 mAbs either enhance or inhibit T cell clonal expansion (9, 10, 20, 21) in vitro; and in vivo, both intact and
Fab fragments of anti-CTLA-4 mAbs enhance T cell response and tumor rejection (22). However, the proposed inhibitory function of B7-CTLA-4 interaction has
not been directly demonstrated.
If B7-CTLA-4 interaction delivers a negative signal for
T cell growth, T cell response in CD28-deficient mice
should be enhanced when the function of B7 is blocked.
However, a study by Green et al. (25) using CD28-deficient T cells has not revealed an enhancement by CTLA-4Ig.
In this study, we reevaluated the effect of B7-CTLA-4 interaction on T cell clonal expansion. Our results demonstrate that this interaction is sufficient to costimulate clonal
expansion of T cells, and that optimal T cell response to
B7-1 requires cooperation of CD28 and CTLA-4.
Experimental Animals, mAbs, and Fusion Proteins.
C57BL/6 mice
were purchased from the National Cancer Institute (Rockville,
MD). CD28-deficient mice (26), backcrossed to C57BL6j for six
generations, were provided by Dr. T.W. Mak (University of
Toronto, Canada).
Transfection of COS and Chinese Hamster Ovary Cells. COS cells were transfected with wild-type and mutant B7-1 molecules by DEAE-dextran methods, as has been described (33). The procedure for Chinese hamster ovary (CHO)1 cell transfection has also been described (34).
Flow Cytometry. Expression of wild-type and mutant B7-1 was determined by flow cytometry using anti-B7-1 mAbs, either 16.10A1, or 3A12, as primary antibody, and FITC-labeled goat anti-hamster IgG was used as second-step reagent, as has been described. Fusion proteins, either CD28Ig or CTLA-4Ig, were used as first-step reagents. The binding to wild-type and mutant B7-1 was determined by using FITC-labeled goat anti-mouse IgG as second-step reagents.
Proliferation Assay. CD4 T cells were purified from spleen cells as described (35). The purity of CD4 T cells isolated was >95%. Given numbers of the CD4 T cells were stimulated with anti-CD3 mAb (0.25 µg/ml) using mitomycin C (100 µg/ml, 37°C for 1 h)-treated CHO cells transfected with either FcR (CHOFcR) or FcR plus murine B7-1 (CHOFcRB7). The cultures were maintained for 42 h, and were pulsed with [3H]TdR (1.25 µCi/ well) for an additional 6 h. The cultures were then harvested and the [3H]TdR incorporated into the genomes was determined by a betaplate counter. The blocking mAbs were added at the beginning of the culture. The data presented are means of duplicates with variation <15% of the mean.
In some experiments, CD4 T cells were separated based on their cell surface expression of CD45RB. In brief, CD4 T cells were incubated with anti-CD45RB mAb C363.16A (5 µg/ml) for 1 h at 4°C; the unbound antibodies were washed away. After adding DYNAL beads coated with goat anti-rat Ig for 1 h, the cells that bound to C363.16A were collected by magnet. The cells bound to the beads were eluted by adding 2 mg/ml of normal rat Ig at 37°C for 1 h and used as naive cells. The cells that did not bind DYNAL beads in the first place were depleted once more with DYNAL beads and used as memory cells. The CD45RB profiles were determined by flow cytometry using either C363.16A (CD45RB) or medium (control) as the first-step reagent and FITC-labeled mouse anti-rat Ig as second-step reagent.Site-directed Mutagenesis. Site-directed mutagenesis of murine B7-1 was achieved by PCR using oligonucleotides carrying the desired mutations. B7Y that carries a mutation from Y >A at position 201 has been described (32). Mutant B7W (W >A at position 88) was created as follows. A B7-1 fragment containing the desired mutation was produced by PCR using GCTCGAGAAGCTTATGGCTTGCAATTGTCAG as forward primer, and CTTAGCCTCGGGCGCCAC TTTTAGTTTCCC as reverse primer. After digestion by AvaI, the PCR product was ligated to the AvaI-XbaI fragment of murine B7-1 (32). B7L (L109 >A) was created by a two-step PCR. First, a mutant B7-1 fragment containing the desired mutation (L >A) is generated using GCTCGAGAAGCTTATGGCTTGCAATTGTCAG as forward primer, and CGACGCAGCTGTAGGTGCCCCGGTCGCTAGCGACCAGGC as reverse primer; another fragment covering the remaining sequence of B7-1 open reading frame is amplified using CACCTACAGCTGCGTCGTTCAAAAGAAGGA as forward primer and CGAATTCTAGAACTAAAGGAAGACGGTCT as reverse primer. Second, a mixture of the two B7-1 fragments were used as template to amplify the full-length B7-1 mutant; GGCTCTAGATTCCTGGCTTTCCCCATCATG was used as forward primer and GTCAGCCATCTCGAGTTTTTCCCAGGTGAAGTC was used as reverse primer. The PCR condition has been described (32).
To examine the function of CD28 and CTLA-4, we compared
wild-type and CD28-deficient T cells in their response to
costimulation by B7 in vitro. We produced CHO cells
transfected with either FcR (CHOFcR), which cross-links
anti-CD3 mAb on T cell surface, or FcR in conjunction
with murine B7-1 (CHOFcRB7) (23), and tested their costimulatory activity for clonal expansion of CD4 T cells
from wild-type and CD28(
/
) mice. As expected, wildtype CD4 T cells respond to costimulation by B7-1 (Fig. 1 a).
Surprisingly, T cells from CD28-deficient mice also mount
a positive response to B7-1, although the response is approximately fivefold lower than that of wild-type T cells
(Fig. 1 b). The critical role of B7-1 is confirmed, as an anti-
B7-1 mAb 3A12 (29) significantly blocks responses of wildtype and CD28-deficient T cells. In addition, CD4 T cells
from wild-type and CD28-deficient mice bearing naive or
memory markers both respond positively to costimulation
by B7-1 (Fig. 2). These results demonstrate that B7-1 can
costimulate T cell clonal expansion by a CD28-independent mechanism.
/
) mice to soluble anti-CD3 using CHO cells transfected with
either FcR or FcR plus murine B7-1 as accessory cells.
Contribution of CTLA-4 to B7-1-mediated Costimulation.
To verify the contribution of CTLA-4, we tested whether
an anti-CTLA-4 mAb affects the function of B7-1. We prepared Fab of the mAb by papain digestion and depletion of
Fc-containing immunoglobulin. As shown in Fig. 3, in
SDS-PAGE under reducing conditions, intact mAb preparation consists of two peptides of ~50 kD and ~28 kD, the
respective molecular masses of the heavy and light chain of IgG. Fab preparation run as one band of ~28 kD, which
indicate that the Fab used for the study is free of detectable
intact Ig. As shown in Fig. 4, the anti-CTLA-4 mAb 4F10
completely blocks the function of B7-1. This blocking
does not require cross-linking of CTLA-4, as the Fab fragment of the mAb also blocked the function of T cells. Surprisingly, both intact and Fab fragment of anti-CTLA-4 mAb inhibit response of CD28(+/+) T cells. The ability
of both intact and Fab of anti-CTLA-4 mAb 4F10 to block
the function of wild-type T cells indicates that CTLA-4 is
critically involved in B7-1-mediated costimulation for wildtype T cells.
A potential caveat of this interpretation is that anti-
CTLA-4 may negatively signal T cells and thus prevent
T cell clonal expansion regardless of the presence of B7-1.
To rule out this possibility, we tested whether anti-CTLA-4
mAb inhibits T cell response to costimulation by CD44H,
which we recently identified as a CD40L-induced costimulatory molecule that promotes T cell clonal expansion by
a CD28-independent mechansim (36). As shown in Fig. 5,
anti-CTLA-4 mAb 4F10 does not inhibit clonal expansion of T cells when CHO cells expressing murine CD44H are
used as costimulator. These results confirm that anti-
CTLA-4 mAb is a specific inhibitor of T cell response to
costimulation by B7-1.
/
) (d-f, 105/well) CD4 T cells were stimulated
with anti-CD3 mAb and CHO cells (mitomycin C-treated, 3,000/well) transfected with either FcR, FcR plus B7-1 (FcRB7), or FcR plus CD44H
(FcRCD44H) for 48 h in the presence of control mAb HB224, anti-B7-1 mAb 10.16A, and anti-CTLA-4 mAb 4F10. (a and d) Proliferation of wildtype and CD28(
/
) T cells to anti-CD3 in the presence of CHOFcR, CHOFcRB7, and CHOFcR CD44H. Note that twice as many CD28(
/
)
CD4 T cells were used to ensure a comparable total proliferative response. (b and e) Lack of inhibition by anti-CTLA-4 mAb when CD44H was used as
costimulator. (c and f ) Inhibition by anti-B7-1 and anti-CTLA-4 when B7-1 was used as costimulators.
Functional Analysis of B7-1 Mutant Supports CTLA-4 as a Positive Regulator for T Cell Clonal Expansion.
Anti-CTLA-4
mAbs show different effects on T cell proliferation depending whether costimulation is provided by anti-CD28 or by
antigen-presenting cells (9, 10, 20). To avoid any question that may be associated with antibody blocking studies, we have carried out a systematic site-directed mutagenesis
of B7-1 molecules in both IgC-like (32) and IgV-like domains in search of a mutant B7 that retains binding for
CTLA-4 but not CD28. As shown in Fig. 6 a, saturating
amount of CTLA-4Ig binds B7W, which carries a mutation from W to A at position 88 of B7-1 (number starts at
the first methionine encoded by B7-1 cDNA), at levels
comparable to those of wild-type B7, although careful titration of CTLA-4Ig reveals that it takes about ninefold more CTLA-4Ig to achieve such saturation for B7W (Fig. 6 c). In
contrast, B7W does not bind CD28Ig (Fig. 6 b). Mutant
B7 L109 >A (B7L), which binds CTLA-4Ig less well than
B7W, binds CD28 even better than wild-type B7-1. On
the other hand, mutant B7Y, which has a mutation at position 201 from Y to A, does not show detectable binding to
either CD28Ig or CTLA-4Ig, as we have reported (32). These results demonstrate that B7-1 is recognized by the
two receptors asymmetrically, and the selective loss of CD28
binding activity in B7W cannot be accounted for simply on
the basis of low avidity of CD28-B7 interaction. The preferential effect of B7W >A mutation on CD28 binding is
consistent with an earlier mutagenesis analysis involving
human B7-1 expressed on fibroblasts (37), although it is apparently at variance with mutagenesis analysis using recombinant human B7-1 fusion protein (38), perhaps owing to
differential glycosylation of B7-1.
MFmock) × k, where k = (MFmutant
MFmock) / (MFWT
MFmock)
when anti-B7-1 mAb 10.16A is used to measure cell surface expression of wild-type or mutant B7-1. Representative of three independent experiments.
Therefore, we transfected B7-1, B7W, and B7Y into
CHOFcR cells, and produced stable cell lines expressing
comparable levels of FcR and wild-type or mutant B7-1
(Fig. 7 a). These cell lines were used to determine the receptors responsible for the costimulatory activity of B7-1.
As shown in Fig. 7 b, both wild-type and CD28-deficient T cells respond to costimulation by wild-type B7-1 and
B7W, but not to that by B7Y. Thus, CTLA-4 binding activity is sufficient to costimulate T cell proliferation. Moreover, wild-type T cells respond to B7-1 significantly better
than to B7W, as ~20-fold more CHO cells expressing B7W
are required to achieve a level of T cell proliferation similar
to that costimulated by wild-type B7-1. This difference is
diminished when CD28(
/
) CD4 T cells are used, thus
confirming the inability of B7W to stimulate CD28. The
function of B7W is blocked by anti-B7-1 and anti-CTLA-4
mAbs (Fig. 8).
/
) (c) T cells. Wild-type and CD28-deficient CD4 T cells were stimulated
with anti-CD3 mAb and 104/well of mitomycin C-treated CHO cells. Data presented are representatives of three independent experiments.
CTLA-4 plays an important role in regulating T cell function, as evidence by the phenotypes of CTLA-4-deficient mice (17, 18) and by the effect of anti-CTLA-4 mAbs (9). The biological consequences of B7-CTLA-4 interactions have not been studied in detail. Here we seek to measure directly the effect of B7-CTLA-4 interaction on T cell clonal expansion. Our results demonstrate that B7-CTLA-4 interaction is sufficient to induce T cell clonal expansion in vitro.
First, T cells from CD28-deficient mice react to costimulation by B7-1, although the proliferative response is generally 5 to 10-fold lower than wild-type T cells. This response
is mediated by CTLA-4 on T cells, because anti-CTLA-4
mAb, either intact or Fab, blocks B7-1-dependent T cell
proliferation. Surprisingly, in numerous experiments, anti-
CTLA-4 mAb also completely inhibit B7-1-mediated proliferation of wild-type T cells. Because this mAb does not
interfere with T cell proliferation when CD44H is used as
costimulator (Fig. 5), it is unlikely that this mAb inhibits T
cell response to B7-1 by negative signaling. These results
suggest that B7-CD28 interaction may not be sufficient to
promote T cell proliferation. This is paradoxical, given the
fact that anti-CD28 mAb used as the prototypic costimulator for T cell clonal expansion (39), although it has not
been demonstrated whether B7-CD28 interaction is sufficient to costimulate T cell proliferation. Because anti-CD28
mAb 9.3 has ~100-fold higher avidity than B7-1Ig for
CD28 (7), this paradox can be reconciled by higher avidity of the anti-CD28 mAb. It should be noted that in an earlier
report, Green et al. (25) failed to detect CD28-independent function of B7-1 in promoting T cell clonal expansion
in the presence of PMA. This difference can be explained
by possible lack of expression of CTLA-4 in the CD28(
/
)
cells used by Green et al. Alternatively, our assay based on
copresentation of TCR ligand and costimulator B7-1 on
the same cells (44) is ~20-fold more sensitive than the earlier study; the difference can be reconciled on the basis of
sensitivity of the assays.
Second, mutant B7-1, B7W, which lacks detectable CD28
binding activity, promotes proliferation of both wild-type
and CD28-deficient T cells. For better quantitation, we
measured CD28 binding using fusion protein CD28Ig. However, our preliminary data indicated that CD28 expressed
on CHO cells as a transmembrane protein also fail to mediate adhesion to B7W (data not shown), much like human B7-1 with a mutation of the corresponding amino acid (37).
Furthermore, while mutant B7W stimulates wild-type T cells
less well than wild-type B7-1, it is comparable to wild-type
B7-1 if CD28(
/
) T cells are used as responder. Thus,
the major functional difference between B7W and wildtype B7-1 is in their interaction with CD28. Our functional analysis of B7-1 mutant indicates that B7-CTLA-4
binding is sufficient to costimulate wild-type and CD28deficient T cells. The use of B7-1 mutants allows us to dissect the function of CTLA-4 without the caveats of anti-
CTLA-4 mAb.
A recent study suggests that another yet unidentified receptor for B7 may exist on NK cells (45). An intriguing question is whether the CD28-independent response to B7-1, as reported here, is mediated by a yet unidentified receptor for B7-1. Although it is impossible to rule out a possible contribution of other unknown receptors, CTLA-4 is at least an essential part of the signaling complex, because the CD28-independent function of B7-1 is completely blocked by anti-CTLA-4 mAb.
Taken together, our results presented in this report demonstrate that B7-CTLA-4 interaction promotes T cell clonal expansion. Moreover, optimal costimulation by B7 requires both CD28 and CTLA-4, as has been proposed by Linsley et al. (11). The mechanism of the cooperation between CD28 and CTLA-4 is still unclear at the present. B7-CD28 interaction may be critical for enhancing IL-2 production. Thus, it has been reported that CD28 deficiency leads to a drastic reduction in IL-2 production (25, 26, 37). Our analysis of IL-2 production in CD28-deficient T cells (data not shown) also supports this concept. In addition, mutant B7W, which bind CTLA-4 but not CD28, promotes T cell clonal expansion but barely enhances IL-2 production (data not shown). Therefore, unlike CD28-B7 interaction, CTLA-4-B7 interaction may not enhance T cell response by increasing the production of IL-2. Our results are inconsistent with the notion that CTLA-4 is a negative regulator for T cell activation, although it is conceivable that CTLA-4 may downregulate T cell activation on other circumstances. Several important factors, such as expression and cellular localization of CTLA-4 may influence the function of CTLA-4. Although it is clear that the expression and cellular expression of CTLA-4 is under stringent control (47), the regulatory mechanisms are not well understood. This lack of knowledge has made it difficult to predict the function of CTLA-4 under physiological conditions.
Several recent studies have shown that anti-CTLA-4 mAbs can be potent enhancers of immune response to defined foreign antigen, self-antigens, and tumors (22). Although these results were interpreted in the light of blocking negative signal from CTLA-4, it is also possible that these results are achieved by enhancing positive signal transduction from CTLA-4. The mutant B7-1 molecules described in this study may help to resolve the function of CTLA-4 in vivo. The answer to this question will be critical for immune intervention targeted at CTLA-4, as it will determine whether signal transduction initiated by CTLA-4 should be amplified or inhibited.
Address correspondence to Dr. Yang Liu, Michael Heidelberger Division of Immunology, Department of Pathology and Kaplan Comprehensive Cancer Center, New York University Medical Center, 550 First Avenue, New York, NY 10016.
Received for publication 19 November 1996 and in revised form 10 February 1997.
This study is supported by grants from the National Institutes of Health (CA58033 and CA69016) and the Council for Tobacco Research, USA.We thank Dr. Tak Mak for CD28-deficient mice, Dr. Jeff Bluestone for anti-CTLA-4 monoclonal antibody, Dr. Stan Vukmanovic for critical reading of the manuscript, and John Hirst for assistance in flow cytometry.
| 1. |
Brestcher, P., and
M. Cohn.
1970.
A theory of self-nonself
discrimination.
Science (Wash. DC).
169:
1042-1049
.
|
| 2. | Lafferty, K.J., S.J. Prowse, C.J. Simeonovich, and H.S. Warren. 1983. Immunobiology of tissue transplantation: a return to passenger leukocyte concept. Annu. Rev. Immunol. 1: 143-173 [Medline]. [Medline] |
| 3. | Mueller, D.L., M.K. Jenkins, and R.H. Schwartz. 1989. Clonal expansion vs functional clonal inactivation: a costimulatory signalling pathway determines the outcome of T cell antigen occupancy. Annu. Rev. Immunol. 7: 445-480 [Medline]. [Medline] |
| 4. | Liu, Y., and P.S. Linsley. 1992. T cell costimulation. Curr. Opin. Immunol. 4: 265-270 [Medline]. [Medline] |
| 5. |
Linsley, P.S.,
E.A. Clark, and
J.A. Ledbetter.
1990.
The T
cell antigen, CD28, mediates adhesion with B cells by interacting with the activation antigen B7.
Proc. Natl. Acad. Sci.
USA.
87:
5031-5035
[Medline].
|
| 6. |
Linsley, P.S.,
W. Brady,
L. Grosmaire,
A. Aruffo,
N.K. Damle, and
J.A. Ledbetter.
1991.
Binding of the B cell activation antigen B7 to CD28 costimulates T cell proliferation
and interleukin-2 mRNA accumulation.
J. Exp. Med.
173:
721-730
[Medline].
|
| 7. |
Linsley, P.S.,
W. Brady,
L. Grosmaire,
N.K. Damle, and
J.A. Ledbetter.
1991.
CTLA-4 is a second receptor for B cell activation antigen B7.
J. Exp. Med.
174:
561-569
[Medline].
|
| 8. | Linsley, P.S., J.L. Green, W. Brady, J. Bajorath, J.A. Ledbetter, and R. Peach. 1994. Human B7-1 (CD80) and B7-2 (CD86) binds with similar avidity but distinct kinetics to CD28 and CTLA-4 receptors. Immunity. 1: 793-801 [Medline]. [Medline] |
| 9. | Walunas, T.L., D.J. Lenchow, C.Y. Bakker, P.S. Linsley, G.J. Freeman, J.M. Green, C.B. Thompson, and J.A. Bluestone. 1995. CTLA-4 can function as a negative regulator of T cell activation. Immunity. 1: 405-414 . |
| 10. |
Krummel, M.F., and
J.P. Allison.
1995.
CD28 and CTLA-4
have opposing effects on the response of T cells to stimulation.
J. Exp. Med.
182:
459-466
[Medline].
|
| 11. |
Linsley, P.S.,
J.A. Green,
P. Tan,
J. Bradshaw,
J.A. Ledbetter,
C. Anasetti, and
N.K. Damle.
1992.
Co-expression and functional co-operation of CTLA-4 and CD28 on activated T
lymphocyte.
J. Exp. Med.
176:
1595-1604
[Medline].
|
| 12. | Pages, F., M. Ragueneau, R. Rottapel, A. Truneh, J. Nunes, J. Imbert, and D. Olive. 1994. Binding of phosphatidylinositol-3-OH kinase to CD28 is required for T cell signalling. Nature (Lond.). 369: 327-329 [Medline]. [Medline] |
| 13. |
August, A., and
B. DuPont.
1994.
CD28 of T lymphocytes
associates with the phosphatidylinositol-3-OH kinase.
Int.
Immunol.
6:
769-774
[Medline].
|
| 14. |
Prasad, K.V.,
Y.C. Cai,
M. Raab,
B. Dukeworth,
L. Cantley,
S.E. Shoelson, and
C.E. Rudd.
1994.
T cell antigen CD28
interacts with the lipid kinase phosphatidylinositol-3-OH kinase by a cytoplasmic Tyr (p)-Met-Xaa-Met motif.
Proc.
Natl. Acad. Sci. USA.
91:
2834-2838
[Medline].
|
| 15. |
Truitt, K.E.,
C.M. Hicks, and
J.B. Imboden.
1994.
Stimulation of CD28 triggers an association of between CD28 and
phosphatidylinositol-3-OH kinase in Jurkat T cells.
J. Exp.
Med.
179:
1071-1076
[Medline].
|
| 16. |
Schneider, H.,
Y.C. Cai,
K.V.S. Pradad,
S.E. Shoelson, and
C.E. Rudd.
1995.
CTLA-4 binding to the lipid kinase phosphatidylinositol 3-kinase in T cells.
J. Exp. Med.
181:
351-355
[Medline].
|
| 17. | Marengere, L.E., P. Waterhouse, G.S. Duncan, H.W. Mittrucker, G.S. Feng, and T.W. Mak. 1996. Regulation of T cell receptor signaling by tyrosine phosphatase SYP association with CTLA-4. Science (Wash. DC). 272: 1170-1173 [Medline]. [Abstract] |
| 18. |
Waterhouse, P.,
J.M. Penninger,
E. Yimms,
A. Wakeham,
A. Shahinian,
K.P. Lee,
C.B. Thompson,
H. Griesser, and
T.W. Mak.
1995.
Lymphoproliferative disorders with early lethality
in mice deficient in CTLA-4.
Science (Wash. DC).
270:
985-987
[Medline].
|
| 19. | Tivol, E.A., F. Borriello, A.N. Schweitzer, W.P. Lynch, J.A. Bluestone, and A.H. Sharpe. 1995. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity. 3: 541-547 [Medline]. [Medline] |
| 20. |
Krummel, M.F., and
J.P. Allison.
1996.
CTLA-4 engagement inhibits IL-2 accumulation and cell cycle progression
upon activation of resting T cells.
J. Exp. Med.
183:
2533-2540
[Medline].
|
| 21. |
Walnunas, T.L.,
C.Y. Bakker, and
J.A. Bluestone.
1996.
CTLA-4-ligation blocks CD28-dependent T cell activation.
J. Exp. Med.
183:
2541-2550
.
|
| 22. | Kearney, E.R., T.L. Walunas, R.W. Karr, R.A. Morton, D.Y. Loh, J.A. Bluestone, and M.K. Jenkins. 1995. Antigen-dependent clonal expansion of a trace population of antigen-specific CD4+ T cells in vivo is dependent on CD28 costimulation and inhibited by CTLA-4. J. Immunol. 155: 1032-1036 [Medline]. [Abstract] |
| 23. |
Karandikar, N.J.,
C.L. Vanderlugt,
T.L. Walunas,
S.D. Miller, and
J.A. Bluestone.
1996.
CTLA-4: a negative regulator of autoimmune disease.
J. Exp. Med.
184:
783-788
[Medline].
|
| 24. | Leach, D.R., M.F. Krummel, and J.P. Allison. 1996. Enhancement of antitumor immunity by CTLA-4 blockade. Science (Wash. DC). 271: 1734-1736 [Medline]. [Abstract] |
| 25. | Green, J.M., P.J. Noel, A.I. Sperling, T.L. Walunas, G.S. Gray, J.A. Bluestone, and C.B. Thompson. 1994. Absence of B7-dependent responses in CD28-deficient mice. Immunity. 1: 501-508 [Medline]. [Medline] |
| 26. |
Shahinian, A.,
K. Pfeffer,
K.P. Lee,
K.P. Kundig,
T.M. Kishihara,
A. Wakeham,
K. Kawai,
P.S. Ohashi,
C.B. Thompson, and
T.W. Mak.
1993.
Differential T cell costimulatory requirements in CD28-deficient mice.
Science (Wash. DC).
261:
609-612
[Medline].
|
| 27. | Leo, O., M. Foo, D.H. Sachs, L.E. Samelson, and J.A. Bluestone. 1987. Identification of a monoclonal antibody against murine T3 polypeptide. Proc. Natl. Acad. Sci. USA. 84: 1037-1041 . |
| 28. |
Razi-Wolf, Z.,
G.J. Freeman,
F. Galvin,
B. Benacerraf,
L.M. Nadler, and
H. Reiser.
1992.
Expression and function of the
murine B7 antigen, the major costimulatory molecule expressed by peritoneal exudate cell.
Proc. Natl. Acad. Sci. USA.
89:
4210-4214
.
|
| 29. |
Wu, Y.,
Y. Guo, and
Y. Liu.
1993.
A major co-stimulatory
molecule, CTLA-4 ligand A, is distinct from B7.
J. Exp. Med.
178:
1789-1793
[Medline].
|
| 30. | Bottomly, K., M. Luqman, L. Greenbaum, S. Carding, J. West, T. Pasqualini, and D. Murphy. 1989. A monoclonal antibody to murine CD45R distinguish CD4 T cell population that produce different cytokines. Eur. J. Immunol. 19: 617-623 [Medline]. [Medline] |
| 31. |
Metlay, J.P.,
M.D. Witmer-Pack,
R. Agger,
M.T. Crowley,
D.S. Lawless, and
R.M. Steinman.
1990.
The distinct leukocyte integrins of mouse spleen dendritic cells as identified
with new hamster monoclonal antibodies.
J. Exp. Med.
171:
1753-1763
[Medline].
|
| 32. |
Guo, Y.,
Y. Wu,
M. Zhao,
X.P. Kong, and
Y. Liu.
1995.
Mutational analysis of an alternatively spliced product of B7
defines its CD28/CTLA-4-binding site on Immunoglobulin
C-like domain.
J. Exp. Med.
181:
1345-1355
[Medline].
|
| 33. |
Aruffo, A., and
B. Seed.
1987.
Molecular cloning of CD28
cDNA through a high efficiency COS cell expression system.
Proc. Natl. Acad. Sci. USA.
84:
8573-8577
[Medline].
|
| 34. |
Liu, Y.,
B. Jones,
A. Aruffo,
K.M. Sullivan,
P.S. Linsley, and
C.A. Janeway Jr..
1992.
Heat-stable antigen is a costimulatory
molecule for CD4 T cell growth.
J. Exp. Med.
175:
437-445
[Medline].
|
| 35. | Wu, Y., J. Xu, S. Shinde, I. Grewal, T. Henderson, R.A. Flavell, and Y. Liu. 1995. Rapid induction of a novel costimulatory activity on B cells by CD40 ligand. Curr. Biol. 5: 1303-1311 [Medline]. [Medline] |
| 36. |
Guo, Y.,
Y. Wu,
S. Shinde,
M.-S. Sy,
A. Aruffo, and
Y. Liu.
1996.
Identification of a costimulatory molecule rapidly induced by CD40L as CD44H.
J. Exp. Med.
184:
955-961
[Abstract] [Medline].
|
| 37. |
Fargeas, C.A.,
A. Truneh,
M. Reddy,
M. Hurle,
R. Sweet, and
R.-P. Sekaly.
1995.
Identification of residues in V-domain
of CD80 (B7-1) implicated in functional interaction with
CD28 and CTLA-4.
J. Exp. Med.
182:
667-676
[Medline].
|
| 38. |
Peach, R.,
J. Bajorath,
J. Naemura,
G. Leytze,
J.-A. Green,
A. Aruffo, and
P.S. Linsley.
1995.
Both extracellular immunoglobulin-like domains of CD80 contains residues critical
for binding T cell surface receptor CTLA-4 and CD28.
J.
Biol. Chem.
270:
21181-21187
[Medline].
|
| 39. |
Hara, T.,
S.M. Fu, and
J.A. Hansen.
1985.
Human T cell activation II. A new activation pathway used by a major T cell
population via a disulfide-bonded dimer of a 44-kilodalton
peptide (9.3 antigen).
J. Exp. Med.
161:
1513-1524
[Medline].
|
| 40. |
Moretta, A.,
G. Pantaleo,
M. Lopez-Botet, and
L. Moratta.
1985.
Involvement of T44 molecule in an antigen-independent pathway of T cell activation.
J. Exp. Med.
162:
823-838
[Medline].
|
| 41. |
June, C.H.,
J.A. Ledbetter,
M.M. Gillispie,
T. Linsten, and
C.B. Thompson.
1987.
T cell proliferation involving the
CD28 pathway is associated with cyclosporine-resistant IL-2
gene expression.
Mol. Cell Biol.
7:
4472-4481
[Medline].
|
| 42. | Harding, F., J. McAuther, J.A. Gross, and J.P. Allison. 1992. CD28-mediated signalling costimulates murine T cells and prevents induction of anergy in T cells. Nature (Lond.). 356: 607-609 [Medline]. [Medline] |
| 43. |
Jenkins, M.K.,
P.S. Taylor, and
K.B.Urdahl, and S.D. Norton.
1991.
CD28 delivers costimulatory signals involved in antigen-specific IL-2 production by human T cells and prevents
anergy.
J. Immunol.
147:
2461-2466
[Medline].
|
| 44. |
Liu, Y., and
C.A. Janeway Jr..
1992.
Cells that present both
specific ligand and costimulatory activity are the most efficient inducer of clonal expansion of normal CD4 T cells.
Proc. Natl. Acad. Sci. USA.
89:
3845-3849
[Medline].
|
| 45. | Chambers, B.J., M. Salcedo, and H.-G. Ljunggren. 1996. Triggering of natural killer cells by the costimulatory molecule CD80 (B7-1). Immunity. 5: 311-317 [Medline]. [Medline] |
| 46. | Linsley, P.S., J. Bradshaw, J. Greene, R. Peach, K.L. Bennett, and R.S. Mittler. 1996. Intracellular trafficking of CTLA-4 and focal localization towards sites of TCR engagement. Immunity. 4: 535-543 [Medline]. [Medline] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|