|
||
-converting Enzyme (ICE), but Inhibit
Processing of the Interleukin-1
Precursor by ICE
By

From the * Department of Immunology and Cell Biology, and
Department of Clinical Medicine,
Research Center Borstel, Center for Medicine and Biosciences, 23845 Borstel, Germany
Local immunoregulatory processes during normal vascular biology or pathogenesis are mediated in part by the production of and response to cytokines by vessel wall cells. Among these
cytokines interleukin (IL)-1 is considered to be of major importance. Although vascular smooth
muscle (SMC) and endothelial cells (EC) expressed both IL-1
and IL-1
as cell-associated,
33-kilodalton (kD) precursors, SMC neither contained detectable mature IL-1
, nor processed
recombinant IL-1
precursor into its mature 17-kD form. Thus, we investigated the expression and function of IL-1
-converting enzyme (ICE) in vascular cells. We demonstrate in processing experiments with recombinant IL-1 precursor molecules that EC processed IL-1
, in
contrast to SMC. Despite the failure of SMC to process IL-1
, these cells expressed ICE mRNA,
immunoreactive ICE protein, and the expected IL-1
nucleotide sequence. The lack of processing was explained by our finding that extracts of SMC specifically and concentration dependently blocked processing of IL-1
precursor by recombinant or native ICE. The initial
biochemical characterization of the inhibitory activity showed that it is heat-labile, has a molecular size of 50-100 kD, and is associated to the cell membrane compartment. Inhibition of
processing, i.e., activation of IL-1
precursor by SMC may constitute a novel regulatory
mechanism during normal vascular biology or pathogenesis of vascular diseases.
IL-1 is a major mediator in the pathogenesis of chronic
and acute inflammatory diseases, regulating multiple functions such as proliferation, differentiation, and activation of
various cell types. Originally, IL-1 was considered to be released exclusively by activated monocytes (1). These cells
express both the IL-1 Proteolytic maturation of the IL-1 Most of the studies investigating the expression of both
IL-1 and ICE have focused on monocytes or monocytederived cell lines. However, recent research has indicated
that active participation of vascular SMC and EC in local
immune and inflammatory responses may also be mediated
by IL-1. The responses of vascular cells to IL-1 include increased expression of adhesion molecules (18, 19) or induction of the proinflammatory cytokines IL-6 (20), IL-8
(24, 25), or IL-1 itself (26, 27). Furthermore, early atherosclerotic lesions have many characteristics in common with inflammatory lesions (28) and may, thus, also be influenced by IL-1. These findings suggest that during local regulatory
processes under physiological or pathological conditions the
cytokine IL-1 may be of major importance. We have previously shown that SMC produce IL-1 activity, but do not
release this mediator (29). The cell-associated IL-1 activity
mainly consists of IL-1 Materials.
Recombinant human mature interleukin-1 Isolation and Culture of Human Vascular Cells and Leukocytes.
Human vascular SMC and EC were isolated from saphenous veins
and cultured as described previously (22). Both cell types were
subcultured after trypsinization (0.05:0.02% trypsin/EDTA solution; Biochrom, Berlin, Germany) in 75-cm2 culture flasks (Dunn
Labortechnik GmbH, Asbach, Germany) and used throughout
passages 2-6. Culture media (M199, DMEM; both from Biochrom) contained <10 pg LPS/ml and FCS (Life Technologies Inc., Berlin, Germany) <50 pg LPS/ml as determined by the Limulus amoebocyte lysate assay (QLC-1000; BioWhittaker, Inc.,
Walkersville, MD). SMC were characterized by staining with
anti-smooth muscle cell Biochemical Methods.
To charactererize the ICE inhibitory activity of SMC supernatants were analyzed in ultrafiltration and
centrifugation experiments. For ultrafiltration, supernatants were
precleared by filtration through 0.2-µm filters. Subsequently, nitrogen-driven ultrafiltration of supernatants through YM membranes was performed in ultrafiltration devices as suggested by the
manufacturer (Amicon GmbH, Witten, Germany). Aliquots of the
filtrates or concentrates were collected and analyzed in the processing assay. To investigate the localization of the inhibitory activity, centrifugation experiments were performed. Supernatants or
cells were obtained as described above. Part of the cells was incubated with digitonin (0.007%, 60 min; 31). Subsequently these
preparations were centrifuged (10 min, 20,000 g) and the resultant pellet (Dig-Cell) or supernatant (Dig-SN) was analyzed in the
processing assay.
Preparation of Recombinant Proteins.
Recombinant IL-1 Table 1.
Fluorescin-labeled Primers Used for RT-PCR and Sequencing
Processing Assay and Western Blot.
For processing, 15 µl of recombinant ICEP30 (0.4 µg/ml) were incubated with 15 µl of the
respective precursor protein (10 µg/ml) in processing buffer (final
concentrations: 10 mM Hepes, 1 mM DL-dithiotreitol, 10% glycerol; all from Sigma-Aldrich Chemie GmbH, Deisenhofen, Germany). For inhibition studies, cell lysates or culture supernatants
(15 µl) were preincubated (37°C for 10 min) with the IL-1 NH2-terminal Amino Acid Sequencing.
Amino terminal sequence
analysis was performed on a pulsed liquid sequencer (model 473A;
Applied Biosystems Inc., Foster City, CA; 32). In brief, after
electroblotting, the membrane was washed in double-distilled
water (30 min), stained by 0.1% (wt/vol) Coomassie R-250
(Serva Feinbiochemica GmbH & Co., KG, Heidelberg, Germany) in 50% (vol/vol) methanol (10 min), destained in methanol (50%), and air dried. Protein spots containing the proteins to be analyzed were cut out. Microsequencing was performed by Edman degradation using a protein sequencer (473 A) with an online phenylthiohydantoin amino acid analyzer (both from Applied Biosystems Inc.).
It has been previously described that human
vascular SMC and EC express IL-1 activity. However, this
IL-1 activity has not been characterized biochemically. In
Western blot analysis we found that stimulated (IL-1/TNF)
human SMC and EC express both IL-1 isoforms (IL-1
As shown above, SMC
cannot process the recombinant IL-1 Since the failure of SMC to process recombinant IL-1 The findings discussed and presented above demonstrate that SMC express the IL-1
Experiments were performed to initially characterize the
ICE inhibitory activity. Fig. 4 A shows that ICE processes
the recombinant precursor molecule (None) and that an untreated supernatant of SMC was able to block this activity.
However, the inhibition of the processing activity by the
supernatant of SMC was reversed by prior heat treatment
of the SMC supernatant. Similar results were obtained when
cell preparations of SMC were subjected to heat treatment
(data not shown). We also characterized the molecular size
of this inhibitory activity in ultrafiltration experiments with
filters of 100-, 50-, and 30-kD cutoff (Fig. 4 B). The SMC supernatant used (SN) in these experiments blocked IL-1
This report provides evidence that human vascular SMC
express IL-1 To study the lack of mature IL-1 These investigations raised the third question: Do SMC
express an ICE inhibitory activity? We found that cultured
SMC constitutively expressed an inhibitory activity, blocking the processing of recombinant IL-1 Although ICE was characterized as the protease that cleaves
the inactive precursor of IL-1 Reporting here on the expression of immunoreactive
ICE protein in human vascular SMC and EC as well as the
expression of an ICE inhibitory activity in SMC, we provide novel information regarding the capacity of vascular
cells to control and regulate normal vascular biology as well
as vascular pathogenesis. Both expression of IL-1
and IL-1
isoform as 33-kD precursor proteins (2). The IL-1 precursor molecules do not
contain a hydrophobic leader sequence as described for
most secreted proteins and are not released through the established secretory pathways in monocytes. The IL-1 precursors are enzymatically processed into mature 17-kD IL-1.
In contrast to the IL-1
precursor, the 33-kD form of IL-1
is biologically inactive, or at least much less active than mature IL-1
, since only processed IL-1
binds detectably to
the IL-1 receptor (5). Two distinct IL-1 receptors have
been characterized. The type I receptor was originally
found on T cells and fibroblasts (6), whereas the type II receptor is the predominant form found on B cells, monocytes, and neutrophils (7). It has been reported that endothelial cells (EC)1 express IL-1 receptor type I (8) and that
vascular smooth muscle cells (SMC) express specific IL-1
binding sites (9).
precursor into the
active 17-kD form results from cleavage due to an endoproteinase denoted IL-1
-converting enzyme (ICE; 10, 11).
ICE was isolated and cloned from cells of the monocytic
lineage. Enzymatic and crystallographic studies have shown
that ICE contains a cysteine at its active site (a QACRG
motif ), which participates in substrate binding and catalysis
(12, 13). ICE is synthesized as a precursor molecule of 45 kD
and autocatalytically processed to form an active homodimeric enzyme of 20- and 10-kD subunits ([p20/
p10]2). Although both the 45-kD precursor protein and active ICE are detected in the cytoplasm, only active ICE is
also localized on the cell surface membrane (14). The active
cysteine protease specifically cleaves the 33-kD IL-1
precursor at the Asp116-Ala117 as well as the Asp27-Gly28 site to
yield 17- and 28-kD proteins, respectively, but does not
cleave the IL-1
precursor. Recently, additional substrates for
ICE, the YAMA/CPP32 proteins, have been identified (15, 16). ICE and the serine protease granzyme B, which can
also cleave YAMA/CPP32 (17), are the only known mammalian proteases cleaving after Asp.
, which may serve as an activator
of adjacent cells, as suggested before (29). In this report, we
describe that SMC expressed IL-1
precursor protein. To
contribute to regulatory mechanisms, the inactive IL-1
precursor produced by SMC has to be processed, i.e., activated by its specific processing enzyme ICE. However, it
was unclear whether or not SMC express functionally active ICE. We, therefore, analyzed the expression and function of ICE in vascular SMC and EC in vitro. We report
here that SMC and EC express ICE; SMC, however, fail to
cleave recombinant IL-1
precursor, probably due to the
expression of an ICE inhibitory activity.
, mature IL-1
, and TNF-
were a gift of Dr. H. Gallati (Hoffmann
La-Roche Inc., Basel, Switzerland). Wild-type LPS of Salmonella
friedenau was provided by Dr. H. Brade (Research Center Borstel,
Borstel, Germany). Rabbit polyclonal antisera directed against IL-1
(L1), IL-1
(L4), or ICE (
-ICEP20) were generated by immunization with recombinant human mature IL-1
, mature IL-1
, or the
ICE 20-kD subunit (ICEP20), respectively. The anti-IL-1
251-269
antibody (Fib 3) was raised as described elsewhere (30).
-actin antibody (HHF35; Dako Diagnostika, Hamburg, Germany), and EC by staining with anti-vWF
antibody (Dako). Monocytes were isolated from freshly prepared
human PBMC by counterflow centrifugation. For this purpose,
PBMC isolated by Ficoll-Hypaque (Pharmacia, Uppsala, Sweden)
density gradient centrifugation were resuspended in HBSS plus
0.1% BSA and loaded into the standard chamber of the JE-6B
elutriator system (Beckman Instrs. GmbH, München, Germany) at an initial flow rate of 25 ml/min, with the rotor speed being 1,720 g (12°C). Subsequently, the flow rate was increased stepwise to obtain elutriated monocyte fractions. Purity of the monocytes was
98% as determined by FACS® analysis. Granulocytes
were isolated and characterized as described previously (24).
and
IL-1
precursor as well as ICE proteins were cloned into the
pQE-30 vector, expressed in Escherichia coli, and purified by affinity chromatography using Ni-NTA-resin (Qiagen, Chatsworth,
CA). For this purpose, mRNA isolation and reverse transcription
(RT) were performed as described previously (24). Inserts were
generated by RT-PCR using the primers described in Table 1.
These primers introduced BamHI and PstI restriction sites into
the PCR products to permit cloning into the pQE-30 vector.
The resultant plasmids were transformed into the competent E. coli strain M15(pREP4) (GIBCO BRL, Gaithersburg, MD) by
MgCl2 treatment. Plasmid sequences of transformants were verified by DNA sequencing. The recombinant proteins were isolated
from the bacteria according to the procedure suggested by the
manufacturer (Qiagen). The recombinant proteins were characterized in Western blot, processing assay, and NH2-terminal sequence analysis. The recombinant IL-1
and IL-1
precursor
molecules showed the expected molecular mass of 33 kD (2)
and contained the correct (10) NH2-terminal sequence. Recombinant ICEP20 (compare Fig. 2) and ICEP30 showed major bands
of ~20 or 30 kD, respectively, and also contained the correct
NH2-terminal sequences (10). ICEP30 specifically processed the
IL-1
, but not the IL-1
precursor, in a concentration-dependent manner. The apparent molecular weights of the processed
IL-1
fragments corresponded to the data reported by other
groups (10, 11).
Specificity
Sense*
Antisense*
Size

bp
IL-1

ATAT GGATCC GCCAAAGTTCCAGACAT
ATAT CTGCAG CTACGCCTGGTTTTCCAGTA
810
IL-1

ATAT GGATCC ATGGCAGAAGTACCTGAGCTC
ATAT CTGCAG TTAGGAAGACACAAATTGCAT
816
ICEP30
ATAT GGATCC GACAACCCAGCTATGCCC
ATAT CTGCAG ATGTCCTGGGAAGAGGTA
350
pQE-30
GAATTCATTAAAGAGGAGAAA
ATCCAGATGGAGTTCTGAGG
840
*
Sequences are given in 5
- to 3
-end orientation. The sequences for restriction sites are in italics.
Size of the expected PCR product in basepairs (bp).
Fig. 2.
Expression of immunoreactive ICE by human vascular SMC
and EC. Supernatants (SN) or lysates (Ly; 2.5 × 104 cells/µl) of unstimulated (
) or TNF-
-stimulated (+; 50 ng/ml) human vascular SMC or
EC, as well as unstimulated (
) or LPS-stimulated (+; 1 µg/ml) monocytes (MØ) were separated by SDS-PAGE and analyzed by Western blot
for ICE expression (
-ICEP20, 1:300). The right lane shows the recombinant ICEP20 protein used for immunization. Similar results were obtained
in five independent experiments.
[View Larger Version of this Image (47K GIF file)]
precursor before the addition of recombinant ICEP30, as well as granulocyte or monocyte extracts. All assays were performed in a final
volume of 50 µl. After 15 min of incubation (37°C), processing
was stopped by addition of SDS-PAGE sample buffer (10 µl; 1 M
Tris, 25% glycerol, 0.5% SDS, 15% 2-mercaptoethanol, 0.1 mg/
ml bromphenol blue) and heating the samples (70°C for 30 min).
Finally, the samples were analyzed in Western blot. For this purpose, samples were separated by standard SDS-PAGE under reducing conditions and blotted to polyvinylidene difluoride membranes (0.6 mA for 15 h; ImmobilonTM-P; Millipore GmbH, Eschborn,
Germany). The blots were blocked with 0.05% Tween 20 and
0.01% merthiolate in PBS (30 min) and subsequently incubated in
PBS containing 0.05% Tween 20, 15% bovine serum (Sigma-Aldrich Chemie GmbH), and the respective monoclonal or polyclonal
antibody. After 1 h, peroxidase-conjugated goat anti-mouse or
goat anti-rabbit antibody (both 1:2,000; Dianova GmbH, Hamburg, Germany) was added for another hour. The blots were washed
three times with PBS/0.05% Tween 20 after each incubation step.
Finally, diaminobenzidine (50 µg/ml; Sigma Chemical Co.) in substrate buffer (17 mM citric acid, 65 mM NaH2PO4, 0.1% H2O2, 0.01% [wt/vol] thimerosal) was added.
Human Vascular SMC Express but Do Not Process the IL-1
Precursor.
and IL-1
) cell associated as 33-kD precursor molecules.
IL-1
, however, is only active as the processed mature 17-kD
form. Thus, we investigated whether cell preparations or culture supernatants of SMC or EC can convert the recombinant IL-1
precursor into the mature form. Culture
supernatants of SMC or EC did not cleave the recombinant
IL-1
or IL-1
precursor into detectable products (Fig. 1).
However, incubation of the IL-1
precursor with lysates of
SMC or EC resulted in the detection of a cleavage product
with an apparent molecular mass of 17 kD, as expected for
mature IL-1
. In contrast, the IL-1
precursor was solely
converted by EC, but not by SMC lysates. Incubation of
the recombinant IL-1
precursor with EC lysates resulted
in cleavage products comparable in molecular weight to the
IL-1 proteins detected upon processing by monocytes,
which are known to express active ICE (data not shown).
NH2-terminal sequencing of the larger cleavage product
revealed the expected amino acid sequence (Ala-Pro-ValArg-Ser-Leu-Asn-?-Thr-Leu-Arg-Asp-Ser) identical to the
NH2 terminus of mature IL-1
expressed in monocytes (3). The NH2-terminal sequence of the smaller product
corresponded to the mature sequence lacking the first eight
amino acids. In contrast to EC, granulocytes, and monocytes, SMC did not process the recombinant IL-1
precursor under any condition tested, i.e., at a lysate concentration of up to 250,000 cells/µl or further stimulation (10 ng/ml IL-1
, 1 µg/ml LPS).
Fig. 1.
Human vascular SMC,
in contrast to EC, do not process recombinant IL-1
precursor. Recombinant IL-1
or IL-1
precursor (10 µg/ml, 15 µl) was incubated (37°C,
15 min) with processing buffer alone
(pIL-1
/pIL-1
), culture supernatants (SN; 15 µl), or cell lysates (Ly;
2.5 × 104 cells/µl, 15 µl) of unstimulated (
) or TNF-
-stimulated (+; 50 ng/ml) vascular SMC or unstimulated EC. The products were separated by SDS-PAGE and analyzed by
Western blot with the respective antibody (IL-1
: Fib 3, 1:1,000; IL-1
:
L4, 1:500). For control, the recombinant mature IL-1 isoforms (mIL-1
/
mIL-1
) were included. Similar results were obtained in four independent experiments.
[View Larger Version of this Image (37K GIF file)]
precursor. Thus, we
investigated potential reasons for the lack of IL-1
processing, including sequence analysis of SMC-derived IL-1
, as
well as expression of ICE. With regard to the cDNA and
amino acid sequence analysis, it was unlikely that an altered
sequence of the IL-1
precursor expressed in SMC was responsible for the lack of processing, since its cDNA sequence was identical to the sequence published for monocyte-derived IL-1
(data not shown). In addition, NH2
terminus sequencing of the native 33-kD IL-1
protein
obtained from vascular SMC revealed the same amino acid sequence as described for the IL-1
precursor produced by
monocytes (3).
precursor could also be due to the absence of ICE in these
cells, we investigated ICE expression in SMC and EC. RTPCR experiments provided evidence that vascular cells express ICE mRNA constitutively (data not shown). Furthermore, cycle sequencing demonstrated that the sequence of
SMC- or EC-derived ICE cDNA was identical to the sequence of monocytic ICE cDNA (data not shown). In line
with the expression of ICE mRNA, Western blot experiments showed that SMC and EC express immunoreactive
ICE protein constitutively (Fig. 2). Stimulation of the cells
with TNF-
(50 ng/ml; +) did not detectably alter the
number or intensity of the stained bands. In further experiments, stimulation of the cells with IL-1
, IL-1
, or LPS
did not alter these findings (data not shown). Vascular cells
expressed only cell-associated ICE, similar to monocytes.
However, vascular cells expressed a different pattern of immunoreactive ICE proteins than monocytes. Cell preparations of SMC or EC contained bands with an apparent molecular mass of 22 and 30 kD, as well as a faint band
possessing an apparent molecular mass of 45 kD. EC expressed the 22-kD protein as a double band. In contrast,
control lysates of monocytes expressed a prominent band
with an apparent molecular mass of 45 kD.
Precursor
by ICE.
precursor and ICE, but
do not process recombinant IL-1
precursor. Therefore, we
investigated whether vascular SMC may inhibit ICE activity. We report here that supernatants or lysates of vascular
SMC block the enzymatic activity of recombinant or native ICE. Preincubation of the recombinant IL-1
precursor with extracts of unstimulated SMC before the processing assay resulted in a concentration-dependent inhibition
of processing (Fig. 3). Lysates containing
200 SMC/µl did
not block the processing of the precursor, whereas cell
concentrations of
25,000 SMC/µl completely blocked
processing. In addition, prolonged incubation with ICEP30
(up to 30 min) did not lead to appearance of processed bands. In contrast, simultaneous addition of IL-1
precursor and lysates to the recombinant ICEP30 resulted in detection of faint bands of cleavage products. Further experiments showed that supernatants of SMC also contained
ICE inhibitory activity (compare Fig. 4). SMC preparations
did not only interfere with processing by the recombinant
ICEP30, they also inhibited processing of the recombinant IL-1
precursor by native ICE as present in monocyte or
granulocyte lysates (data not shown). In contrast to SMC
lysates, preincubation of IL-1
precursor with lysates of EC
(or fibroblasts, data not shown) did not inhibit the ICEP30
activity (Fig. 3), indicating the specificity of the inhibition.
Fig. 3.
Processing of the recombinant IL-1
precursor by ICEP30 is specifically inhibited by human vascular SMC. Recombinant IL-1
precursor (10 µg/ml,
15 µl) was preincubated for 10 min (37°C) with 15 µl
of processing buffer alone (Lysate,
) or cell lysates of
vascular SMC or EC at the designated concentrations.
Subsequently, the preparations were incubated (37°C,
15 min) with (+) or without (
) recombinant ICEP30
(0.4 µg/ml, 15 µl). The products were separated by
SDS-PAGE and analyzed by Western blot with the IL-1
-
specific antibody (Fib 3, 1:1,000). Similar results were
obtained in seven independent experiments.
[View Larger Version of this Image (34K GIF file)]
Fig. 4.
The ICE inhibitory activity of human vascular SMC is heatlabile and expresses a molecular size of 50-100 kD. (A) Heat treatment reverses the inhibitory activity of the ICE inhibitor. Recombinant IL-1
precursor (10 µg/ml, 15 µl) was incubated (37°C, 15 min) with heattreated (Heated; 70°C, 30 min) or untreated supernatants (15 µl). Immediately thereafter, recombinant ICEP30 (0.4 µg/ml, 15 µl) was added. All
samples were separated by SDS-PAGE and analyzed by Western blot with
the IL-1
-specific antibody (Fib 3, 1:1,000). Similar results were obtained in two independent experiments. (B) Ultrafiltration of inhibitory
SMC supernatants. The supernatant of SMC was filtered through 0.2 µm
filters and a 100-kD cutoff filter. This preparation was applied to 50-kD
cutoff ultrafiltration (50 conc). The run-through (50 run) of this preparation was then filtered through a 30-kD cutoff filter and the concentrate
was collected (30 conc). These samples (15 µl) were tested in the processing assay as described above. Three similar experiments were performed.
[View Larger Version of this Image (31K GIF file)]
processing by ICE. The filtrate of a 100-kD cutoff filter
was still inhibitory (data not shown). This filtrate was then
applied to a 50-kD cutoff ultrafiltration. The figure shows
that the obtained 50-kD concentrate (50 conc) potently inhibited the ICE processing. In contrast, the 50-kD filtrate
(50 run) or the subsequent 30-kD concentrate (30 conc) did
not inhibit the ICE activity, suggesting that the inhibitory
activity is larger than 50 kD, but smaller than 100 kD. To
investigate the localization of the putative inhibitor in the
cell preparations, the cells were applied to digitonin treatment. Cytosolic proteins are expected in the supernatant of
digitonin-treated cells, whereas membrane-associated molecules are expected in the resulting pellet. The presented
experiment (Fig. 5) shows that a supernatant of SMC inhibited the processing to some degree, and that the corresponding cell extract completely blocked processing. An
aliquot of the cells was treated by digitonin, which permeabilizes cells and releases cytosolic proteins from the cells.
However, the supernatant (Dig-SN) obtained after centrifugation of the digitonin-treated cells did not contain inhibitory activity. In contrast, the pellet of the so-treated cells
(Dig-Cell) inhibited the IL-1
processing as potently as cell
preparations of the untreated SMC. In additional experiments, centrifugation supernatants of sonified cells also did
not block processing (data not shown). These data suggest
that the putative inhibitor is localized in cell membranes
rather than in the cytoplasm.
Fig. 5.
ICE inhibitory activity of SMC is membrane associated. The
supernatant (SN) of SMC was collected, the cells were trypsinized, washed,
and half of the cells was lysed by freeze-thaw cycles (Cell). The other part
of the cells was treated by digitonin (0.007%) and centrifuged (20 min,
20,000 g). The supernatant (Dig-SN) and the remaining pellet (Dig-Cell)
of this centrifugation were collected. For inhibition assay, these samples
were incubated with recombinant IL-1
precursor (10 µg/ml, 15 µl),
and subsequently with recombinant ICEP30 (0.4 µg/ml, 15 µl). The
products were separated by SDS-PAGE and analyzed by Western blot
with the IL-1
-specific antibody (Fib 3, 1:1,000). Similar results were
obtained in two independent experiments.
[View Larger Version of this Image (41K GIF file)]
precursor and ICE, but lack the capacity to
process the IL-1
precursor, probably due to the presence
of an ICE-inhibitory activity. The IL-1
precursor is thought
to be the major cell-associated IL-1 isoform and, therefore,
mediates activation of neighboring SMC (29). In contrast,
activation of IL-1
precursor requires enzymatic processing
of the precursor molecule. As shown in this report, vascular
SMC, in contrast to EC, do not process the recombinant IL-1
precursor and therefore, likewise do not process the
native protein. Under the conditions used, we did not detect any mature IL-1
in SMC. The detection limit of the
Western blot may have contributed to this result, but even
in sensitive biological test systems (data not shown), we
could not detect IL-1
activity in the supernatants of
SMC. Nevertheless, the processing studies with recombinant IL-1
precursor indicated that the lack of mature IL-1
in SMC probably results from the lack of processing activity in these cells and is not simply a failure to detect the
mature protein.
in more detail we
raised three questions. (a) Is the lack of processing of IL-1
due to a sequence that cannot be cleaved by ICE? This explanation does not pertain. SMC, like EC, express the IL-1
precursor identical in its cDNA sequence, molecular weight,
and NH2-terminal amino acid sequence to monocyte-derived
IL-1
. (b) Do SMC lack ICE? This report demonstrates
that SMC and EC express the ICE, identical in its cDNA
sequence to the sequence published for monocyte-derived ICE. Furthermore, there is no evidence that SMC express a
nonfunctional ICE mRNA, since its in vitro expression, as
shown in this report, resulted in a specifically active enzyme
(ICEP30). Under the conditions tested, neither mRNA, nor
protein expression of the enzyme, is detectably altered in
stimulated SMC or EC. This finding is in line with the report of an unchanged amount of ICEP45 in monocytes after
LPS stimulation (33). However, the immunoreactive forms of IL-1
convertase detected in SMC and EC show a different expression pattern than monocyte-derived ICE. In
our tests, monocytes expressed ICE as a major protein band
with an apparent molecular mass of 45 kD. A similar form
of ICE is described by Ayala et al. (33). In contrast, vascular
SMC or EC expressed two detectable immunoreactive ICE
proteins of lower molecular mass and a weak band at 45 kD that migrates at the same size as the one found in monocytes. The ICE protein of SMC expressing an apparent molecular mass of 30 kD may result from incomplete autocatalysis, whereas the 22-kD immunoreactive ICE protein may
represent the ICEP20 subunit of the homodimeric enzyme.
The used ICE antibody did not detect the 10-kD subunit,
since it was raised against the ICEP20 subunit and, therefore,
does not bind to the ICEP10 subunit.
precursor by recombinant ICE, as well as granulocyte or monocyte lysates
used as a source of native ICE. As far as we are aware, this
is the first report describing a physiological cell-derived ICE
inhibitor. Previously, other groups have shown inhibition
by synthetic peptides (i.e., YVAD; reference 10) as well as
viral inhibitors (crmA or baculovirus p35; references 34 and
35), and discussed them as potential therapeutic agents. Furthermore, Boudreau et al. (36) reported a correlation between ICE activity and expression of extracellular matrix in
epithelial cells. Other authors demonstrated the expression
of enzymatically inactive homologues of ICE in insect cells,
resulting from alternatively spliced mRNA forms as derived
from monocytic cell lines (37). One of these homologues, a
10-kD fragment, competed with the ICEP10 subunit for binding to ICEP20, thereby inhibiting processing of the IL-1
precursor by ICE. Bump et al. (35) demonstrated that equimolar amounts of a recombinant baculovirus protein inhibited the activity of purified ICE, and that inhibition is accompanied by a cleavage of the ICEP30 subunit to 22- and
10-kD fragments, which build stable complexes with ICE,
thereby inactivating it. At present, we cannot rule out such
possibilities; however, our data show that the inhibitory activity found in SMC expresses a molecular mass of 50-100
kD, and fractions containing proteins smaller than 30 kD, as
those suggested by Bump et al. (35) and Alnemri et al. (37),
were not inhibitory. The initial biochemical characterization also indicated that the inhibitory activity resides in the
membrane compartment of the cells. It has been shown
previously that active ICE is located in the membranes
(14). Thus, a colocalization with an inhibitory molecule at
the membrane could explain the lack of processing in
SMC. The heat sensitivity of the inhibitory activity provided further evidence that it may be a protein.
to yield the active cytokine, its possible connection to cell death only emerged from
cloning of the Caenorhabditis elegans death gene ced-3 (38).
Striking evidence that ICE family proteases are part of the
apoptotic pathway is coming from studies demonstrating
that inhibitors of these proteases block some of the apoptotic pathways (39), although ICE probably is not the only
protein involved. However, the finding that certain cells of
the vascular vessel wall express an inhibitor for a member
of the apoptotic pathway may be the beginning of further
studies investigating the regulation of apoptotic events in
the vessel wall, i.e., during pathological processes such as atherosclerosis (40, 41).
precursor, probably serving as a reservoir to be activated by processing capacities of infiltrating leukocytes, and expression of ICE in SMC or EC might be of major importance for
the regulation of vascular diseases.
Address correspondence to Dr. H. Loppnow, Department of Immunology and Cell Biology, Center for Medicine and Biosciences, Research Center Borstel, Parkallee 22, 23845 Borstel, Germany. U. Schönbeck's present address is Vascular Medicine and Atherosclerosis Unit, Department of Medicine, Brigham & Women's Hospital, Harvard Medical School, 221 Longwood Ave., Boston, MA 02115.
Received for publication 21 October 1996 and in revised form 24 January 1997.
1Abbreviations used in this paper: EC, endothelial cells; ICE, IL-1
-converting enzyme; RT, reverse transcription; SMC, smooth muscle cells.
We thank Drs. A. Haverich and K. Hirt (Kiel University, Kiel, Germany) for providing saphenous vein specimens, and Dr. M. Ernst, D. Heinrich, and E. Kaltenhäuser for providing us with elutriated monocytes. The
kind gift of S. friedenau LPS by Dr. H. Brade and of recombinant mature IL-1
, IL-1
, and TNF-
by Dr.
H. Gallati (Hoffmann La-Roche Inc., Basel, Switzerland) is gratefully acknowledged. We are grateful to G. Tillmann and S. Bark for their expert technical assistance.
This work was supported by grants of the Deutsche Forschungsgemeinschaft to Dr. H. Loppnow (Lo 385/ 4-1) and to Dr. U. Schönbeck (Scho 614/1-1).
| 1. | Gery, I., R.K. Gershon, and B.H. Waksman. 1972. Potentiation of the T-lymphocyte response to mitogens. I. The responding cell. J. Exp. Med. 136: 128-142 [Medline]. [Abstract] |
| 2. | Lomedico, P.T., U. Gubler, C.P. Hellmann, M. Dukovitch, J.G. Giri, Y.-C.E. Pan, K. Collier, R. Semionow, A.O. Chua, and S.B. Mizel. 1984. Cloning and expression of murine interleukin-1 cDNA in Escherichia coli. Nature (Lond.). 312: 458-462 [Medline]. [Medline] |
| 3. |
Auron, P.E.,
A.C. Webb,
L.J. Rosenwasser,
S.F. Mucci,
A. Rich,
S.M. Wolff, and
C.A. Dinarello.
1984.
Nucleotide sequence of human monocyte interleukin-1 precursor cDNA.
Proc. Natl. Acad. Sci. USA.
81:
7907-7911
[Medline].
|
| 4. | March, C.J., B. Mosley, A. Larsen, D.P. Cerretti, G. Braedt, V. Price, S. Gillis, C.S. Henney, S.R. Kronheim, K. Grabstein, et al . 1985. Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature (Lond.). 315: 641-647 [Medline]. [Medline] |
| 5. |
Mosley, B.D.,
S.K. Dower,
S. Gillis, and
D. Cosman.
1987.
Determination of the minimum polypeptide lengths of the
functionally active sites of human interleukins-1 and-1 .
Proc. Natl. Acad. Sci. USA.
84:
4572-4576
.
|
| 6. |
Dower, S.K.,
S.R. Kronheim,
T.P. Hopp,
M. Cantrell,
M. Deeley,
S. Gillis,
C.S. Henney, and
C.S. Urdal.
1986.
The
cell surface receptors for interleukin-1 und interleukin-1
are identical.
Nature (Lond.).
324:
266-268
[Medline].
[Medline] |
| 7. | MacMahan, C.J., J.L. Slack, B. Mosley, D. Cosman, S.D. Lupton, L.L. Brunton, C.E. Grubin, J.M. Wignall, N.A. Jenkins, C.I. Brannan, et al . 1991. A novel IL-1 receptor, cloned from B cells by mammalian expression, is expressed in many cell types. EMBO (Eur. Mol. Biol. Organ.) J. 10: 2821-2832 . [Medline] |
| 8. | Akeson, A.L., L.B. Mosher, C.W. Woods, K.K. Schröder, and T.L. Bowlin. 1992. Human aortic endothelial cells express the type I but not the type II receptor for interleukin-1 (IL-1). J. Cell. Physiol. 153: 583-588 [Medline]. [Medline] |
| 9. | French, J.F., K.K. Schröder, A.L. Akeson, R.C. Dage, and T.L. Bowlin. 1993. Identification of a specific receptor for interleukin-1 in vascular smooth muscle cells: regulation by IL-1 and IL-6. Eur. J. Pharmacol. 233: 109-112 [Medline]. [Medline] |
| 10. |
Thornberry, N.A.,
H.G. Bull,
J.R. Calaycay,
K.T. Chapman,
A.D. Howard,
M.J. Kostura,
D.K. Miller,
S.M. Molineaux,
J.R. Weidner,
J. Aunins, et al
.
1992.
A novel heterodimeric
cysteine protease is required for interleukin-1 processing in
monocytes.
Nature (Lond.).
356:
768-774
[Medline].
[Medline] |
| 11. |
Cerretti, D.P.,
C.J. Kozlosky,
B. Mosley,
N. Nelson,
K. van
Ness,
T.A. Greenstreet,
C.C. March,
S.R. Kronheim,
T. Druck,
L.A. Cannizzaro, et al
.
1992.
Molecular cloning of the
interleukin-1 converting enzyme.
Science (Wash. DC).
256:
97-100
[Medline].
|
| 12. |
Walker, N.P.C.,
R.V. Talanian,
K.D. Brady,
L.C. Dang,
N.J. Bump,
C.R. Ferenz,
S. Franklin,
T. Ghayur,
M.C. Hackett,
L.D. Hammill, et al
.
1994.
Crystal structure of the
cysteine protease interleukin-1 -converting enzyme: a (p20/
p10)2 homodimer.
Cell.
78:
343-352
.
[Medline] |
| 13. |
Wilson, K.P.,
J.-A.F. Black,
J.A. Thomson,
E.E. Kim,
J.P. Griffith,
M.A. Navia,
M.A. Murcko,
S.P. Chambers,
R.A. Aldape, et al
.
1994.
Structure and mechanism of interleukin-1 -
converting enzyme.
Nature (Lond.).
370:
270-274
[Medline].
[Medline] |
| 14. |
Singer, I.I.,
S. Scott,
J. Chin,
E.K. Bayne,
G. Limjuco,
J. Weidner,
D.K. Miller,
K. Capman, and
M.J. Kostura.
1995.
The interleukin-1 -converting enzyme (ICE) is localized on
the external cell surface membranes and in the cytoplasmatic
ground substance of human monocytes by immuno-electron
microscopy.
J. Exp. Med.
182:
1447-1459
[Medline].
|
| 15. |
Tewari, M.,
L.T. Quan,
K. O'Rourke,
S. Desnoyers,
Z. Zeng,
D.R. Beidler,
G.G. Poirier,
G.S. Salvesen, and
V.M. Dixit.
1995.
Yama/CPP32 , a mammalian homolog of CED-3,
is a crmA-inhibitable protease that cleaves the death substrate
poly(ADP-ribose) polymerase.
Cell.
81:
801-809
[Medline].
[Medline] |
| 16. | Nicholson, D.W., A. Ali, N.A. Thornberry, J.P. Vaillancourt, C.K. Ding, M. Gallant, Y. Gareau, P.R. Griffin, M. Labelle, Y.A. Lazebnik, et al . 1995. Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis. Nature (Lond.). 376: 37-43 [Medline]. [Medline] |
| 17. |
Quan, L.T.,
M. Tewari,
K. O'Rourke,
V. Dixit,
S.J. Snipas,
G.G. Poirier,
C. Ray,
D.J. Pickup, and
G.S. Salvesen.
1996.
Proteolytic activation of the cell death protease Yama/CPP32
by granzyme B.
Proc. Natl. Acad. Sci. USA.
93:
1972-1976
[Medline].
|
| 18. | Dustin, M.L., R. Rothlein, A.K. Bhan, C.A. Dinarello, and T.A. Springer. 1986. Induction by IL-1 and interferongamma: tissue distribution, biochemistry, and function of a natural adherence molecule (ICAM-1). J. Immunol. 137: 245-254 [Medline]. [Abstract] |
| 19. | Bevilacqua, M.P., J.S. Pober, G.R. Majeau, R.S. Cotran, and M.A. Gimbrone Jr.. 1985. Interleukin-1 acts on cultured human vascular endothelium to increase the adhesion of polymorphonuclear leukocytes, monocytes and related leukocyte cell lines. J. Clin. Invest. 76: 2003-2011 [Medline]. |
| 20. | Jirik, F.R., T.J. Podor, T. Hirano, T. Kishimoto, D.J. Loskutoff, D.A. Carson, and M. Lotz. 1989. Bacterial lipopolysaccharides and inflammatory mediators augment IL-6 secretion by human endothelial cells. J. Immunol. 142: 144-147 [Medline]. [Abstract] |
| 21. | Sironi, M., F. Breviario, P. Proserpio, A. Biondi, A. Vecchi, J. Van Damme, E. Dejana, and A. Mantovani. 1989. IL-1 stimulates IL-6 production in endothelial cells. J. Immunol. 142: 549-553 [Medline]. [Abstract] |
| 22. | Loppnow, H., and P. Libby. 1989. Adult human vascular endothelial cells express the IL-6 gene differentially in response to LPS or IL-1. Cell. Immunol. 122: 493-503 [Medline]. [Medline] |
| 23. | Loppnow, H., and P. Libby. 1990. Proliferating or interleukin 1-activated human vascular smooth muscle cells secrete copious interleukin-6. J. Clin. Invest. 85: 731-738 [Medline]. |
| 24. | Schönbeck, U., E. Brandt, F. Petersen, H.-D. Flad, and H. Loppnow. 1995. Interleukin-8 specifically binds to endothelial cells but not to smooth muscle cells. J. Immunol. 154: 2375-2383 [Medline]. [Abstract] |
| 25. |
Wang, J.M.,
A. Sica,
G. Peri,
S. Walter,
I.M. Padura,
P. Libby,
M. Ceska,
F. Colotta, and
A. Mantovani.
1991.
Expression of monocyte chemotactic protein and interleukin-8
by cytokine-activated human vascular smooth muscle cells.
Arterioscler. Thromb.
11:
1166-1174
[Medline].
|
| 26. | Libby, P., J.M. Ordovas, L.K. Birinyi, K.R. Auger, and C.A. Dinarello. 1986. Inducible interleukin-1 expression in human vascular smooth muscle cells. J. Clin. Invest. 78: 1432-1438 [Medline]. |
| 27. |
Warner, S.J.C.,
K.R. Auger, and
P. Libby.
1987.
Human interleukin-1 induces interleukin-1 gene expression in human
vascular smooth muscle cells.
J. Exp. Med.
165:
1316-1331
.
|
| 28. |
Ross, R.,
J. Masuda,
E.W. Raines,
A.M. Gown,
S. Katsuda,
M. Sasahara,
L.T. Malden,
H. Masuko, and
H. Sato.
1990.
Localization of PDGF-B protein in macrophages in all phases
of atherogenesis.
Science (Wash. DC).
248:
1009-1011
[Medline].
|
| 29. | Loppnow, H., and P. Libby. 1992. Functional significance of human vascular smooth muscle cell-derived interleukin-1 in paracrine and autocrine regulation pathways. Exp. Cell Res. 198: 283-290 [Medline]. [Medline] |
| 30. |
Herzbeck, H.,
B. Blum,
W. Rönspeck,
B. Frenzel,
E. Brandt,
A.J. Ulmer, and
H.-D. Flad.
1989.
Functional and
molecular characterization of a monoclonal antibody against
the 165-186 peptide of human IL-1 .
Scand. J. Immunol.
30:
549-562
[Medline].
[Medline] |
| 31. |
Fiskum, G.,
S.W. Craig,
G.L. Decker, and
A.L. Lehninger.
1980.
The cytoskeleton of digitonin-treated rat hepatocytes.
Proc. Natl. Acad. Sci. USA.
77:
3430-3434
[Medline].
|
| 32. |
Matsudaira, P..
1987.
Sequence from picomole quantities of
proteins electroblotted onto polyvinylidene difluoride membranes.
J. Biol. Chem.
262:
10035-10038
[Medline].
|
| 33. |
Ayala, J.M.,
T.-T. Yamin,
L.A. Egger,
J. Chin,
M.J. Kostura, and
D.K. Miller.
1994.
IL-1- converting enzyme is present
in monocytic cells as an inactive 45-kDa precursor.
J. Immunol.
153:
2592-2599
[Medline].
[Abstract] |
| 34. |
Ray, C.A.,
R.A. Black,
S.R. Kronheim,
T.A. Greenstreet,
P.R. Sleath,
G.S. Salvesen, and
D.J. Pickup.
1992.
Viral inhibition of inflammation: cowpox virus encodes an inhibitor of
the interleukin-1 -converting enzyme.
Cell.
69:
597-604
[Medline].
[Medline] |
| 35. |
Bump, N.J.,
M. Hackett,
M. Hugunin,
S. Seshagiri,
K. Brady,
P. Chen,
C. Ferenz,
S. Franklin,
T. Ghayur,
P. Li, et al
.
1995.
Inhibition of ICE family proteases by baculovirus
antiapoptotic protein p35.
Science (Wash. DC).
269:
1885-1888
[Medline].
|
| 36. |
Boudreau, N.,
C.J. Sympson,
Z. Werb, and
M.J. Bissell.
1995.
Suppression of ICE and apoptosis in mammary epithelial cells
by extracellular matrix.
Science (Wash. DC).
267:
891-893
[Medline].
|
| 37. |
Alnemri, E.S.,
T. Fernandes-Alnemri, and
G. Litwack.
1995.
Cloning and expression of four novel isoforms of human IL-1 -
converting enzyme with different apoptotic activities.
J. Biol.
Chem.
270:
4312-4317
[Medline].
|
| 38. |
Yuan, J.,
S. Shaham,
S. Ledoux,
H.M. Ellis, and
H.R. Horvitz.
1993.
The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1 -converting enzyme.
Cell.
75:
641-652
[Medline].
[Medline] |
| 39. | Enari, M., R.V. Talanian, W.W. Wong, and S. Nagata. 1996. Sequential activation of ICE-like and CPP32-like proteases during Fas-mediated apoptosis. Nature (Lond.). 380: 723-726 [Medline]. [Medline] |
| 40. | Geng, Y.-J., and P. Libby. 1995. Evidence for apoptosis in advanced human atheroma. Colocalization with ICE. Am. J. Pathol. 147: 251-266 [Medline]. [Abstract] |
| 41. | Han, D.K.M., C.C. Haudenschild, M.K. Hong, B.T. Tinkle, M.B. Leon, and G. Liau. 1995. Evidence for apoptosis in human atherogenesis and in rat vascular injury model. Am. J. Pathol. 147: 267-277 . [Abstract] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|