|
||
By





From the * Department of Medicine, and
Department of Microbiology and Immunology,
Albert Einstein College of Medicine, Bronx, New York 10461
Two major mechanisms for the regulation of autoreactive B cells that arise in the bone marrow are functional silencing (anergy) and deletion. Studies to date suggest that low avidity interactions between B cells and autoantigen lead to B cell silencing, whereas high avidity interactions lead to deletion. Anti-double stranded (ds) DNA antibodies represent a pathogenic autospecificity in Systemic Lupus Erythematosus (SLE). An understanding of their regulation is critical to an understanding of SLE. We now demonstrate in a transgenic model in which mice express the heavy chain of a potentially pathogenic anti-DNA antibody that antibody affinity for dsDNA does not alone determine the fate of anti-dsDNA B cells. B cells making antibodies with similar affinities for dsDNA are regulated differently, depending on light chain usage. A major implication of this observation is that dsDNA may not be the self antigen responsible for cell fate determinations of anti-dsDNA B cells. Light chain usage may determine antigenic crossreactivity, and cross-reactive antigens may regulate B cells that also bind dsDNA.
Anti-double stranded (ds)1 DNA antibodies are characteristic of the autoimmune disease SLE and titers of
IgG anti-dsDNA antibodies in patients' serum correlate with
disease activity and nephritis. Analyses of the immunoglobulin variable region gene loci reveal no differences between
autoimmune and nonautoimmune mouse strains and no
differences in human kindreds that associate with autoimmune disease. Furthermore, the immunoglobulin variable
region (V) genes used in both murine and human antiDNA antibodies are also used in the generation of a protective antibody repertoire (1).
Studies of the regulation of autoreactive B cells became
possible with the advent of transgenic technology. Analyses
of B cells expressing transgene encoded autoantibodies have
demonstrated the existence of several mechanisms for maintaining self tolerance: functional silencing or anergy, deletion, and receptor editing (6). Based on investigations
from several laboratories, Goodnow has proposed that there
are thresholds of receptor occupancy that correlate with
different mechanisms of regulation (14). According to this
model, deletion occurs under conditions of extensive receptor cross-linking, whereas silencing occurs under conditions of more moderate cross-linking.
To study the regulation of anti-dsDNA antibodies, we
previously generated nonautoimmune BALB/c and NZW
mice transgenic for the In the present study we compared transgene expression
in nonautoimmune BALB/c and NZW mice and autoimmune NZB/W F1 mice. While negligible transgene-encoded
anti-DNA activity is present in the serum of BALB/c and
NZW mice, such activity is present in the serum of all
NZB/W F1 mice. Analyses of hybridomas show that transgene expressing anti-dsDNA B cells from NZB/W F1
mice use a broad spectrum of light chain genes. In contrast,
anti-dsDNA B cells from nonautoimmune mice use almost
exclusively Vk1 genes. Thus, two populations of anti-
dsDNA B cells exist, which are differentially regulated in
nonautoimmune mice. There is a Vk1 anti-dsDNA subset
that is present but is functionally silent, and a non-Vk1 subset which is targeted for deletion. In the NZB/W F1 autoimmune background, both populations are activated in
vivo. Since the Vk1 and the non-Vk1 anti-dsDNA antibodies have similar affinities for dsDNA, this critical, potentially pathogenic, specificity cannot be regulated solely
by binding to dsDNA. Alternative models of regulation in which cell fate is determined by light chain usage need to
be considered.
Transgenic Mice.
Mice expressing the R4A- Generation of Hybridomas.
Spleens cells derived from two 8-wk-
old unimmunized transgenic NZW mice and two unimmunized
transgenic BALB/c mice were fused after stimulation for 48 h in
vitro with LPS (17).
2b heavy chain of the R4A antidsDNA antibody. The R4A antibody is encoded by an S107
V11 heavy chain gene and a Vk1 light chain gene, binds
dsDNA, and deposits in glomeruli of SCID mice (15, 16). In
R4A-
2b transgenic BALB/c and NZW mice, negligible
anti-DNA activity is present in the serum, and fusion of unstimulated splenocytes from these mice fails to yield transgene
expressing anti-dsDNA hybridomas. Anti-dsDNA B cells,
however, are present in the spleens of these mice and can
be activated in vitro by LPS to secrete transgene encoded
anti-dsDNA antibody. Furthermore, R4A anti-dsDNA hybridomas can be obtained from these mice if splenocytes
are stimulated in vitro with LPS before fusion (9, 17).
2b heavy chain
transgene have been previously reported (9, 17). Transgene expressing NZB/W F1 mice were generated by breeding transgenic
NZW mice with wild-type NZB mice.
2b dsDNA binding as previously described (17). Cells from hybridoma wells displaying antidsDNA activity were cloned in soft agar.
Analysis of V Gene Expression.
Hybridoma clones were screened
for expression of R4A-
2b and Vk1 genes by RNA dot blot using
probes specific for the mouse S107 and Vk1 gene families as previously described (17). A Vk1 probe was provided by Dr. C. Schildkraut (Albert Einstein College of Medicine, Bronx, New
York; reference 18).
light chain genes were synthesized using 10 µg
of RNA and 100 ng of antisense oligonucleotide primers specific
for the mouse gamma constant region (TGGACAGGGA/CTCCAG/TAGTTC) and for the mouse
light chain constant region (ACACTCATTCCTGTTGAA). PCR amplification was
performed using vent polymerase. For the R4A heavy chain gene,
an oligomer specific for framework 1 (FR1; GGTGAAGCTGGTGGAATCTGG) and the gamma constant region primer were used; for kappa light chain genes a Vk1, FR1-specific oligomer (CCAGCAGTGATGTTGTGATGACCC) or a cocktail of degenerate FR1, Vk oligomers (19), and the
constant region
primer were used. PCR products were sequenced with the dsDNA cycle sequencing system (GIBCO BRL, Gaithersburg,
MD) using constant region, FR1, and internal primers. Sequencing reactions were electrophoresed on 6 or 7% acrylamide gels.
Allelic Exclusion. Allelic exclusion of anti-dsDNA hybridomas was determined by ELISA as previously described (17). In brief, 96-well Falcon plates (Becton Dickinson, Lincoln Park, NJ) were coated with a 1/1,000 dilution of goat anti-mouse antibody to IgM, IgG1, IgG3, IgG2a, or IgG2b (Southern Biotechnology Assoc., Birmingham, AL). After blocking plates in PBS, 1.0% BSA, cell supernatants normalized to 10 µg/ml were added to wells for 1 h at 37°C followed by the addition of goat anti-mouse IgM, IgG1, IgG3, IgG2a, or IgG2b antibody, respectively, conjugated to alkaline phosphatase (Southern Biotechnology Assoc.). All ELISA washes were performed with PBS-0.05% Tween. ELISAs were developed with p-nitrophenylphosphate disodium as substrate (Sigma Chemical Co., St. Louis, MO) and ELISAs were read at 405 nm in a Titertek-Multiscan ELISA reader.
Antibody Quantitation. IgG2b antibodies in hybridoma supernatants were quantitated by ELISA as previously described (16).
Analysis of Antigenic Specificity. Quantitated hybridoma supernatants were tested by ELISA for binding to dsDNA and single stranded (ss) DNA. The dsDNA ELISA was performed on salmon sperm DNA-coated Immulon 2 ELISA plates (Dynatech Labs. Inc., Chantilly, VA) according to Iliev et al. (17). The ssDNA ELISA was performed as described for dsDNA (17) except that salmon sperm DNA was not filtered through a nitrocellulose filter and was denatured by boiling and quick cooled on ice before coating Immulon 2 plates.
Affinity Measurements of Anti-dsDNA Antibodies. Affinity constants for selected anti-dsDNA antibodies were determined according to an antigen inhibition ELISA as described by Nieto et al. (20). Immulon 2 plates were coated with 100 µg/ml salmon sperm DNA and blocked in PBS, 1.0% BSA. Hybridoma supernatants diluted to an antibody concentration that was within the linear range on an anti-dsDNA antibody titration curve, were then incubated in wells of ELISA plates along with increasing concentrations of soluble salmon sperm DNA used as inhibitor (0.0-2 mg/ml) for 2 h at 37°C. Wells were washed and incubated for 1 h at 37°C with goat anti-mouse IgG2b conjugated to alkaline phosphatase and developed with substrate solution as described above. ELISA measurements were read at 405 nm in a Titertek Multiscan ELISA reader. Apparent affinities were calculated based on the concentration of soluble DNA resulting in 50% inhibition of antibody binding (20).
Dissociation constants were determined according to the method of Friguet et al. (21). In brief, linearized plasmid DNA was nick translated with 32P-labeled deoxynucleotide triphosphates. A constant amount of antibody was combined with various amounts of radiolabeled DNA (5-100 ng), brought to a final volume of 1.0 ml with SSC, and then incubated for 3 h at room temperature. Antibody-dsDNA complexes were trapped on 0.45 µm type HA millipore filters (Millipore Corp., Bedford, MA). Bound radioactivity was detected on a liquid scintillation counter. Results were plotted and dissociation constants were obtained from the slope of the linear regression.Pathogenicity of Anti-dsDNA Antibodies. Hybridoma cells (5 × 106) from two lines, BW7E6H1 and NZW14E10, were injected intraperitoneally into pristane-primed SCID mice. 3 wk after injections, animals were killed, and kidneys removed and imbedded in paraffin. Sections were stained with biotin-conjugated goat anti-mouse IgG (Vectastain ABC kit; Vector Labs., Inc., Burlingame, CA) and then developed with NBT-BCIP substrate (GIBCO BRL) according to Katz et al. (16). Stained sections were viewed with a Zeiss microscope.
While splenocytes from nonautoimmune NZW and
BALB/c R4A-
2b transgenic mice can be induced to secrete transgene encoded anti-dsDNA antibodies by in vitro
stimulation with LPS, spontaneous secretion of
2b antidsDNA antibody is negligible in these mice (9). In contrast,
NZB/W F1 R4A-
2b transgenic mice have elevated titers of
2b anti-dsDNA. These antibodies are transgene encoded; at 2.5-3 mo of age, elevated titers of
2b DNA
binding activity is present only in the sera of transgenic
NZB/W F1 mice and not in nontransgenic littermates (Fig. 1).
2b anti-dsDNA antibody in the sera
of NZB/W F1 transgenic and non transgenic mice. Sera from 10 transgenic (Tg+) NZB/W F1 mice and 10 nontransgenic (Tg
) littermates
were diluted 1/500 and then tested by ELISA for binding of
2b antibody to dsDNA. Ages of Tg+ and Tg
mice range from 10-21 wk. There is
no linear relationship between age of the mouse and anti-dsDNA titer
within these populations. *Mean value significantly exceeds mean value
for Tg
mice. P <0.002 (Student's t test).
To understand the differential regulation of anti-dsDNA
B cells in autoimmune and nonautoimmune mice, we generated transgene encoded anti-dsDNA hybridomas. We
were able to obtain anti-dsDNA producing hybridomas from
NZW or BALB/c mice only if splenocytes were cultured
with LPS before fusion (17). 5-10% of hybridomas from
LPS-stimulated splenocytes expressing the R4A-
2b transgene bound dsDNA. 20 anti-dsDNA hybridomas, 9 from
NZW mice, and 11 from BALB/c mice, were analyzed in detail. Expression of the transgene was verified in these clones
by sequencing through the VDJ junction of the
2b heavy
chain in all hybridomas and throughout the entire V region
in half. Sequence analysis revealed the heavy chain to be
encoded by the transgene in all cases and further revealed that there was no somatic mutation of the R4A heavy chain.
To examine the endogenous light chains expressed in these hybridomas, we first looked for expression of a Vk1 transcript by RNA dot blot since the "wild-type" R4A antibody possesses a Vk1 light chain (15). 17 of 20 lines expressed a Vk1 light chain. All light chains were sequenced (Fig. 2) confirming the light chain identification obtained by RNA dot blot. The Vk1-A gene was used in the majority (12) of hybridomas. 16 of the Vk1 light chain genes were somatically mutated. The three non-Vk1 anti-dsDNA associated light chains, BA12BB2, BA12BD-1, and BA1227, were derived from BALB/c hybridomas and are encoded by Vk21, Vk2, and Vk4/5 genes respectively (data not shown).
(1) dextran
germline gene; and (C) Vk1-C (38). CDR regions are underlined and
are according to Kabat et al. (40). Dashes indicate identity of nucleotides
to the germline sequence. Silent base changes are designated by lowercase
letters. Nucleotide changes leading to amino acid replacements in the V
region are indicated by uppercase letters. Those leading to amino acid replacements in the joining (J) regions are indicated in bold uppercase letters. Amino acid replacements are shown above the nucleotide sequence. Amino acid replacements from the germline J are indicated in bold. Light
chains derived from BALB/c mice have the prefix BA preceding the numeric designation. Light chains derived from NZW mice have the prefix
NZW preceding the numeric designation.
Generation of Hybridomas from NZB/W F1 Autoimmune Mice.
Transgene expressing anti-dsDNA hybridomas
from R4A-
2b transgenic NZB/W F1 mice could be obtained from non-LPS activated B cells as well as from LPS
activated splenocytes, confirming activation in vivo of antidsDNA B cells in the autoimmune mice. In contrast to the
dominant Vk1 usage seen in nonautoimmune mice, only 5 of 16 autoimmune derived anti-dsDNA hybridomas use a
Vk1 gene (Table 1). 12 cell lines were obtained from LPSstimulated splenocytes, of which only 4 (33%) use Vk1
genes. Only 1 of 4 cell lines obtained from unstimulated
NZB/W F1 splenocytes (25%) uses a Vk1 light chain. Therefore, there is little difference in the frequency of Vk1 expression in hybridomas from LPS-stimulated and unstimulated splenocytes. Vk1 genes from NZB/W F1 hybridomas display no somatic mutation in three (BW19G10, BW21D11,
and BW10D9) of the five Vk1 genes sequenced (Fig. 3).
The base change observed at the junction of Vk and Jk in
Bw19G10 and BW21D11 is likely the result of imprecise
joining during Vk-Jk rearrangement.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The remaining 11 hybridomas use light chains from eight different non-Vk1 light chain gene families (Fig. 4), including two from the Vk10 family and three from the Vk4/5 family. Since none of the non-Vk1 genes share 100% homology with any germline genes reported in the EMBL/GenBank/DDBJ database, we cannot determine whether they are somatically mutated or whether they represent novel germline genes.
We previously observed that R4A anti-dsDNA hybridomas from nonautoimmune mice display a lack of allelic exclusion, whereas the transgene expressing non-dsDNA
binding hybridomas all display intact allelic exclusion (17).
We, therefore, examined the R4A anti-dsDNA hybridomas from NZB/W F1 mice for expression of endogenous µ,
1,
3, or
2a heavy chain. Hybridoma supernatants were
assayed by ELISA for binding to anti-isotype antibodies.
Most hybridomas (14 of 16) were observed to express endogenous heavy chain as well as the R4A-
2b heavy chain.
In nine hybridomas, the endogenous heavy chain is of the
µ isotype; in 5, it is of the
3 or
2a isotype. All hybridomas failing to display allelic exclusion demonstrated expression of a second isotype as detected by an OD reading that was at least fivefold above background levels (OD405 nm
>0.6). Two hybridomas from NZB/W F1 mice, BW10D9
and BW7E6, demonstrated no binding above background
to anti-µ,
1,
3, or
2a (OD405 nm <0.150) suggesting that
they maintained allelic exclusion or that they secreted an
endogenous
2b heavy chain.
Comparison of the light chain repertoire of transgene- encoded anti-dsDNA antibodies used by the nonautoimmune and autoimmune mice (Table 1) demonstrates a statistically significant dominance of Vk1 light chains in hybridomas from the nonautoimmune BALB/c and NZW mice. To understand how R4A-Vk1 anti-DNA antibodies might differ from R4A non-Vk1 anti-DNA antibodies, we compared binding to dsDNA by ELISA (Fig. 5). A similar spectrum of binding was present among antibodies with both Vk1 and non-Vk1 light chains. Several non-Vk1 antibodies displayed lower dsDNA binding than Vk1 antibodies, demonstrating that the non-Vk1 antibodies did not represent a higher affinity subset. We also measured the apparent affinity of some representative Vk1 and non-Vk1 anti-dsDNA antibodies in a DNA inhibition assay (20). There was no difference in the range of affinities among the Vk1 and the non-Vk1 anti-dsDNA antibodies (Table 2). One antibody which binds only moderately well to dsDNA-coated plates (BW16B2) by direct ELISA, appears to have a higher apparent affinity, as detected by a DNA inhibition ELISA, than expected. This antibody may bind better to DNA in solution than to DNA in a solid phase, a characteristic of some anti-DNA antibodies which has previously been observed (22).
2b concentration of 10 µg/ml and
assayed for binding to salmon
sperm dsDNA by ELISA. Wildtype R4A-
2b antibody and irrelevant
2b are used as positive
and negative controls, respectively. Shaded boxes, Vk1 antibodies; open boxes, non-Vk1
antibodies. (A) Strong dsDNAbinding antibodies. Strong dsDNA binders are defined as those
whose ELISA measurements at
405 nm are at least fourfold
greater than R4A after a 4-h incubation with alkaline phosphatase substrate solution. (B)
Moderate dsDNA-binding antibodies. Moderate dsDNA binders are defined as those whose
ELISA measurements at 405 nm
range from 0.75-2-fold that of
R4A after overnight incubation
with substrate solution. Results
are the average of triplicates ± standard deviation. Standard deviations <0.010 do not appear
on the bar graph.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Because it has been reported that B cells with specificity for ssDNA are tolerized by anergy induction, while B cells binding dsDNA are deleted (8), we assayed for cross-reactivity with ssDNA by ELISA (Table 3). At 2 µg/ml, one Vk1 anti-dsDNA antibody, BA129B-1, derived from a BALB/c mouse, and two non-Vk1 anti-dsDNA antibodies, BW14C7B1 and BW9B5F7, derived from an NZB/W F1 mouse bind strongly to ssDNA (Table 3) relative to R4A. Two other anti-dsDNA antibodies, one from a BALB/c mouse and one from an NZB/W F1 mouse, show less than a twofold increase in binding ssDNA relative to R4A. The remainder of the anti-dsDNA antibodies from both autoimmune and nonautoimmune mice display binding to ssDNA less than twofold greater than the binding of R4A.
|
||||||||||||||||||||||||||||||
To test for pathogenicity, a Vk1-expressing cell line,
NZW145-D2, derived from an NZW transgenic mouse,
and a non-Vk1 expressing line, BW7E6H1, derived from
an NZB/W F1 transgenic mouse, were injected into SCID
mice. NZW145D-2 and BW7E6H1 were selected for pathogenicity studies because both cell lines are allelically excluded and secrete only the transgenic antibody. Furthermore, antibodies from both hybridomas have similar binding characteristics. They both bind moderately well to dsDNA by ELISA (Fig. 5) and both have dissociation
constants in the range of 10
9-10
8 as detected by a filter
binding assay (21). After 3 wk, kidneys were removed from
these mice and stained for antibody deposition. In both
cases, deposition of IgG was observed in glomeruli (Fig. 6,
B and C) suggesting that both Vk1 and non-Vk1 R4A
anti-dsDNA antibodies have pathogenic potential.
Anti-dsDNA antibodies represent a major pathogenic specificity in SLE. To understand their regulation in nonautoimmune and autoimmune hosts, we generated mice expressing the heavy chain of an IgG2b pathogenic anti- dsDNA antibody. This heavy chain, expressed in association with an endogenous light chain repertoire, can form antibodies with a variety of affinities for dsDNA. The analysis of serum and hybridomas from R4A transgenic mice leads to several important observations.
The first observation is that there is a defect in tolerance
induction in transgenic NZB/W F1 mice leading to elevated serum titers of transgenic
2b anti-dsDNA antibody
in this autoimmune strain. In the autoimmune MRL/lpr
mouse which has a defect in the Fas gene, Roark et al. have
similarly observed a breakdown of tolerance of transgenic
anti-dsDNA antibodies (23) and have suggested that loss of
Fas may lead to the accumulation of autoreactive B cells.
Other studies, however, have demonstrated intact regulation of transgenic autoantibodies in MRL/lpr mice suggesting that Fas is not essential for maintaining B cell tolerance (24, 25). Studies in transgenic NZB/W F1 mice may
help us determine what factors, besides decreased Fas expression, may lead to a breakdown in tolerance in autoimmune-prone mice.
A second observation is that the transgenic anti-dsDNA antibodies derived from NZB/W F1 mice are often encoded by unmutated light chain genes. 3 out of 5 Vk1 genes are unmutated in NZB/W F1 mice compared to 1 out of 17 in BALB/c and NZW mice. Although studies of anti-dsDNA antibodies from nontransgenic NZB/W F1 mice show the antibody genes to be somatically mutated, little information is available on whether the mutations lead to specificity for dsDNA or whether the autoreactivity is germline encoded. It is possible that autoreactive B cells whose specificities are germline encoded escape regulation in the bone marrow and exit to the periphery where they then acquire somatic mutations after activation by self antigens. Thus, there are two possible explanations for the fact that autoantibodies obtained from nontransgenic NZB/W F1 mice are somatically mutated; either the mutations are necessary for autospecificity, or the mutations occur in already autoreactive B cells that are not tolerized. Our studies indicate that in the transgenic NZB/W F1 mice, anti- dsDNA B cells arising in the bone marrow can move into peripheral lymphoid organs and secrete germline encoded autoantibody. Furthermore, B cell activation occurs without molecular evidence for T cell help.
A third observation from our studies is that transgene expressing anti-dsDNA hybridomas from both nonautoimmune and autoimmune strains display a lack of allelic exclusion. In NZW- and BALB/c-derived hybridomas, the majority of endogenous antibodies display no binding to dsDNA. We had previously speculated that the endogenous heavy chain is instrumental to survival of the autoreactive B cell (17). In the NZB/W F1-derived hybridomas, however, the endogenous heavy chain may display DNAbinding specificity (Spatz, L., V. Saenko, and B. Diamond, unpublished observations). Therefore, the reason for the lack of allelic exclusion in transgenic NZB/W F1 mice is unclear. Although many anti-dsDNA B cells present in nontransgenic NZB/W F1 mice have been shown to display intact allelic exclusion, the frequency of nonallelically excluded autoreactive B cells has not been examined in these mice. It has been demonstrated in B cells of MRLlpr/lpr mice transgenic for an anti-DNA antibody, that allelic exclusion is more often absent than in B cells from nonautoimmune transgenic strains (26). Perhaps there is an intrinsic B cell defect in both MRL/lpr and NZB/W F1 B cells such that the production of a transgenic heavy chain does not effectively repress further heavy chain rearrangements.
A fourth and major observation is that anti-dsDNA antibodies from the nonautoimmune mice preferentially use Vk1
light chains, whereas those obtained from autoimmune mice
are encoded by a broad spectrum of Vk genes. This finding
suggests that autoreactive B cells expressing non-Vk1 light
chains are deleted from the nonautoimmune strains and that
light chain usage influences cell fate. Further support for
the deletion of non-Vk1-R4A B cells in nonautoimmune mice comes from studies of BALB/c mice transgenic for
both R4A-
2b and bcl-2. These mice have transgenic antiDNA B cells in the spleen expressing a broad spectrum of
Vk genes (Kuo, P., and B. Diamond, unpublished observations).
Decreased Vk1 usage in NZB/W F1 mice is not due to
an abnormality in the
light chain gene locus of the NZB
mouse. Autoantibody production has been observed in
many different Igk-V haplotypes and RFLP analysis has
failed to identify particular lupus-associated Igk-V genes (27).
Previous studies suggest that the Igk-V gene loci in autoimmune mouse strains are normal (28) and Gavalchin et
al. have demonstrated that the V regions encoding a set of pathogenic anti-DNA antibodies in the (NZB × SWR)F1
lupus-prone mice are often derived from the nonautoimmune SWR parental strain (1). Allelic polymorphisms exist
among individual light chain genes from different inbred
strains. However, this cannot account for the dominant usage of Vk1-A light chains among anti-dsDNA antibodies
obtained from transgenic BALB/c mice and their relative paucity among transgenic anti-dsDNA antibodies obtained
from NZB/W F1 mice because an identical Vk1-A gene is
present in both strains (29). Furthermore, it is unlikely that
the dominant expression of Vk1 genes by anti-dsDNA antibodies obtained from the nonautoimmune transgenic
mice is due to biased use of Vk1 genes in cells expressing the R4A-
2b transgene. None of the 19 randomly selected
R4A-
2b-expressing, non-DNA-binding antibodies from
NZW hybridomas express a Vk1 light chain (17). The predominant expression of Vk1 anti-dsDNA antibodies, therefore, demonstrates that anti-DNA B cells with nonVk1 light chains are targeted for deletion in nonautoimmune strains.
To understand why Vk1-expressing B cells escape to the periphery and persist in an unactivated, silent state, whereas non-Vk1 B cells undergo deletion in nonautoimmune strains, we looked for differences in binding to dsDNA that might account for their differential regulation. While current models of B cell tolerance suggest that low avidity interactions with antigen lead to anergy while high avidity interactions lead to deletion, Vk1 and non-Vk1 anti-dsDNA antibodies demonstrate similar affinities for dsDNA. The difference in regulation, therefore, does not appear to be due to a difference in affinity for dsDNA. Nor does the difference in regulation correlate with differences in the pathogenic potential of these antibodies. Cell lines secreting a Vk1 and non-Vk1 anti-dsDNA antibody were injected into SCID mice and both antibodies deposited in glomeruli.
The relative contribution of kappa light chains in DNA specificity have previously been reported (30, 31). Radic et al. have demonstrated that the pairing of the 3H9 anti-DNA heavy chain with different light chains alters the ability of the antibody to bind dsDNA, cardiolipin, and RNA, although all antibodies retain the ability to bind ssDNA (31). More recently, Retter et al. has suggested that the light chain may confer upon the antibody a second cross-reactive specificity (32). We propose that perhaps it is on the basis of a second light chain-associated specificity that B cells producing R4A anti-dsDNA antibodies are either deleted or silenced. To begin to test this hypothesis, we measured binding of hybridoma antibodies to ssDNA. Although we have identified a few antibodies that bind strongly to ssDNA, we have not observed any trend that might explain the differential regulation of Vk1 and non-Vk1 antibodies. In fact, two of these antibodies use non-Vk1 genes and appear to be deleted from the nonautoimmune mice rather than anergized as one might expect.
The simplest interpretation of our studies is that DNA is not the critical antigen mediating selection of these autoreactive B cells. There is increasing evidence that anti-DNA antibodies can cross-react with several other self antigens including fibronectin, laminin, heparan sulfate, collagen, and cardiolipin, as well as nuclear antigens (33). If dsDNA were the critical selecting antigen and receptor occupancy alone determined cell fate, then both Vk1 and non-Vk1 B cells would undergo the same form of negative selection. Just as recent data raise the possibility that anti-DNA antibodies may mediate tissue injury by binding cross-reactive antigens, anti-DNA B cells may be regulated by cross-reactive antigens.
This transgenic model provides a unique opportunity to study the molecular basis for differential regulation of autoreactive B cells, and suggests that affinity for dsDNA is not the critical determinant of the fate of anti-dsDNA B cells. If dsDNA is indeed a self antigen capable of mediating negative selection, our data suggest that antigen binding on the membrane of a B cell may engage the B cell receptor complex to either delete or inactivate autoreactive B cells depending on properties not correlated with affinity for antigen. More likely, different light chains associating with the R4A heavy chain mediate binding to cross-reactive antigens and this cross-reactivity plays a role in determining the fate of the autoreactive anti-dsDNA B cells. The identity of these putative cross-reactive antigens remains to be determined in future studies.
Address correspondence to Linda Spatz, Albert Einstein College of Medicine, Microbiology and Immunology, Forchheimer 405, Bronx, NY 10461.
Received for publication 30 September 1996 and in revised form 24 January 1997.
This project is supported by National Institutes of Health grants AI40163 (L. Spatz) and AR42533 (B. Diamond) and grants from the New York Chapter of the Arthritis Foundation. Linda Spatz is a recipient of a Young Scholar Award granted by the New York Partnership in Arthritis Research of the Arthritis Foundation, New York Chapter.We would like to thank Amy Gilkes for her assistance. We would also like to express our sincere gratitude to Dr. Barbara Birshtein, Dr. Barry Bloom, and Dr. Matthew Scharff for their critical reading of this manuscript.
| 1. | Gavalchin, J., J.A. Nicklas, J.W. Eastcott, M.P. Madaio, B.D. Stollar, R.S. Schwartz, and S.K. Datta. 1995. Lupus prone (SWR × NZB) F1 mice produce potentially nephritogenic autoantibodies inherited from the normal SWR parent. J. Immunol. 134: 885-894 . [Abstract] |
| 2. |
Datta, S.K.,
B.D. Stollar, and
R.S. Schwartz.
1983.
Normal
mice express idiotypes related to autoantibody idiotypes from
lupus mice.
Proc. Natl. Acad. Sci. USA.
80:
2723-2727
[Medline].
|
| 3. | Krishnan, M.R., and T.N. Marion. 1993. Structural similarity of antibody variable regions from immune and autoimmune anti-DNA antibodies. J. Immunol. 150: 4948-4957 [Medline]. [Abstract] |
| 4. |
Kofler, R.,
D.J. Noonan,
D.E. Levy,
M.C. Wilson,
N.A. Moller,
F.J. Dixon, and
A.N. Theofilopoulos.
1985.
Genetic
elements used for a murine lupus anti-DNA autoantibody are
closely related to those for antibodies to exogenous antigens.
J. Exp. Med.
161:
805-815
[Medline].
|
| 5. | Manheimer-Lory, A., R. Monhian, A. Splaver, B. Gaynor, and B. Diamond. 1995. Analysis of the Vk1 family: germline genes from an SLE patient and expressed autoantibodies. Autoimmunity. 20: 259-265 . [Medline] |
| 6. | Goodnow, C.C., J. Crosbie, S. Adelstein, T.B. Lavoie, S.J. Smith-Gill, R.A. Brink, H. Pritchard-Briscoe, J.S. Wotherspoon, R.H. Loblay, K. Raphael, et al . 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature (Lond.). 334: 676-682 [Medline]. [Medline] |
| 7. | Nemazee, D.A., and K. Burki. 1989. Clonal deletion of B lymphocytes in a transgenic mouse bearing anti-MHC class I antibody genes. Nature (Lond.). 337: 562-566 [Medline]. [Medline] |
| 8. | Erikson, J., M.Z. Radic, S.A. Camper, R.R. Hardy, C. Carmack, and M. Weigert. 1991. Expression of anti-DNA immunoglobulin transgenes in non-autoimmune mice. Nature (Lond.). 349: 331-334 [Medline]. [Medline] |
| 9. |
Offen, D.,
L. Spatz,
H. Escowitz,
S. Factor, and
B. Diamond.
1992.
Induction of tolerance to an IgG autoantibody.
Proc.
Natl. Acad. Sci. USA.
89:
8332-8336
[Medline].
|
| 10. |
Okamoto, M.,
M. Murakami,
A. Shimizu,
S. Ozaki,
T. Tsubata,
S. Kumagai, and
T. Honjo.
1992.
A transgenic
model of autoimmune hemolytic anemia.
J. Exp. Med.
175:
71-79
[Medline].
|
| 11. |
Tiegs, S.L.,
D.M. Russell, and
D. Nemazee.
1993.
Receptor
editing in self-reactive bone marrow B cells.
J. Exp. Med.
177:
1009-1021
[Medline].
|
| 12. |
Gay, D.,
T. Saunders,
S. Camper, and
M. Weigert.
1993.
Receptor editing: an approach by autoreactive B cells to escape tolerance.
J. Exp. Med.
177:
999-1008
[Medline].
|
| 13. | Tsao, B.P., A. Chow, H. Cheroutre, Y.W. Song, M.E. McGrath, and M. Kronenberg. 1993. B cells are anergic in transgenic mice that express IgM anti-DNA antibodies. Eur. J. Immunol. 23: 2332-2339 [Medline]. [Medline] |
| 14. | Goodnow, C.C.. 1992. Transgenic mice and analysis of B-cell tolerance. Annu. Rev. Immunol. 10: 489-518 [Medline]. [Medline] |
| 15. |
Shefner, R.,
G. Kleiner,
A. Turken,
L. Papazian, and
B. Diamond.
1991.
A novel class of anti-DNA antibodies identified
in BALB/c mice.
J. Exp. Med.
173:
287-296
[Medline].
|
| 16. |
Katz, J.B.,
W. Limpanasithikul, and
B. Diamond.
1994.
Mutational analysis of an autoantibody: differential binding and
pathogenicity.
J. Exp. Med.
180:
925-932
[Medline].
|
| 17. | Iliev, A., L. Spatz, S. Ray, and B. Diamond. 1994. Lack of allelic exclusion permits autoreactive B cells to escape deletion. J. Immunol. 153: 3551-3556 [Medline]. [Abstract] |
| 18. | Moynet, D., S.J. MacLean, K.H. Ng, D. Anctil, and D.M. Gibson. 1985. Polymorphism of k variable region (Vk-1) genes in inbred mice: relationship to the Igk-Ef2 serum light chain marker. J. Immunol. 134: 3455-3460 [Medline]. [Abstract] |
| 19. | Kettleborough, C.A., J. Saldanha, K.H. Ansell, and M.M. Bendig. 1993. Optimization of primers for cloning libraries of mouse immunoglobulin genes using the polymerase chain reaction. Eur. J. Immunol. 23: 206-211 [Medline]. [Medline] |
| 20. | Nieto, A., A. Gaya, M. Jansa, C. Moreno, and J. Vives. 1984. Direct measurement of antibody affinity distribution by hapten-inhibition enzyme immunoassay. Mol. Immunol. 21: 537-543 [Medline]. [Medline] |
| 21. | Friguet, B., A.F. Chaffotte, L. Djavadi-Ohaniance, and M.E. Goldberg. 1985. Measurement of the true affinity constant in solution of antigen-antibody complexes by enzyme-linked immunosorbent assay. J. Immunol. Methods. 77: 305-319 [Medline]. [Medline] |
| 22. | Pisetsky, D.S., and C.F. Reich. 1994. The influence of DNA size on the binding of anti-DNA antibodies in the solid and fluid phase. Clin. Immunol. Immunopathol. 72: 350-356 [Medline]. [Medline] |
| 23. |
Roark, J.H.,
C.L. Kuntz,
K.-A. Nguyen,
A.J. Caton, and
J. Erikson.
1995.
Breakdown of B cell tolerance in a mouse
model of systemic lupus erythematosus.
J. Exp. Med.
181:
1157-1167
[Medline].
|
| 24. | Rathmell, J.C., and C.C. Goodnow. 1994. Effects of the lpr mutation on elimination and inactivation of self-reactive B cells. J. Immunol. 153: 2831-2842 [Medline]. [Abstract] |
| 25. | Rubio, C.F., J. Kench, D.M. Russell, R. Yawger, and D. Nemazee. 1996. Analysis of central B cell tolerance in autoimmune-prone MRL/lpr mice bearing autoantibody transgenes. J. Immunol. 157: 65-71 [Medline]. [Abstract] |
| 26. | Roark, J.H., C.L. Kuntz, K.A. Nguyen, L. Mandik, M. Cattermole, and J. Erikson. 1995. B cell selection and allelic exclusion of an anti-DNA Ig transgene in MRL-lpr/lpr mice. J. Immunol. 154: 4444-4455 [Medline]. [Abstract] |
| 27. | Kofler, R., R. Strohal, R.S. Balderas, M.E. Johnson, D.J. Noonan, M.A. Duchosal, F.J. Dixon, and A.N. Theofilopoulos. 1988. Immunoglobulin k light chain variable region gene complex organization and immunoglobulin genes encoding anti-DNA autoantibodies in lupus mice. J. Clin. Invest. 82: 852-860 [Medline]. |
| 28. | Theofilopoulos, A.N., R. Kofler, P.A. Singer, and F.J. Dixon. 1989. Molecular genetics of murine lupus models. Adv. Immunol. 46: 61-109 [Medline]. [Medline] |
| 29. |
Bailey, N.C.,
K.N. Kasturi,
K.T. Blackwell,
F.W. Alt, and
C.A. Bona.
1991.
Complexity of the immunoglobulin light
chain Vk1 gene family in the New Zealand black mouse.
Int.
Immunol.
3:
751-760
[Medline].
|
| 30. |
Lacour, M., and
S. Izui.
1991.
Lack of anti-DNA precursors
in chain bearing B lymphocytes in (NZB × NZW) F1 mice.
Evidence for the contribution of Vk genes to anti-DNA specificity.
Eur. J. Immunol.
21:
839-842
[Medline].
[Medline] |
| 31. | Radic, M.Z., M.A. Mascelli, J. Erikson, H. Shan, and M. Weigert. 1991. Ig H and L chain contributions to autoimmune specificities. J. Immunol. 146: 176-182 [Medline]. [Abstract] |
| 32. | Retter, M.W., R.A. Eisenberg, P.L. Cohen, and S.H. Clarke. 1995. Sm and DNA binding by dual reactive B cells requires distinct VH, Vk and VH CDR3 structures. J. Immunol. 155: 2248-2257 [Medline]. [Abstract] |
| 33. |
Lafer, E.M.,
J. Rauch,
G. Andrzejewski Jr.,
D. Mudd,
B.C. Furie,
B. Furie, and
R.S. Schwartz.
1981.
Polyspecific monoclonal lupus autoantibodies reactive with both polynucleotides and phospholipids.
J. Exp. Med.
153:
897-909
[Medline].
|
| 34. | Lake, R.A., A. Morgan, B. Henderson, and N.A. Staines. 1985. A key role for fibronectin in the sequential binding of native dsDNA and monoclonal anti-DNA antibodies to components of the extracellular matrix: its possible significance in glomerulonephritis. Immunology. 54: 389-395 [Medline]. [Medline] |
| 35. |
Ohnishi, K.,
F.M. Ebling,
B. Mitchell,
R.R. Singh,
B.H. Hahn, and
B.P. Tsao.
1994.
Comparison of pathogenic and
non-pathogenic murine antibodies to DNA: antigen binding
and structural characteristics.
Int. Immunol.
6:
817-830
[Medline].
|
| 36. | Bernstein, K.A., R. DiVarerio, and J.B. Lefkowith. 1995. Glomerular binding activity in MRL-lpr serum consists of antibodies that bind to a DNA/histone/type IV collagen complex. J. Immunol. 154: 2424-2433 [Medline]. [Abstract] |
| 37. | Swanson, P.C., R.L. Yung, N.B. Blatt, M.A. Eagan, J.M. Norris, B.C. Richardson, K.J. Johnson, and G.D. Glick. 1996. Ligand recognition by murine anti-DNA autoantibodies. II. Genetic analysis and pathogenicity. J. Clin. Invest. 97: 1748-1760 [Medline]. [Medline] |
| 38. |
Corbet, S.,
M. Milili,
M. Fougereau, and
C. Schiff.
1987.
Two V-kappa germ-line genes related to the GAT idiotypic
network (Ab1 and Ab3/Ab1 ) account for the major subfamilies of the mouse V-kappa-1 variability subgroup.
J. Immunol.
138:
932-939
[Medline].
[Abstract] |
| 39. | Matsuda, T., and E.A. Kabat. 1989. Variable region cDNA sequences and antigen binding specificity of mouse monoclonal antibodies to isomaltosyl oligosaccharides coupled to proteins. J. Immunol. 142: 863-870 [Medline]. [Abstract] |
| 40. | Kabat, E.A., T.T. Wu, M. Reid-Miller, H.M. Perry, and K.S. Gottesman. 1987. Sequence of Proteins of Immunological Interest. U.S. Department of Health and Human Services Washington, DC. |
| 41. | Ng, K.H., A. Lavigueur, L. Ricard, M. Boivrette, S. MaClean, D. Cloutier, and D.M. Gibson. 1989. Characterization of allelic Vk-1 region genes in inbred strains of mice. J. Immunol. 143: 638-648 [Medline]. [Abstract] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|