The Journal of Experimental Medicine
ReproCELL
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 144K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crowley, M. P.
Right arrow Articles by Chien, Y.-h.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crowley, M. P.
Right arrow Articles by Chien, Y.-h.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Exp. Med.
© The Rockefeller University Press
0022-1007/97/04/1223/08 $2.00
Volume 185, Number 7, April 7, 1997 1223-1230

The Recognition of the Nonclassical Major Histocompatibility Complex (MHC) Class I Molecule, T10, by the gamma delta T Cell, G8

By Michael P. Crowley,* Ziv Reich,Dagger Nasim Mavaddat,§ John D. Altman,§ and Yueh-hsiu Chien*§

From the * Program in Immunology; Dagger  The Howard Hughes Medical Institute; and the § Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, California 94305

Summary
Materials and Methods
Results
Discussion
Footnotes
Acknowledgements
References


Summary

Recent studies have shown that many nonclassical major histocompatibility complex (MHC) (class Ib) molecules have distinct antigen-binding capabilities, including the binding of nonpeptide moieties and the binding of peptides that are different from those bound to classical MHC molecules. Here, we show that one of the H-2T region-encoded molecules, T10, when produced in Escherichia coli, can be folded in vitro with beta 2-microglobulin (beta 2m) to form a stable heterodimer in the absence of peptide or nonpeptide moieties. This heterodimer can be recognized by specific antibodies and is stimulatory to the gamma delta T cell clone, G8. Circular dichroism analysis indicates that T10/beta 2m has structural features distinct from those of classical MHC class I molecules. These results suggest a new way for MHC-like molecules to adopt a peptide-free structure and to function in the immune system.


Classical MHC class I (class Ia) molecules possess a highly specialized groove occupied by short peptides that are acquired inside the cell during MHC heterodimer assembly. This peptide-MHC interaction not only contributes to the stability of the heterodimer on the cell surface, but forms the basis for its function, as complexes of intracellular pathogen derived peptides with MHC are the ligands for cytolytic alpha beta T cells. Recently, many nonclassical MHC class I molecules, such as those encoded in the Q, T, M, and CD1 regions, have been found to possess binding properties different from those of classical MHC molecules (as reviewed in references 1 and 2). These studies suggest that class Ib molecules have evolved for specific tasks that are distinct from those of classical class I MHC. For example, M3 and human CD1 have been proposed to play a special role in controlling microbial infection by binding and presenting N-formylated peptide and lipid antigens, respectively (3). Murine CD1 molecules have been shown to bind hydrophobic peptides and are thought to stimulate regulatory alpha beta T cells (8, 9). Some Qa molecules were found to bind mixtures of peptides with molecular properties different from those bound to classical MHC molecules (10, 11). Other Qa molecules have been suggested to have roles in the generation of regulatory T cells, as well as the elimination of bacterially infected cells (12, 13).

Although the majority of the cells that respond to class Ib ligands bear the alpha beta TCR, the H-2T-encoded T10 and the closely related T22 (94% identity) proteins were first identified as the ligands for two gamma delta T cells, KN6 and G8 (14- 16). G8 was generated by immunizing BALB/c nude mice with B10.BR spleen cells (17), whereas KN6 was derived from a C57BL/6 double-negative thymocyte (18). Attempts to derive alpha beta T cells specific for these molecules, using either cells naturally expressing T10/T22 or transfected with these genes as immunogen, have been unsuccessful (reference 19; Schild, H., and Y.-h. Chien, unpublished data). Analysis of the recognition of T10/T22 by G8 shows it to be clearly different from MHC class I recognition by alpha beta T cells. In particular, G8 can respond to stimulator cells that lack functional peptide-loading mechanisms for either MHC class I or class II molecules (15, 16, 19). All variations in the ability of different stimulator cells to activate G8 can be attributed solely to the level of T10/T22 surface expression. In addition, G8 is able to respond to T10/T22 expressed on Drosophila melanogaster cells, which inherently lack peptide-loading machinery and therefore express MHC molecules that are devoid of peptide (20). Together, these experiments indicated that T10/T22 may not present peptide for its recognition by G8.

In this study, we evaluate directly whether components other than the T10/T22 heavy chain and beta 2-microglobulin (beta 2m) are necessary for its recognition and structural stability. We find that Escherichia coli-produced T10 and beta 2m can be folded in vitro in the absence of peptide or nonpeptide moieties. This is in contrast with classical class I MHC molecules, whose folding of E. coli-produced heavy chain and beta 2m can take place only in the presence of an appropriate peptide (21, 22). The reconstituted T10/beta 2m heterodimer is biochemically homogeneous and can be recognized by specific antibodies and the G8 gamma delta T cell. The far-UV circular dichroic (CD)1 spectrum of T10/beta 2m is different from that of typical MHC class I molecules. These data suggest that T10 may have evolved to possess distinctive structural features capable of carrying out a specialized function in the immune system.


Materials and Methods

Construction of Expression Vectors. The expression cassettes for T10 and T10/Ld (T10/Ld, which has the alpha 1 and alpha 2 domains of T10 and alpha 3 domain of the murine class I molecule Ld, can be recognized by the Ld alpha 3-specific antibody 28.14.8S and G8. This hybrid gene was constructed previously to monitor cell surface expression of T10 in transfected cells in the absence of a T10/T22 heavy chain-specific antibody; reference 15) were constructed using PCR and the oligonucleotide primers GGAATTCCCATATGGGTTCACACTCGCTTAGG and GCGCAAGCTTTTACCATCTCAGGGTGAGGG containing the underlined EcoRI, NdeI, and HindIII restriction sites, respectively. The NdeI site in the EcoRI-NdeI oligonucleotide provides an ATG start codon and a stop codon TAA is included in the HindIII oligonucleotide to terminate the heavy chain following the alpha 3 domain COOHterminal tryptophan. The PCR was performed with the UltmaTM polymerase (Perkin Elmer, Norwalk, CT) and the recommended protocol. Amplified DNAs were ligated into pBluescriptKS(+) (Stratagene, La Jolla, CA) as EcoRI-HindIII fragments. Upon verification of the sequences, the heavy chain genes were ligated into pET24a+ (Novagen, Madison, WI) as NdeI-HindIII fragments and expressed in E. coli BL21(DE3)pLysS. Clones containing inserts and producing protein upon induction with isopropyl beta -D-thiogalactopyranoside (IPTG) were identified for large culture. The human HLA-A2 and human beta 2m expression constructs are described in Garboczi et al. (22). The murine beta 2m expression construct is described in Young et al. (23).

Protein Production and Purification. 1 L of Cells transformed with either heavy chain construct was grown to an OD600 of 0.3 and induced for 2 h with 1 mM IPTG. The harvested cells were resuspended in 10 ml of 25% sucrose, 50 mM Tris, pH 8.0, 1 mM EDTA, 1 mM PMSF, 1 mM DTT, and lysed at 37°C with 1% Triton X-100 and 1 mg/ml lysozyme (Sigma Chem. Co., St. Louis, MO) followed by freeze/thawing. The lysate was incubated for 30 min at 25°C with 30 mM MgCl2 and 30 µg/ml DNase (DN-25; Sigma) followed by the addition of 50 mM EDTA. Inclusion bodies were collected by centrifugation and washed 4-6 times with 20 ml of wash buffer containing 0.5% Triton X-100, 50 mM Tris, pH 8.0, 100 mM NaCl, and 0.1% NaN3. After two final washes in 20 ml of 50 mM Tris, pH 8.0, 100 mM NaCl, the inclusion bodies were solubilized in 6 M guanidine-HCl, 100 mM Tris, pH 8.0, 1 mM EDTA. HLA-A2, human beta 2m (hbeta 2m), and murine beta 2m (mbeta 2m) were expressed and inclusion bodies isolated as described (22, 23). Subunits for the T10/hbeta 2m folding were size-purified on a Superdex 200 column (Pharmacia, Uppsala, Sweden) in the presence of 6 M urea. Before folding, 0.3 M DTT was added to all subunits.

Folding and Purification of the Heavy Chain-beta 2m Complexes. Folding of the heterodimer was initiated by a 100-fold dilution of subunits into 1 L of nitrogen-saturated folding solution: 100 mM Tris, pH 8.0, 0.4 M L-arginine, 4 mM oxidized glutathione, 2 mM EDTA, 0.5 mM PMSF for T10/Ld/hbeta 2m or T10/hbeta 2m and 100 mM Tris, pH 8.2, 25% glycerol, 4 mM oxidized glutathione, 2 mM EDTA, 0.5 mM PMSF for T10/mbeta 2m. Final protein concentrations were 1 µM T10 heavy chain and 2 µM beta 2m. Folding reactions were incubated at room temperature for 48 h and concentrated to 30 ml in an Amicon stirred cell (10 kD cutoff) for fractionation on a Superdex 200 column (Pharmacia). Fractions containing associated T10/Ld heavy chain and hbeta 2m were identified using a sandwich ELISA. The ELISA-positive fractions for T10/Ld and the corresponding sized fractions for T10/hbeta 2m or T10/mbeta 2m were each concentrated ~10 times and subjected to a Mono QTM (Pharmacia) anion exchange column with a linear gradient of 0.1-0.3 M NaCl in 20 mM Tris (pH 7.5). The estimated yields of properly folded T10/hbeta 2m and T10/mbeta 2m are 2-4% and 1%, respectively.

The folding of HLA-A2 with HIV pol peptide RT309-317 (ILKEQVHGV) was carried out as described (22) with a folding yield routinely ~8%. No heterodimer could be detected when HLA-A2 and beta 2m were folded in the absence of peptide.

ELISA. The sandwich ELISA for folded T10/Ld/hbeta 2m heterodimer was performed using Immulon IV plates (Dynatech Laboratories, Inc., Chantilly, VA) coated overnight at 4°C with 10 µg/ml 28.14.8S antibody. After a 1-h incubation with analyte at room temperature, a rabbit anti-human beta 2m polyclonal serum (Boehringer Mannheim, Indianapolis, IN) was added. The assay was developed with a goat anti-rabbit alkaline phosphatase conjugate (Jackson ImmunoResearch Labs., West Grove, PA).

G8 Stimulation Assay. G8 stimulation assays were performed in high binding polystyrene plates (Costar, Cambridge, MA) coated overnight at 4°C with purified T10/beta 2m complex, moth cytochrome c peptide 88-103 loaded I-Ek, or using T10/Ld transfected CHO cells for stimulation of 105 G8 cells per well. Assays were also performed with T10/hbeta 2m and T10/mbeta 2m proteins that had been coated overnight at 4°C followed by a 10-h incubation with either PBS containing 2% BSA or RPMI containing 10% FCS at 22°C. The 24-h assay was carried out at 37 or 33°C for T10/hbeta 2m and T10/mbeta 2m, respectively. G8 cells express an alkaline phosphatase gene under control of the IL-2 gene NFAT promoter/enhancer (15). G8 stimulation is measured in fluorescence units, which represent measurements of NFAT-specific alkaline phosphatase activity, using the fluorescent substrate 4-methylumbelliferyl phosphate (Sigma). The dose-response curves are representative of at least three independent experiments.

Circular Dichroism Spectroscopy and Thermal Denaturation Studies. Far-UV CD spectra were recorded in a 0.1 path length cell on an AVIV 60 DS spectropolarimeter (Aviv Associates, Inc., Lakewood, NJ) equipped with a thermoelectric cuvette holder, using a step size of 0.25 nm, a bandwidth of 1 nm, and a time constant of 1 s. Spectra were recorded in sodium phosphate buffer (5 mM, pH 7.0). The spectra shown are representative of 3-5 independent measurements (each obtained from five repetitive scans) and were smoothed by the Savitzky-Golay algorithm using a sliding window of 9 (2.25 nm). Far-UV CD data is given as [Theta ]r, the mean residue ellipticity. Thermal denaturation curves were obtained by following the CD signal at 223 nm as a function of the temperature. The temperature was increased in a step-wise mode (2°C intervals) with each temperature jump being followed by a 30-s equilibration time. Recording time was 100 s. Each point in the melting curves shown in the text represents the average of three independent experiments. Reversibility of the thermal transitions was determined by standard heating/cooling cycles. In each such cycle, spectra were initially recorded at 25°C and the samples were heated to temperatures above the Tm of the protein complex analyzed and immediately cooled to 25°C. Posttransition spectra were recorded after an equilibration period of 1 h. The CD spectra at high temperatures were recorded separately to avoid the formation of kinetically driven, irreversibly unfolded species due to long incubation times at high temperatures.

Thermodynamic parameters were derived from the CD data presented in the text, assuming a two-state unfolding model. Derivation of the free energy change, Delta G, at physiological temperature (37°C), which lies below the transition region of the unfolding curves where the equilibrium constant, K, cannot be directly derived, was made using the following form of the Gibbs-Helmholtz equation: Delta G(T) = Delta Hm(1 - T / Tm- Delta Cp([Tm - T] + T  ln [T / Tm]), where T is the Kelvin temperature, Tm is the midpoint temperature of the thermal unfolding transition, Delta Hm is the enthalpy change for unfolding measured at Tm, and Delta Cp is the difference in heat capacity between the folded and unfolded conformations. Tm and Delta Hm were obtained from the van't Hoff equation: Delta HRT2(delta lnK)/(delta T), in which R is the gas constant. Delta Hm values used to derive the free energy of the two T10 forms were 96 and 85 kcal/mol for the human-mouse and mouse-mouse combinations, respectively. Delta Cp values were assumed to be independent of temperature (24) and were estimated from the following: Delta Cp= (delta Delta H)/(delta T)p. An average value of 0.8 kcal/mol · deg was used in all calculations. Values of K(T) inside the transition region of the unfolding curves were derived from the following relation: K(T) = (Theta N - Theta T) / (Theta T - Theta U), where (Theta N) and (Theta U) are the limiting ellipticity values representing the native and unfolded states, respectively, and (Theta T) is the observed ellipticity at T. Baseline corrections of the row ellipticity values were made only for data below the transition zone. The end product of the main unfolding transition was represented by a single molar ellipticity value.


Results

E. coli-produced T10 and beta 2m Subunits Can Be Folded into a Stable Heterodimer in the Absence of Peptide.

It was shown previously that T10/T22 protein can be expressed stably on cells lacking a functional peptide-loading mechanism (15, 16, 19). In addition, incubation of T10/Ld-expressing cells with peptide libraries of 8 amino acids in length or shorter does not increase the level of surface T10/Ld expression (Schild, H., M. Jackson, and Y.-h. Chien, unpublished data). These results suggest that T10/T22 may not require peptide binding for stable expression on the cell surface at physiological temperature. The fact that T10/ T22 expressed on these peptide loading-deficient cells can stimulate G8 as well as those molecules expressed on normal cells further suggests that a peptide-free form of these molecules is functional. To evaluate definitively whether T10 and beta 2m without peptide are sufficient for maintaining the structural stability and function of the complex, we expressed both components separately in E. coli, purified and denatured each component, and folded them together in vitro.

To detect properly folded material in the absence of an anti-T10/T22 antibody or a suitable mouse beta 2m antibody, we first perfomed folding experiments with a soluble form of the chimeric T10/Ld heavy chain molecule and human beta 2m. T10/Ld, which has the alpha 1 and alpha 2 domains of T10 and alpha 3 domain of the murine class I molecule Ld, can stimulate G8 and can be recognized by the Ld alpha 3-specific antibody 28.14.8S (15). Human beta 2m can be recognized by an anti-hbeta 2m polyclonal serum.

Soluble forms of the T10/Ld and T10 heavy chain proteins were produced by truncating the extracellular domains just before the transmembrane region. All proteins (T10, T10/Ld, hbeta 2m, and mbeta 2m) were produced as inclusion bodies and, thus, they could be isolated to a high level of purity by standard washing procedures (Fig. 1, A and B). For the folding of T10/hbeta 2m, subunits were subjected to gel filtration in the presence of 6 M urea to further purify heavy chain and hbeta 2m away from residual bacterial components (Fig. 1 A). The folding of subunits (T10/Ld with hbeta 2m, T10 with hbeta 2m, and T10 with mbeta 2m) was initiated by dilution of the denatured subunits according to modified published procedures (22, 25). To isolate heterodimer, the folding reactions were concentrated and fractionated by gel filtration chromatography. Fractions containing the renatured T10/Ld/hbeta 2m were detected by a sandwich ELISA. Corresponding fractions from the T10/hbeta 2m or T10/mbeta 2m foldings were combined and the heterodimers were further purified by ion exchange chromatography. In a gradient of 0.1-0.3M NaCl, a major peak eluting at 0.25 M NaCl or at 0.27 M NaCl was observed for the T10/hbeta 2m and T10/ mbeta 2m, respectively, while the rest of the protein eluted in the 0.5 M NaCl high salt wash (Fig. 1 C; data not shown). In each case, SDS-PAGE indicated that the major peak within the gradient contained both the heavy chain and beta 2m, whereas fractions from the high salt wash contained heavy chain alone (Fig. 1, A and B).



Fig. 1. Purification of reconstituted T10/beta 2m heterodimer by ion exchange chromatography. (A) SDS-PAGE analysis of T10 heavy chain (lane 1) and hbeta 2m (lane 2) in urea, a 0.25 M NaCl ion exchange column peak fraction from the T10/hbeta 2m purification (lane 3), and a 0.5 M NaCl high salt wash ion exchange column fraction (lane 4). Subunits in lanes 1 and 2 have been size purified in 6 M urea after solubilization in guanidine-HCl. The gel was stained with Coomassie blue. (B) SDS-PAGE analysis of T10 heavy chain (lane 1) and mbeta 2m (lane 2) solubilized in guanidine-HCl, a 0.27 M NaCl ion exchange column peak fraction from the T10/mbeta 2m purification (lane 3), and a 0.5 M NaCl high salt wash ion exchange column fraction (lane 4). The gel was stained with Coomassie blue. (C) Ion exchange chromatography profile from the T10/hbeta 2m heterodimer purification. Two major peaks, one at 0.25 M NaCl in the 0.1-0.3 M NaCl gradient and a second peak eluting at 0.5 M NaCl in the high salt wash, are observed.
[View Larger Versions of these Images (61 + 53 + 9K GIF file)]

Fractions from the ion exchange column were assayed for their ability to stimulate G8 gamma delta T cells. For all heterodimer purifications, only the material eluting within the major peak in the gradient was active in these assays. The folded T10/hbeta 2m complex was found to stimulate G8 to the same degree as T10/Ld transfected CHO cells (Fig. 2 A), which stimulate G8 to a higher level than the naturally expressing EL4 or PCC3 cells (15). The T10/mbeta 2m complex was also stimulatory (Fig. 2 B), but at an ~10-fold lower level.


Fig. 2. (A) Stimulation of G8 gamma delta T cells by purified T10/hbeta 2m heterodimer and by CHO T10/Ld cells. (B) Stimulation of G8 gamma delta T cells by purified T10/mbeta 2m heterodimer and by the moth cytochrome c 88-103 peptide-loaded MHC class II molecule, I-Ek.
[View Larger Version of this Image (16K GIF file)]

The lower stimulatory activity of T10/mbeta 2m in these experiments is most likely due to its lower thermal stability compared with that of the T10/hbeta 2m form (as discussed below). This could cause T10/mbeta 2m to be more sensitive to the denaturing effects of the coating process (26). We have preincubated T10/hbeta 2m and T10/mbeta 2m with media at 22°C for 10 h before T cell stimulation assays. This treatment does not change the dose-response curves for either complex compared with those without preincubation. Together, these results clearly indicate that the complex has been correctly folded and can be recognized by G8, without the addition of peptide or nonpeptide components and, likely, without the contribution of a media or serum component.

T10/beta 2m Is Structurally Different from Classical MHC Class I Molecules.

Far-UV CD spectroscopy has been used to analyze the structure and thermal stability of classical MHC class I molecules and the rat neonatal Fc receptor (FcRn), an MHC-like molecule that functions as an IgG transporter (27). To obtain similar parameters for the reconstituted T10/beta 2m heterodimer, we subjected both T10/hbeta 2m and T10/mbeta 2m to CD analysis (Fig. 3, data not shown). Interestingly, the spectra of both T10/hbeta 2m and T10/mbeta 2m are red-shifted compared with those reported for classical MHC class I molecules and FcRn (27). This difference was further verified by comparing the CD spectrum of T10 with that of E. coli-expressed and folded HLA-A2 molecules complexed with HIV pol peptide (Fig. 3). These data suggest that although these molecules are likely to have similar folds, T10 has structural properties distinct from classical class I MHC molecules (32).


Fig. 3. Far-UV CD spectra of T10/hbeta 2m (0.15 mg/mL; solid line) and HLA-A2 (0.25 mg/mL; dotted line) heterodimers in 5 mM sodium phosphate buffer (pH 7.0). Spectra were recorded using 0.1 cm cells at 25°C.
[View Larger Version of this Image (16K GIF file)]

The thermal denaturation profile of the T10/hbeta 2m complex is shown in Fig. 4 A. At neutral pH , the melting curve reveals two transitions. The first is characterized by a transition temperature midpoint (Tm) of 49°C and reflects the simultaneous dissociation and unfolding of the T10 heavy chain. The second transition, with a Tm at 63-64°C, is characterized by a sign reversal of the CD signal and closely parallels the unfolding profile of free beta 2m (Tm approx  64°C, data not shown; references 29, 30), implying that its denaturation is largely independent of the heavy chain. Consistent with its lower activity in G8 stimulation assays, the T10/mbeta 2m complex is less stable than the mouse-human combination, with a Tm = 43°C (Fig. 5). Mouse beta 2m was observed to have a Tm approx  62°C (data not shown). For each heterodimer, the thermal transition is largely reversible (see Fig. 4 B; data not shown).


Fig. 4. (A) Thermal denaturation of the T10/hbeta 2m heterodimer. Protein concentration was 0.15 mg/mL. (B) CD scans of native, unfolded, and renatured T10/hbeta 2m.
[View Larger Version of this Image (17K GIF file)]


Fig. 5. Thermal denaturation of the T10/mbeta 2m heterodimer. Protein concentration was 0.15 mg/mL.
[View Larger Version of this Image (14K GIF file)]

Assuming a standard two-state unfolding model, the free energy change at a particular temperature, Delta G(T), can be estimated from the melting curves shown here. At physiological temperature (37°C), we calculate free energy changes of ~3.3 and 1.5 kcal/mol for the T10/hbeta 2m and T10/ mbeta 2m heterodimers, respectively. These values for T10/ hbeta 2m and T10/mbeta 2m can be translated into expected ratios of folded to unfolded species of 200:1 and 11:1, respectively, at 37°C. The structural basis for the different thermal stabilities of these heterodimers is presently under investigation.

By comparison, both forms of T10 are less stable than classical class I molecules complexed with an appropriate peptide, for which free energies >5kcal/mol and Tm of 65-72°C have been reported (29, 30). However, with the exception of the Kd molecule, MHC class I molecules are critically unstable in the absence of peptide and can not be assembled. On the other hand, the stability of FcRn, which does not bind peptide for either stability or function, lies in between these extremes, with Tm of 62°C and 51°C at pH 6.0 and pH 8.0, respectively, the latter being very similar to the the Tm of the T10/hbeta 2m heterodimer (31).


Discussion

We set out to evaluate directly whether a component other than the T10 heavy chain and beta 2m is necessary for its recognition by G8 and for the structural stability of the molecule by producing the two subunits separately in E. coli and folding them together in vitro. We find that the complex of T10 with murine beta 2m can be assembled in the absence of any additional factors and that the heterodimer is stimulatory to G8. However, T10/mbeta 2m has a rather low thermal stability, similar to that of the empty Kd molecule. The ability of plate bound T10/mbeta 2m to stimulate G8 is also lower than cells expressing T10, by ~10-fold.

Based on these observations, one possibility is that the heterodimer expressed on the cell surface is further stabilized by a factor(s) other than the primary amino acid sequences of T10 and mbeta 2m. This stabilizing factor for T10/ mbeta 2m in vivo may be the carbohydrate moieties that are covalently linked to the T10 heavy chain. Although T10 and T22 have three potential N-linked glycosylation sites in the alpha 1 and alpha 2 domains, two more than classical MHC class I molecules, the E. coli-produced subunits are not glycosylated. Recently, it was shown that the elimination of a single N-glycan site in the adhesion domain of human CD2, a protein belonging to the immunoglobulin superfamily, severely reduces the stability of the protein (33). It is possible that one or more of the carbohydrates of T10/ T22 plays a critical role in stabilizing the structure of the heterodimer. Alternatively, T10/mbeta 2m might also be stabilized by association with a molecule not covalently linked to the complex. However, regardless of the nature of such a stabilizing factor, by substituting the mouse beta 2m with human beta 2m in our in vitro system, we were able to increase the stability of the T10 complex. T10/hbeta 2m can stimulate G8 at levels similar to that of the best stimulator cells. These results indicate that, while an additional factor may be necessary for the stable expression of T10 on the cell surface, it does not confer specificity. Thus, the only essential feature required for G8 recognition is a properly folded and stable T10 heavy chain and beta 2m heterodimer.

This scenario is reminiscent of the recognition of murine class II I-Ek by the gamma delta T cell LBK5. While I-Ek requires peptide for stable expression on the cell surface, the bound peptide does not confer specificity for its recognition by LBK5. As shown previously, LBK5 can recognize I-Ek stabilized by a variety of different peptides (15). Thus, these two examples of gamma delta T cell recognition differ fundamentally from the recognition by alpha beta T cells of classical or nonclassical MHC. In the latter case, the peptide or nonpeptide moieties being presented contributes significantly to the specificity of the recognition. However, unlike I-Ek, there is no evidence that T10 binds peptide. This assertion is based on the observation that no peptide(s) other than those derived from the antibodies used for immunoprecipitation can be eluted from T10/Ld molecules isolated from cells (19), as well as our result presented here that the folding of heterodimer does not require peptide. These observations are consistent with the primary amino acid sequences of T10/T22, which suggest that these molecules may lack the necessary structural features to bind peptide. Most notably, T10/T22 possess a 3-amino acid deletion within the alpha 1 domain and a 12-amino acid deletion within the alpha 2 domain (14). Thus, assuming that T10 and T22 molecules fold similarly to classical MHC molecules, the alpha 2 alpha -helical region, the conserved COOH-terminal peptide-binding pocket (pocket F), as well as the outermost beta  strand of the alpha 1 domain and the outermost beta  strand of the alpha 2 domain, would all be significantly altered (14).

Such structural features in T10 are not shared by FcRn, a class Ib molecule that does not bind peptide. Crystallographic studies revealed that FcRn is structurally similar to MHC molecules in its conservation of the alpha 1 and alpha 2 domain topology of two helices that span a single beta  sheet, but the presence of a proline at position 162 introduces a break in the alpha 2 helix of the molecule, causing a shift of its alpha  helices and resulting in a peptide-binding groove filled with side chains (34). Consistent with the crystallographic analysis, it was shown that the CD spectrum of FcRn and classical MHC are very similar (35). However, both spectra are blue-shifted when compared with that of T10/beta 2m. This observation indicates that T10 is likely to possess structural properties not found in either MHC class I molecules or in FcRn. Thus, these results suggest a new way for an MHC class I-like molecule to adopt a peptide-free structure.

An alternative to the hypothesis that T10/T22 needs an additional factor for stability is the possibility that rapid turnover is a useful property in a ligand for gamma delta T cell recognition. There is strong evidence that at least one role for gamma delta T cells in the immune system is the surveillance for cells that have become stressed or damaged (36). T10 molecules expressed on the cell surface are likely to have a shorter half-life than classical MHC molecules. Consistent with this, preliminary antibody stainings indicate low T10 cell surface expression on primary lymphoid cells and EL4 cells (Crowley, M., and Y.-h. Chien, unpublished data). It is arguable that a rapid turnover may better enable T10 to act as a transient target of sensory immune cells.


Footnotes

Address correspondence to Dr. Y.-h. Chien, D333 Fairchild Building, Department of Microbiology and Immunology, Stanford University, School of Medicine, Stanford, California 94305. The current address of N. Mavaddat is the Walter and Eliza Hall Institute of Medical Research, The Royal Melbourne Hospital, Victoria 3050, Australia.

Received for publication 10 April 1996 and in revised form 27 January 1997.

   M.P. Crowley was supported by a fellowship from the National Science Foundation. Z. Reich was supported by The Rothchild Foundation, Israel, and is currently supported by The Howard Hughes Medical Institute. N. Mavaddat is supported by the National Health and Medical Research Council of Australia. We also thank the National Institutes of Health for grant support.
   1Abbreviations used in this paper: CD, circular dichroic; FcRn, rat neonatal Fc receptor; IPTG, isopropyl beta -D-thiogalactopyranoside.

We thank Drs. D. Garboczi and D. Wiley for providing the human HLA-A2 and hbeta 2m constructs, Drs. J. Sacchettini and S. Nathenson for providing the mbeta 2m construct, and Dr. M. Davis for critically reading the manuscript.


References

1. Shawar, S.M., J.M. Vyas, J.R. Rodgers, and R.R. Rich. 1994. Antigen presentation by major histocompatibility complex class I-B molecules. Annu. Rev. Immunol. 12: 839-880 [Medline]. [Medline]
2. Stroynowski, I., and K.F. Lindahl. 1994. Antigen presentation by nonclassical class I molecules. Curr. Opin. Immunol. 6: 38-44 [Medline]. [Medline]
3. Kurlander, R.J., S.M. Shawar, M.L. Brown, and R.R. Rich. 1992. Specialized role for a murine class 1-b MHC molecule in prokaryotic host defenses. Science (Wash. DC). 257: 678-679 [Medline]. [Abstract/Free Full Text]
4. Shawar, S.M., R.G. Cook, J.R. Rodgers, and R.R. Rich. 1990. Specialized functions of MHC class I molecules. I. An N-formyl peptide receptor is required for construction of the class I antigen Mta. J. Exp. Med. 17: 872-912 .
5. Pamer, E.G., C.R. Wang, L. Flaherty, K.F. Lindahl, and M.J. Bevan. 1992. H-2M3 presents a Listeria monocytogenes peptide to cytotoxic T lymphocytes. Cell. 70: 215-223 [Medline]. [Medline]
6. Beckman, E.M., S.A. Porcelli, C.T. Morita, S.M. Behar, S.T. Furlong, and M.B. Brenner. 1994. Recognition of a lipid antigen by CD1-restricted alpha beta+ T cells. Nature (Lond.). 372: 691-694 [Medline]. [Medline]
7. Sieling, P.A., D. Chatterjee, S.A. Porcelli, T.I. Prigozy, R.J. Mazzaccaro, T. Soriano, B.R. Bloom, M.B. Brenner, M. Kronenberg, P.J. Brennan, et al . 1995. CD1-restricted T cell recognition of microbial lipoglycan antigens. Science (Wash. DC). 269: 227-230 [Medline]. [Abstract/Free Full Text]
8. Castano, A.R., S. Tangri, J.E. Miller, H.R. Holcombe, M.R. Jackson, W.D. Huse, M. Kronenberg, and P.A. Peterson. 1995. Peptide binding and presentation by mouse CD1. Science (Wash. DC). 269: 223-226 [Medline]. [Abstract/Free Full Text]
9. Bendelac, A., O. Lantz, M.E. Quimby, J.W. Yewdell, J.R. Bennink, and R.R. Brutkiewicz. 1995. CD1 recognition by mouse NK1+ T lymphocytes. Science (Wash. DC). 268: 863-865 [Medline]. [Abstract/Free Full Text]
10. Rotzschke, O., K. Falk, S. Stevanovic, B. Grahovac, M.J. Soloski, G. Jung, and H.G. Rammensee. 1993. Qa-2 molecules are peptide receptors of higher stringency than ordinary class I molecules. Nature (Lond.). 361: 642-644 [Medline]. [Medline]
11. Joyce, S., P. Tabaczewski, R.H. Angeletti, S.G. Nathenson, and I. Stroynowski. 1994. A nonpolymorphic major histocompatibility complex class Ib molecule binds a large array of diverse self-peptides. J. Exp. Med. 179: 579-588 [Medline]. [Abstract/Free Full Text]
12. Jiang, H., R. Ware, A. Stall, L. Flaherty, L. Chess, and B. Pernis. 1995. Murine CD8+ T cells that specifically delete autologous CD4+ T cells expressing V beta 8 TCR: a role of the Qa-1 molecule. Immunity. 2: 185-194 [Medline]. [Medline]
13. Imani, F., and M.J. Soloski. 1991. Heat shock proteins can regulate expression of the Tla region-encoded class Ib molecule. Qa-1. Proc. Natl. Acad. Sci. USA. 88: 10475-10479 [Medline]. [Abstract/Free Full Text]
14. Ito, K., K.L. Van, M. Bonneville, S. Hsu, D.B. Murphy, and S. Tonegawa. 1990. Recognition of the product of a novel MHC TL region gene (27b) by a mouse gamma delta T cell receptor. Cell. 62: 549-561 [Medline]. [Medline]
15. Schild, H., N. Mavaddat, C. Litzenberger, E.W. Ehrich, M.M. Davis, J.A. Bluestone, L. Matis, R.K. Draper, and Y.H. Chien. 1994. The nature of major histocompatibility complex recognition by gamma delta T cells. Cell. 76: 29-37 [Medline]. [Medline]
16. Weintraub, B.C., M.R. Jackson, and S.M. Hedrick. 1994. Gamma delta T cells can recognize nonclassical MHC in the absence of conventional antigenic peptides. J. Immunol. 153: 3051-3058 [Medline]. [Abstract]
17. Bluestone, J.A., R.Q. Cron, M. Cotterman, B.A. Houlden, and L.A. Matis. 1988. Structure and specificity of T cell receptor gamma/delta on major histocompatibility complex antigen-specific CD3+, CD4-, CD8- T lymphocytes. J. Exp. Med. 168: 1899-1916 [Medline]. [Abstract/Free Full Text]
18. Bonneville, M., K. Ito, E.G. Krecko, S. Itohara, D. Kappes, I. Ishida, O. Kanagawa, C.A. Janeway, D.B. Murphy, and S. Tonegawa. 1989. Recognition of a self major histocompatibility complex TL region product by gamma delta T-cell receptors. Proc. Natl. Acad. Sci. USA. 86: 5928-5932 [Medline]. [Abstract/Free Full Text]
19. Kaliyaperumal, A., R. Falchetto, A. Cox, R. Dick, J. Shabanowitz, Y.H. Chien, L. Matis, D.F. Hunt, and J.A. Bluestone. 1995. Functional expression and recognition of nonclassical MHC class I T10b is not peptide-dependent. J. Immunol. 155: 2379-2386 [Medline]. [Abstract]
20. Jackson, M.R., E.S. Song, Y. Yang, and P.A. Peterson. 1992. Empty and peptide-containing conformers of class I major histocompatibility complex molecules expressed in Drosophila melanogaster cells. Proc. Natl. Acad. Sci. USA. 89: 12117-12121 [Medline]. [Abstract/Free Full Text]
21. Silver, M.L., K.C. Parker, and D.C. Wiley. 1991. Reconstitution by MHC-restricted peptides of HLA-A2 heavy chain with beta 2-microglobulin, in vitro. Nature (Lond.). 350: 619-622 [Medline]. [Medline]
22. Garboczi, D.N., D.T. Hung, and D.C. Wiley. 1992. HLA-A2- peptide complexes: refolding and crystallization of molecules expressed in Escherichia coli and complexed with single antigenic peptides. Proc. Natl. Acad. Sci. USA. 89: 3429-3433 [Medline]. [Abstract/Free Full Text]
23. Young, A.C.M., W. Zhang, J.C. Sachettini, and S.G. Nathenson. 1994. The three-dimensional structure of H-2Db at 2.4Å resolution: implications for antigen-determinant selection. Cell. 76: 39-50 . [Medline]
24. Privalov, P.L., and S.J. Gill. 1988. Stability of protein structure and hydrophobic interaction. Adv. Prot. Chem. 39: 191-234 [Medline]. [Medline]
25. Buchner, J., and R. Rudolph. 1991. Renaturation, purification and characterization of recombinant Fab-fragments produced in Escherichia coli. Bio/technology. 9:157-162.
26. Butler, J.E. 1991. Perspectives, configurations, and principles. In Immunochemistry of Solid-phase Immunoassay. J.E. Butler, editor. CRC Press, Inc., Boca Raton, FL. 3-26.
27. Lancet, D., P. Parham, and J.L. Strominger. 1979. Heavy chain of HLA-A and HLA-B antigens is conformationally labile: a possible role for beta 2-microglobulin. Proc. Natl. Acad. Sci. USA. 76: 3844-3848 [Medline]. [Abstract/Free Full Text]
28. Gorga, J.C., A. Dong, M.C. Manning, R.W. Woddy, W.S. Caughey, and J.L. Strominger. 1989. Comparison of the secondary structures of human class I and class II major histocompatibility complex antigens by Fourier transform infrared and circular dichroism spectroscopy. Proc. Natl. Acad. Sci. USA. 86: 2321-2325 [Medline]. [Abstract/Free Full Text]
29. Fahnestock, M.L., I. Tamir, L. Narhi, and P.J. Bjorkman. 1992. Thermal stability comparison of purified empty and peptide-filled forms of a class I MHC molecule. Science (Wash. DC). 258: 1658-1662 [Medline]. [Abstract/Free Full Text]
30. Bouvier, M., and D.C. Wiley. 1994. Importance of peptide amino and carboxyl termini to the stability of MHC class I molecules. Science (Wash. DC). 265: 398-402 [Medline]. [Abstract/Free Full Text]
31. Raghavan, M., L.N. Gastinel, and P.J. Bjorkman. 1993. The class I major histocompatibility complex related Fc receptor shows pH-dependent stability differences correlating with immunoglobulin binding and release. Biochemistry. 32: 8654-8660 [Medline]. [Medline]
32. Greenfield, N., and G.D. Fasman. 1969. Computed circular dichroism spectra for the evolution of protein conformation. Biochemistry. 8: 4108-4116 [Medline]. [Medline]
33. Wyss, D.F., J.S. Choi, J. Li, M.H. Knoppers, K.J. Willis, A.R. Arulanandam, A. Smolyar, E.L. Reinherz, and G. Wagner. 1995. Conformation and function of the N-linked glycan in the adhesion domain of human CD2. Science (Wash. DC). 269: 1273-1278 [Medline]. [Abstract/Free Full Text]
34. Burmeister, W.P., L.N. Gastinel, N.E. Simister, M.L. Blum, and P.J. Bjorkman. 1994. Crystal structure at 2.2 Å resolution of the MHC-related neonatal Fc receptor. Nature (Lond.). 372: 336-343 [Medline]. [Medline]
35. Gastinel, L.N., N.E. Simister, and P.J. Bjorkman. 1992. Expression and crystallization of a soluble and functional form of an Fc receptor related to class I histocompatibility molecules. Proc. Natl. Acad. Sci. USA. 89: 638-642 [Medline]. [Abstract/Free Full Text]
36. Carding, S., W. Allan, S. Kyes, A. Hayday, and P. Doherty. 1990. Late dominance of the inflammatory process in murine influenza by gamma -delta + T cells. J. Exp. Med. 172: 1225-1231 [Medline]. [Abstract/Free Full Text]
37. Hara, T., Y. Mizuno, K. Takaki, H. Takada, H. Akeda, T. Aoki, M. Nagata, K. Ueda, G. Matsuzaki, Y. Yoshikai, et al . 1992. Predominant activation and expansion of Vgamma 9-bearing gamma delta T cells in vivo as well as in vitro in salmonella infection. J. Clin. Invest. 90: 204-210 [Medline].
38. Hou, S., M. Kats, P.C. Doherty, and S.R. Carding. 1992. Extent of gamma delta T cells involvement in the pneumonia caused by Sendai virus. Cell. Immunol. 143: 183-193 [Medline]. [Medline]
39. Hiromatsu, K., Y. Yoshikai, G. Matsuzaki, S. Ohga, K. Muramori, K. Matsumoto, J. Bluestone, and K. Nomoto. 1992. A protective role of gamma -delta T cells in primary infection with Listeria monocytogenes in mice. J. Exp. Med. 175: 49-56 [Medline]. [Abstract/Free Full Text]

Copyright © 1997 by The Rockefeller University Press.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 144K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crowley, M. P.
Right arrow Articles by Chien, Y.-h.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crowley, M. P.
Right arrow Articles by Chien, Y.-h.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS