|
||

T Cell, G8
By

From the * Program in Immunology;
The Howard Hughes Medical Institute; and the § Department of
Microbiology and Immunology, Stanford University School of Medicine, Stanford, California 94305
Recent studies have shown that many nonclassical major histocompatibility complex (MHC)
(class Ib) molecules have distinct antigen-binding capabilities, including the binding of nonpeptide moieties and the binding of peptides that are different from those bound to classical MHC
molecules. Here, we show that one of the H-2T region-encoded molecules, T10, when produced in Escherichia coli, can be folded in vitro with
2-microglobulin (
2m) to form a stable
heterodimer in the absence of peptide or nonpeptide moieties. This heterodimer can be recognized by specific antibodies and is stimulatory to the 
T cell clone, G8. Circular dichroism analysis indicates that T10/
2m has structural features distinct from those of classical MHC class
I molecules. These results suggest a new way for MHC-like molecules to adopt a peptide-free
structure and to function in the immune system.
Classical MHC class I (class Ia) molecules possess a
highly specialized groove occupied by short peptides
that are acquired inside the cell during MHC heterodimer
assembly. This peptide-MHC interaction not only contributes to the stability of the heterodimer on the cell surface,
but forms the basis for its function, as complexes of intracellular pathogen derived peptides with MHC are the
ligands for cytolytic Although the majority of the cells that respond to class Ib
ligands bear the In this study, we evaluate directly whether components
other than the T10/T22 heavy chain and Construction of Expression Vectors.
The expression cassettes for
T10 and T10/Ld (T10/Ld, which has the Protein Production and Purification.
1 L of Cells transformed with
either heavy chain construct was grown to an OD600 of 0.3 and
induced for 2 h with 1 mM IPTG. The harvested cells were resuspended in 10 ml of 25% sucrose, 50 mM Tris, pH 8.0, 1 mM
EDTA, 1 mM PMSF, 1 mM DTT, and lysed at 37°C with 1%
Triton X-100 and 1 mg/ml lysozyme (Sigma Chem. Co., St.
Louis, MO) followed by freeze/thawing. The lysate was incubated for 30 min at 25°C with 30 mM MgCl2 and 30 µg/ml
DNase (DN-25; Sigma) followed by the addition of 50 mM
EDTA. Inclusion bodies were collected by centrifugation and
washed 4-6 times with 20 ml of wash buffer containing 0.5%
Triton X-100, 50 mM Tris, pH 8.0, 100 mM NaCl, and 0.1%
NaN3. After two final washes in 20 ml of 50 mM Tris, pH 8.0, 100 mM NaCl, the inclusion bodies were solubilized in 6 M
guanidine-HCl, 100 mM Tris, pH 8.0, 1 mM EDTA. HLA-A2,
human Folding and Purification of the Heavy Chain-
T cells. Recently, many nonclassical MHC class I molecules, such as those encoded in the Q,
T, M, and CD1 regions, have been found to possess binding properties different from those of classical MHC molecules (as reviewed in references 1 and 2). These studies suggest that class Ib molecules have evolved for specific tasks
that are distinct from those of classical class I MHC. For example, M3 and human CD1 have been proposed to play a
special role in controlling microbial infection by binding
and presenting N-formylated peptide and lipid antigens, respectively (3). Murine CD1 molecules have been shown
to bind hydrophobic peptides and are thought to stimulate
regulatory 
T cells (8, 9). Some Qa molecules were
found to bind mixtures of peptides with molecular properties different from those bound to classical MHC molecules
(10, 11). Other Qa molecules have been suggested to have
roles in the generation of regulatory T cells, as well as the
elimination of bacterially infected cells (12, 13).

TCR, the H-2T-encoded T10 and the
closely related T22 (94% identity) proteins were first identified as the ligands for two 
T cells, KN6 and G8 (14-
16). G8 was generated by immunizing BALB/c nude mice
with B10.BR spleen cells (17), whereas KN6 was derived
from a C57BL/6 double-negative thymocyte (18). Attempts to derive 
T cells specific for these molecules, using either cells naturally expressing T10/T22 or transfected with these genes as immunogen, have been unsuccessful
(reference 19; Schild, H., and Y.-h. Chien, unpublished
data). Analysis of the recognition of T10/T22 by G8 shows
it to be clearly different from MHC class I recognition by

T cells. In particular, G8 can respond to stimulator cells
that lack functional peptide-loading mechanisms for either
MHC class I or class II molecules (15, 16, 19). All variations in the ability of different stimulator cells to activate
G8 can be attributed solely to the level of T10/T22 surface
expression. In addition, G8 is able to respond to T10/T22
expressed on Drosophila melanogaster cells, which inherently lack peptide-loading machinery and therefore express MHC
molecules that are devoid of peptide (20). Together, these
experiments indicated that T10/T22 may not present peptide for its recognition by G8.
2-microglobulin
(
2m) are necessary for its recognition and structural stability. We find that Escherichia coli-produced T10 and
2m can
be folded in vitro in the absence of peptide or nonpeptide
moieties. This is in contrast with classical class I MHC molecules, whose folding of E. coli-produced heavy chain and
2m can take place only in the presence of an appropriate peptide (21, 22). The reconstituted T10/
2m heterodimer
is biochemically homogeneous and can be recognized by
specific antibodies and the G8 
T cell. The far-UV circular dichroic (CD)1 spectrum of T10/
2m is different
from that of typical MHC class I molecules. These data
suggest that T10 may have evolved to possess distinctive
structural features capable of carrying out a specialized function in the immune system.
1 and
2 domains of
T10 and
3 domain of the murine class I molecule Ld, can be
recognized by the Ld
3-specific antibody 28.14.8S and G8. This
hybrid gene was constructed previously to monitor cell surface
expression of T10 in transfected cells in the absence of a T10/T22
heavy chain-specific antibody; reference 15) were constructed using
PCR and the oligonucleotide primers GGAATTCCCATATGGGTTCACACTCGCTTAGG and GCGCAAGCTTTTACCATCTCAGGGTGAGGG containing the underlined EcoRI,
NdeI, and HindIII restriction sites, respectively. The NdeI site in
the EcoRI-NdeI oligonucleotide provides an ATG start codon
and a stop codon TAA is included in the HindIII oligonucleotide
to terminate the heavy chain following the
3 domain COOHterminal tryptophan. The PCR was performed with the UltmaTM
polymerase (Perkin Elmer, Norwalk, CT) and the recommended protocol. Amplified DNAs were ligated into pBluescriptKS(+)
(Stratagene, La Jolla, CA) as EcoRI-HindIII fragments. Upon
verification of the sequences, the heavy chain genes were ligated
into pET24a+ (Novagen, Madison, WI) as NdeI-HindIII fragments and expressed in E. coli BL21(DE3)pLysS. Clones containing inserts and producing protein upon induction with isopropyl
-D-thiogalactopyranoside (IPTG) were identified for large culture. The human HLA-A2 and human
2m expression constructs
are described in Garboczi et al. (22). The murine
2m expression
construct is described in Young et al. (23).
2m (h
2m), and murine
2m (m
2m) were expressed
and inclusion bodies isolated as described (22, 23). Subunits for
the T10/h
2m folding were size-purified on a Superdex 200 column (Pharmacia, Uppsala, Sweden) in the presence of 6 M urea.
Before folding, 0.3 M DTT was added to all subunits.
2m Complexes.
Folding of the heterodimer was initiated by a 100-fold dilution of subunits into 1 L of nitrogen-saturated folding solution: 100 mM
Tris, pH 8.0, 0.4 M L-arginine, 4 mM oxidized glutathione, 2 mM EDTA, 0.5 mM PMSF for T10/Ld/h
2m or T10/h
2m and
100 mM Tris, pH 8.2, 25% glycerol, 4 mM oxidized glutathione,
2 mM EDTA, 0.5 mM PMSF for T10/m
2m. Final protein concentrations were 1 µM T10 heavy chain and 2 µM
2m. Folding
reactions were incubated at room temperature for 48 h and concentrated to 30 ml in an Amicon stirred cell (10 kD cutoff) for
fractionation on a Superdex 200 column (Pharmacia). Fractions containing associated T10/Ld heavy chain and h
2m were identified using a sandwich ELISA. The ELISA-positive fractions for
T10/Ld and the corresponding sized fractions for T10/h
2m or
T10/m
2m were each concentrated ~10 times and subjected to a
Mono QTM (Pharmacia) anion exchange column with a linear
gradient of 0.1-0.3 M NaCl in 20 mM Tris (pH 7.5). The estimated yields of properly folded T10/h
2m and T10/m
2m are
2-4% and 1%, respectively.
2m were folded in the absence of peptide.
ELISA.
The sandwich ELISA for folded T10/Ld/h
2m heterodimer was performed using Immulon IV plates (Dynatech
Laboratories, Inc., Chantilly, VA) coated overnight at 4°C with
10 µg/ml 28.14.8S antibody. After a 1-h incubation with analyte
at room temperature, a rabbit anti-human
2m polyclonal serum
(Boehringer Mannheim, Indianapolis, IN) was added. The assay
was developed with a goat anti-rabbit alkaline phosphatase conjugate (Jackson ImmunoResearch Labs., West Grove, PA).
G8 Stimulation Assay.
G8 stimulation assays were performed
in high binding polystyrene plates (Costar, Cambridge, MA)
coated overnight at 4°C with purified T10/
2m complex, moth
cytochrome c peptide 88-103 loaded I-Ek, or using T10/Ld transfected CHO cells for stimulation of 105 G8 cells per well. Assays
were also performed with T10/h
2m and T10/m
2m proteins
that had been coated overnight at 4°C followed by a 10-h incubation with either PBS containing 2% BSA or RPMI containing
10% FCS at 22°C. The 24-h assay was carried out at 37 or 33°C
for T10/h
2m and T10/m
2m, respectively. G8 cells express an
alkaline phosphatase gene under control of the IL-2 gene NFAT promoter/enhancer (15). G8 stimulation is measured in fluorescence units, which represent measurements of NFAT-specific alkaline phosphatase activity, using the fluorescent substrate 4-methylumbelliferyl phosphate (Sigma). The dose-response curves are representative of at least three independent experiments.
Circular Dichroism Spectroscopy and Thermal Denaturation Studies.
Far-UV CD spectra were recorded in a 0.1 path length cell on an
AVIV 60 DS spectropolarimeter (Aviv Associates, Inc., Lakewood, NJ) equipped with a thermoelectric cuvette holder, using
a step size of 0.25 nm, a bandwidth of 1 nm, and a time constant
of 1 s. Spectra were recorded in sodium phosphate buffer (5 mM,
pH 7.0). The spectra shown are representative of 3-5 independent measurements (each obtained from five repetitive scans) and were smoothed by the Savitzky-Golay algorithm using a sliding window of 9 (2.25 nm). Far-UV CD data is given as [
]r, the mean
residue ellipticity. Thermal denaturation curves were obtained by
following the CD signal at 223 nm as a function of the temperature. The temperature was increased in a step-wise mode (2°C
intervals) with each temperature jump being followed by a 30-s
equilibration time. Recording time was 100 s. Each point in the
melting curves shown in the text represents the average of three
independent experiments. Reversibility of the thermal transitions
was determined by standard heating/cooling cycles. In each such
cycle, spectra were initially recorded at 25°C and the samples
were heated to temperatures above the Tm of the protein complex analyzed and immediately cooled to 25°C. Posttransition
spectra were recorded after an equilibration period of 1 h. The
CD spectra at high temperatures were recorded separately to
avoid the formation of kinetically driven, irreversibly unfolded
species due to long incubation times at high temperatures.
G, at physiological temperature (37°C), which lies below the transition region of the unfolding curves where the equilibrium constant, K, cannot be directly
derived, was made using the following form of the Gibbs-Helmholtz equation:
G(T) =
Hm(1
T / Tm)
Cp([Tm
T] + T ln [T / Tm]), where T is the Kelvin temperature, Tm is the midpoint temperature of the thermal unfolding transition,
Hm is the
enthalpy change for unfolding measured at Tm, and
Cp is the
difference in heat capacity between the folded and unfolded conformations. Tm and
Hm were obtained from the van't Hoff equation:
H = RT2(
lnK)/(
T), in which R is the gas constant.
Hm
values used to derive the free energy of the two T10 forms were
96 and 85 kcal/mol for the human-mouse and mouse-mouse
combinations, respectively.
Cp values were assumed to be independent of temperature (24) and were estimated from the following:
Cp= (
H)/(
T)p. An average value of 0.8 kcal/mol · deg
was used in all calculations. Values of K(T) inside the transition
region of the unfolding curves were derived from the following
relation: K(T) = (
N
T) / (
T
U), where (
N) and (
U)
are the limiting ellipticity values representing the native and unfolded states, respectively, and (
T) is the observed ellipticity at
T. Baseline corrections of the row ellipticity values were made
only for data below the transition zone. The end product of the
main unfolding transition was represented by a single molar ellipticity value.
2m Subunits Can Be Folded into
a Stable Heterodimer in the Absence of Peptide.
It was shown
previously that T10/T22 protein can be expressed stably
on cells lacking a functional peptide-loading mechanism (15, 16, 19). In addition, incubation of T10/Ld-expressing
cells with peptide libraries of 8 amino acids in length or
shorter does not increase the level of surface T10/Ld expression (Schild, H., M. Jackson, and Y.-h. Chien, unpublished data). These results suggest that T10/T22 may not
require peptide binding for stable expression on the cell
surface at physiological temperature. The fact that T10/
T22 expressed on these peptide loading-deficient cells can
stimulate G8 as well as those molecules expressed on normal cells further suggests that a peptide-free form of these
molecules is functional. To evaluate definitively whether
T10 and
2m without peptide are sufficient for maintaining the structural stability and function of the complex, we expressed both components separately in E. coli, purified and
denatured each component, and folded them together in
vitro.
To detect properly folded material in the absence of an
anti-T10/T22 antibody or a suitable mouse
2m antibody,
we first perfomed folding experiments with a soluble form
of the chimeric T10/Ld heavy chain molecule and human
2m. T10/Ld, which has the
1 and
2 domains of T10
and
3 domain of the murine class I molecule Ld, can stimulate G8 and can be recognized by the Ld
3-specific antibody 28.14.8S (15). Human
2m can be recognized by an
anti-h
2m polyclonal serum.
Soluble forms of the T10/Ld and T10 heavy chain proteins were produced by truncating the extracellular domains just before the transmembrane region. All proteins
(T10, T10/Ld, h
2m, and m
2m) were produced as inclusion bodies and, thus, they could be isolated to a high level
of purity by standard washing procedures (Fig. 1, A and B).
For the folding of T10/h
2m, subunits were subjected to
gel filtration in the presence of 6 M urea to further purify
heavy chain and h
2m away from residual bacterial components (Fig. 1 A). The folding of subunits (T10/Ld with
h
2m, T10 with h
2m, and T10 with m
2m) was initiated
by dilution of the denatured subunits according to modified published procedures (22, 25). To isolate heterodimer,
the folding reactions were concentrated and fractionated by
gel filtration chromatography. Fractions containing the renatured T10/Ld/h
2m were detected by a sandwich ELISA.
Corresponding fractions from the T10/h
2m or T10/m
2m
foldings were combined and the heterodimers were further
purified by ion exchange chromatography. In a gradient of
0.1-0.3M NaCl, a major peak eluting at 0.25 M NaCl or at
0.27 M NaCl was observed for the T10/h
2m and T10/
m
2m, respectively, while the rest of the protein eluted in
the 0.5 M NaCl high salt wash (Fig. 1 C; data not shown).
In each case, SDS-PAGE indicated that the major peak
within the gradient contained both the heavy chain and
2m, whereas fractions from the high salt wash contained heavy chain alone (Fig. 1, A and B).
2m heterodimer by ion exchange chromatography. (A) SDS-PAGE analysis of T10 heavy chain (lane 1)
and h
2m (lane 2) in urea, a 0.25 M NaCl ion exchange column peak fraction from the T10/h
2m purification (lane 3), and a 0.5 M NaCl high salt wash
ion exchange column fraction (lane 4). Subunits in lanes 1 and 2 have been size purified in 6 M urea after solubilization in guanidine-HCl. The gel was
stained with Coomassie blue. (B) SDS-PAGE analysis of T10 heavy chain (lane 1) and m
2m (lane 2) solubilized in guanidine-HCl, a 0.27 M NaCl ion
exchange column peak fraction from the T10/m
2m purification (lane 3), and a 0.5 M NaCl high salt wash ion exchange column fraction (lane 4). The
gel was stained with Coomassie blue. (C) Ion exchange chromatography profile from the T10/h
2m heterodimer purification. Two major peaks, one at
0.25 M NaCl in the 0.1-0.3 M NaCl gradient and a second peak eluting at 0.5 M NaCl in the high salt wash, are observed.
Fractions from the ion exchange column were assayed
for their ability to stimulate G8 
T cells. For all heterodimer purifications, only the material eluting within the
major peak in the gradient was active in these assays. The
folded T10/h
2m complex was found to stimulate G8 to
the same degree as T10/Ld transfected CHO cells (Fig. 2
A), which stimulate G8 to a higher level than the naturally
expressing EL4 or PCC3 cells (15). The T10/m
2m complex was also stimulatory (Fig. 2 B), but at an ~10-fold
lower level.

T cells by purified T10/h
2m heterodimer and by CHO T10/Ld cells. (B) Stimulation of G8 
T cells by
purified T10/m
2m heterodimer and by the moth cytochrome c 88-103
peptide-loaded MHC class II molecule, I-Ek.
The lower stimulatory activity of T10/m
2m in these
experiments is most likely due to its lower thermal stability
compared with that of the T10/h
2m form (as discussed
below). This could cause T10/m
2m to be more sensitive
to the denaturing effects of the coating process (26). We
have preincubated T10/h
2m and T10/m
2m with media
at 22°C for 10 h before T cell stimulation assays. This treatment does not change the dose-response curves for either
complex compared with those without preincubation. Together, these results clearly indicate that the complex has been correctly folded and can be recognized by G8, without the addition of peptide or nonpeptide components and,
likely, without the contribution of a media or serum component.
2m Is Structurally Different from Classical MHC Class
I Molecules.
Far-UV CD spectroscopy has been used to
analyze the structure and thermal stability of classical MHC
class I molecules and the rat neonatal Fc receptor (FcRn),
an MHC-like molecule that functions as an IgG transporter
(27). To obtain similar parameters for the reconstituted
T10/
2m heterodimer, we subjected both T10/h
2m and
T10/m
2m to CD analysis (Fig. 3, data not shown). Interestingly, the spectra of both T10/h
2m and T10/m
2m are
red-shifted compared with those reported for classical MHC
class I molecules and FcRn (27). This difference was
further verified by comparing the CD spectrum of T10
with that of E. coli-expressed and folded HLA-A2 molecules complexed with HIV pol peptide (Fig. 3). These data suggest that although these molecules are likely to have
similar folds, T10 has structural properties distinct from
classical class I MHC molecules (32).
2m (0.15 mg/mL; solid line)
and HLA-A2 (0.25 mg/mL; dotted line) heterodimers in 5 mM sodium
phosphate buffer (pH 7.0). Spectra were recorded using 0.1 cm cells at
25°C.
The thermal denaturation profile of the T10/h
2m complex is shown in Fig. 4 A. At neutral pH , the melting curve
reveals two transitions. The first is characterized by a transition temperature midpoint (Tm) of 49°C and reflects the simultaneous dissociation and unfolding of the T10 heavy
chain. The second transition, with a Tm at 63-64°C, is characterized by a sign reversal of the CD signal and closely parallels the unfolding profile of free
2m (Tm
64°C, data not
shown; references 29, 30), implying that its denaturation is
largely independent of the heavy chain. Consistent with its
lower activity in G8 stimulation assays, the T10/m
2m complex is less stable than the mouse-human combination, with a
Tm = 43°C (Fig. 5). Mouse
2m was observed to have a
Tm
62°C (data not shown). For each heterodimer, the
thermal transition is largely reversible (see Fig. 4 B; data not
shown).
2m heterodimer.
Protein concentration was 0.15 mg/mL. (B) CD scans of native, unfolded, and renatured T10/h
2m.
2m heterodimer. Protein
concentration was 0.15 mg/mL.
Assuming a standard two-state unfolding model, the free
energy change at a particular temperature,
G(T), can be
estimated from the melting curves shown here. At physiological temperature (37°C), we calculate free energy changes
of ~3.3 and 1.5 kcal/mol for the T10/h
2m and T10/
m
2m heterodimers, respectively. These values for T10/
h
2m and T10/m
2m can be translated into expected ratios
of folded to unfolded species of 200:1 and 11:1, respectively, at 37°C. The structural basis for the different thermal
stabilities of these heterodimers is presently under investigation.
By comparison, both forms of T10 are less stable than
classical class I molecules complexed with an appropriate
peptide, for which free energies >5kcal/mol and Tm of
65-72°C have been reported (29, 30). However, with the
exception of the Kd molecule, MHC class I molecules are
critically unstable in the absence of peptide and can not be
assembled. On the other hand, the stability of FcRn, which
does not bind peptide for either stability or function, lies in
between these extremes, with Tm of 62°C and 51°C at pH
6.0 and pH 8.0, respectively, the latter being very similar to
the the Tm of the T10/h
2m heterodimer (31).
We set out to evaluate directly whether a component
other than the T10 heavy chain and
2m is necessary for its
recognition by G8 and for the structural stability of the
molecule by producing the two subunits separately in E. coli and folding them together in vitro. We find that the
complex of T10 with murine
2m can be assembled in the
absence of any additional factors and that the heterodimer
is stimulatory to G8. However, T10/m
2m has a rather
low thermal stability, similar to that of the empty Kd molecule. The ability of plate bound T10/m
2m to stimulate
G8 is also lower than cells expressing T10, by ~10-fold.
Based on these observations, one possibility is that the
heterodimer expressed on the cell surface is further stabilized by a factor(s) other than the primary amino acid sequences of T10 and m
2m. This stabilizing factor for T10/
m
2m in vivo may be the carbohydrate moieties that are
covalently linked to the T10 heavy chain. Although T10
and T22 have three potential N-linked glycosylation sites
in the
1 and
2 domains, two more than classical MHC
class I molecules, the E. coli-produced subunits are not glycosylated. Recently, it was shown that the elimination of a
single N-glycan site in the adhesion domain of human
CD2, a protein belonging to the immunoglobulin superfamily, severely reduces the stability of the protein (33). It
is possible that one or more of the carbohydrates of T10/
T22 plays a critical role in stabilizing the structure of the
heterodimer. Alternatively, T10/m
2m might also be stabilized by association with a molecule not covalently linked
to the complex. However, regardless of the nature of such a stabilizing factor, by substituting the mouse
2m with human
2m in our in vitro system, we were able to increase
the stability of the T10 complex. T10/h
2m can stimulate
G8 at levels similar to that of the best stimulator cells.
These results indicate that, while an additional factor may
be necessary for the stable expression of T10 on the cell
surface, it does not confer specificity. Thus, the only essential feature required for G8 recognition is a properly folded
and stable T10 heavy chain and
2m heterodimer.
This scenario is reminiscent of the recognition of murine
class II I-Ek by the 
T cell LBK5. While I-Ek requires
peptide for stable expression on the cell surface, the bound
peptide does not confer specificity for its recognition by
LBK5. As shown previously, LBK5 can recognize I-Ek stabilized by a variety of different peptides (15). Thus, these two examples of 
T cell recognition differ fundamentally
from the recognition by 
T cells of classical or nonclassical MHC. In the latter case, the peptide or nonpeptide
moieties being presented contributes significantly to the
specificity of the recognition. However, unlike I-Ek, there
is no evidence that T10 binds peptide. This assertion is
based on the observation that no peptide(s) other than
those derived from the antibodies used for immunoprecipitation can be eluted from T10/Ld molecules isolated from
cells (19), as well as our result presented here that the folding of heterodimer does not require peptide. These observations are consistent with the primary amino acid sequences of T10/T22, which suggest that these molecules
may lack the necessary structural features to bind peptide.
Most notably, T10/T22 possess a 3-amino acid deletion
within the
1 domain and a 12-amino acid deletion within
the
2 domain (14). Thus, assuming that T10 and T22
molecules fold similarly to classical MHC molecules, the
2
-helical region, the conserved COOH-terminal peptide-binding pocket (pocket F), as well as the outermost
strand of the
1 domain and the outermost
strand of the
2 domain, would all be significantly altered (14).
Such structural features in T10 are not shared by FcRn, a
class Ib molecule that does not bind peptide. Crystallographic studies revealed that FcRn is structurally similar to
MHC molecules in its conservation of the
1 and
2 domain
topology of two helices that span a single
sheet, but the
presence of a proline at position 162 introduces a break in
the
2 helix of the molecule, causing a shift of its
helices
and resulting in a peptide-binding groove filled with side
chains (34). Consistent with the crystallographic analysis, it
was shown that the CD spectrum of FcRn and classical MHC are very similar (35). However, both spectra are
blue-shifted when compared with that of T10/
2m. This
observation indicates that T10 is likely to possess structural
properties not found in either MHC class I molecules or in
FcRn. Thus, these results suggest a new way for an MHC
class I-like molecule to adopt a peptide-free structure.
An alternative to the hypothesis that T10/T22 needs an
additional factor for stability is the possibility that rapid
turnover is a useful property in a ligand for 
T cell recognition. There is strong evidence that at least one role for 
T cells in the immune system is the surveillance for cells
that have become stressed or damaged (36). T10 molecules expressed on the cell surface are likely to have a shorter
half-life than classical MHC molecules. Consistent with this,
preliminary antibody stainings indicate low T10 cell surface
expression on primary lymphoid cells and EL4 cells (Crowley, M., and Y.-h. Chien, unpublished data). It is arguable
that a rapid turnover may better enable T10 to act as a transient target of sensory immune cells.
Address correspondence to Dr. Y.-h. Chien, D333 Fairchild Building, Department of Microbiology and Immunology, Stanford University, School of Medicine, Stanford, California 94305. The current address of N. Mavaddat is the Walter and Eliza Hall Institute of Medical Research, The Royal Melbourne Hospital, Victoria 3050, Australia.
Received for publication 10 April 1996 and in revised form 27 January 1997.
M.P. Crowley was supported by a fellowship from the National Science Foundation. Z. Reich was supported by The Rothchild Foundation, Israel, and is currently supported by The Howard Hughes Medical Institute. N. Mavaddat is supported by the National Health and Medical Research Council of Australia. We also thank the National Institutes of Health for grant support.
-D-thiogalactopyranoside.
We thank Drs. D. Garboczi and D. Wiley for providing the human HLA-A2 and h
2m constructs, Drs. J. Sacchettini and S. Nathenson for providing the m
2m construct, and Dr. M. Davis for critically reading the
manuscript.
| 1. | Shawar, S.M., J.M. Vyas, J.R. Rodgers, and R.R. Rich. 1994. Antigen presentation by major histocompatibility complex class I-B molecules. Annu. Rev. Immunol. 12: 839-880 [Medline]. [Medline] |
| 2. | Stroynowski, I., and K.F. Lindahl. 1994. Antigen presentation by nonclassical class I molecules. Curr. Opin. Immunol. 6: 38-44 [Medline]. [Medline] |
| 3. |
Kurlander, R.J.,
S.M. Shawar,
M.L. Brown, and
R.R. Rich.
1992.
Specialized role for a murine class 1-b MHC molecule in
prokaryotic host defenses.
Science (Wash. DC).
257:
678-679
[Medline].
|
| 4. | Shawar, S.M., R.G. Cook, J.R. Rodgers, and R.R. Rich. 1990. Specialized functions of MHC class I molecules. I. An N-formyl peptide receptor is required for construction of the class I antigen Mta. J. Exp. Med. 17: 872-912 . |
| 5. | Pamer, E.G., C.R. Wang, L. Flaherty, K.F. Lindahl, and M.J. Bevan. 1992. H-2M3 presents a Listeria monocytogenes peptide to cytotoxic T lymphocytes. Cell. 70: 215-223 [Medline]. [Medline] |
| 6. | Beckman, E.M., S.A. Porcelli, C.T. Morita, S.M. Behar, S.T. Furlong, and M.B. Brenner. 1994. Recognition of a lipid antigen by CD1-restricted alpha beta+ T cells. Nature (Lond.). 372: 691-694 [Medline]. [Medline] |
| 7. |
Sieling, P.A.,
D. Chatterjee,
S.A. Porcelli,
T.I. Prigozy,
R.J. Mazzaccaro,
T. Soriano,
B.R. Bloom,
M.B. Brenner,
M. Kronenberg,
P.J. Brennan, et al
.
1995.
CD1-restricted T cell recognition of microbial lipoglycan antigens.
Science (Wash. DC).
269:
227-230
[Medline].
|
| 8. |
Castano, A.R.,
S. Tangri,
J.E. Miller,
H.R. Holcombe,
M.R. Jackson,
W.D. Huse,
M. Kronenberg, and
P.A. Peterson.
1995.
Peptide binding and presentation by mouse CD1.
Science (Wash. DC).
269:
223-226
[Medline].
|
| 9. |
Bendelac, A.,
O. Lantz,
M.E. Quimby,
J.W. Yewdell,
J.R. Bennink, and
R.R. Brutkiewicz.
1995.
CD1 recognition by
mouse NK1+ T lymphocytes.
Science (Wash. DC).
268:
863-865
[Medline].
|
| 10. | Rotzschke, O., K. Falk, S. Stevanovic, B. Grahovac, M.J. Soloski, G. Jung, and H.G. Rammensee. 1993. Qa-2 molecules are peptide receptors of higher stringency than ordinary class I molecules. Nature (Lond.). 361: 642-644 [Medline]. [Medline] |
| 11. |
Joyce, S.,
P. Tabaczewski,
R.H. Angeletti,
S.G. Nathenson, and
I. Stroynowski.
1994.
A nonpolymorphic major histocompatibility complex class Ib molecule binds a large array of
diverse self-peptides.
J. Exp. Med.
179:
579-588
[Medline].
|
| 12. | Jiang, H., R. Ware, A. Stall, L. Flaherty, L. Chess, and B. Pernis. 1995. Murine CD8+ T cells that specifically delete autologous CD4+ T cells expressing V beta 8 TCR: a role of the Qa-1 molecule. Immunity. 2: 185-194 [Medline]. [Medline] |
| 13. |
Imani, F., and
M.J. Soloski.
1991.
Heat shock proteins can regulate expression of the Tla region-encoded class Ib molecule.
Qa-1.
Proc. Natl. Acad. Sci. USA.
88:
10475-10479
[Medline].
|
| 14. |
Ito, K.,
K.L. Van,
M. Bonneville,
S. Hsu,
D.B. Murphy, and
S. Tonegawa.
1990.
Recognition of the product of a novel
MHC TL region gene (27b) by a mouse ![]() T cell receptor.
Cell.
62:
549-561
[Medline].
[Medline] |
| 15. |
Schild, H.,
N. Mavaddat,
C. Litzenberger,
E.W. Ehrich,
M.M. Davis,
J.A. Bluestone,
L. Matis,
R.K. Draper, and
Y.H. Chien.
1994.
The nature of major histocompatibility
complex recognition by ![]() T cells.
Cell.
76:
29-37
[Medline].
[Medline] |
| 16. | Weintraub, B.C., M.R. Jackson, and S.M. Hedrick. 1994. Gamma delta T cells can recognize nonclassical MHC in the absence of conventional antigenic peptides. J. Immunol. 153: 3051-3058 [Medline]. [Abstract] |
| 17. |
Bluestone, J.A.,
R.Q. Cron,
M. Cotterman,
B.A. Houlden, and
L.A. Matis.
1988.
Structure and specificity of T cell receptor gamma/delta on major histocompatibility complex
antigen-specific CD3+, CD4 , CD8 T lymphocytes.
J.
Exp. Med.
168:
1899-1916
[Medline].
|
| 18. |
Bonneville, M.,
K. Ito,
E.G. Krecko,
S. Itohara,
D. Kappes,
I. Ishida,
O. Kanagawa,
C.A. Janeway,
D.B. Murphy, and
S. Tonegawa.
1989.
Recognition of a self major histocompatibility complex TL region product by gamma delta T-cell receptors.
Proc. Natl. Acad. Sci. USA.
86:
5928-5932
[Medline].
|
| 19. | Kaliyaperumal, A., R. Falchetto, A. Cox, R. Dick, J. Shabanowitz, Y.H. Chien, L. Matis, D.F. Hunt, and J.A. Bluestone. 1995. Functional expression and recognition of nonclassical MHC class I T10b is not peptide-dependent. J. Immunol. 155: 2379-2386 [Medline]. [Abstract] |
| 20. |
Jackson, M.R.,
E.S. Song,
Y. Yang, and
P.A. Peterson.
1992.
Empty and peptide-containing conformers of class I major
histocompatibility complex molecules expressed in Drosophila
melanogaster cells.
Proc. Natl. Acad. Sci. USA.
89:
12117-12121
[Medline].
|
| 21. | Silver, M.L., K.C. Parker, and D.C. Wiley. 1991. Reconstitution by MHC-restricted peptides of HLA-A2 heavy chain with beta 2-microglobulin, in vitro. Nature (Lond.). 350: 619-622 [Medline]. [Medline] |
| 22. |
Garboczi, D.N.,
D.T. Hung, and
D.C. Wiley.
1992.
HLA-A2-
peptide complexes: refolding and crystallization of molecules
expressed in Escherichia coli and complexed with single antigenic peptides.
Proc. Natl. Acad. Sci. USA.
89:
3429-3433
[Medline].
|
| 23. | Young, A.C.M., W. Zhang, J.C. Sachettini, and S.G. Nathenson. 1994. The three-dimensional structure of H-2Db at 2.4Å resolution: implications for antigen-determinant selection. Cell. 76: 39-50 . [Medline] |
| 24. | Privalov, P.L., and S.J. Gill. 1988. Stability of protein structure and hydrophobic interaction. Adv. Prot. Chem. 39: 191-234 [Medline]. [Medline] |
| 25. | Buchner, J., and R. Rudolph. 1991. Renaturation, purification and characterization of recombinant Fab-fragments produced in Escherichia coli. Bio/technology. 9:157-162. |
| 26. | Butler, J.E. 1991. Perspectives, configurations, and principles. In Immunochemistry of Solid-phase Immunoassay. J.E. Butler, editor. CRC Press, Inc., Boca Raton, FL. 3-26. |
| 27. |
Lancet, D.,
P. Parham, and
J.L. Strominger.
1979.
Heavy chain
of HLA-A and HLA-B antigens is conformationally labile: a
possible role for beta 2-microglobulin.
Proc. Natl. Acad. Sci.
USA.
76:
3844-3848
[Medline].
|
| 28. |
Gorga, J.C.,
A. Dong,
M.C. Manning,
R.W. Woddy,
W.S. Caughey, and
J.L. Strominger.
1989.
Comparison of the secondary structures of human class I and class II major histocompatibility complex antigens by Fourier transform infrared
and circular dichroism spectroscopy.
Proc. Natl. Acad. Sci. USA.
86:
2321-2325
[Medline].
|
| 29. |
Fahnestock, M.L.,
I. Tamir,
L. Narhi, and
P.J. Bjorkman.
1992.
Thermal stability comparison of purified empty and
peptide-filled forms of a class I MHC molecule.
Science
(Wash. DC).
258:
1658-1662
[Medline].
|
| 30. |
Bouvier, M., and
D.C. Wiley.
1994.
Importance of peptide
amino and carboxyl termini to the stability of MHC class I
molecules.
Science (Wash. DC).
265:
398-402
[Medline].
|
| 31. | Raghavan, M., L.N. Gastinel, and P.J. Bjorkman. 1993. The class I major histocompatibility complex related Fc receptor shows pH-dependent stability differences correlating with immunoglobulin binding and release. Biochemistry. 32: 8654-8660 [Medline]. [Medline] |
| 32. | Greenfield, N., and G.D. Fasman. 1969. Computed circular dichroism spectra for the evolution of protein conformation. Biochemistry. 8: 4108-4116 [Medline]. [Medline] |
| 33. |
Wyss, D.F.,
J.S. Choi,
J. Li,
M.H. Knoppers,
K.J. Willis,
A.R. Arulanandam,
A. Smolyar,
E.L. Reinherz, and
G. Wagner.
1995.
Conformation and function of the N-linked glycan in
the adhesion domain of human CD2.
Science (Wash. DC).
269:
1273-1278
[Medline].
|
| 34. | Burmeister, W.P., L.N. Gastinel, N.E. Simister, M.L. Blum, and P.J. Bjorkman. 1994. Crystal structure at 2.2 Å resolution of the MHC-related neonatal Fc receptor. Nature (Lond.). 372: 336-343 [Medline]. [Medline] |
| 35. |
Gastinel, L.N.,
N.E. Simister, and
P.J. Bjorkman.
1992.
Expression and crystallization of a soluble and functional form of
an Fc receptor related to class I histocompatibility molecules.
Proc. Natl. Acad. Sci. USA.
89:
638-642
[Medline].
|
| 36. |
Carding, S.,
W. Allan,
S. Kyes,
A. Hayday, and
P. Doherty.
1990.
Late dominance of the inflammatory process in murine
influenza by - + T cells.
J. Exp. Med.
172:
1225-1231
[Medline].
|
| 37. |
Hara, T.,
Y. Mizuno,
K. Takaki,
H. Takada,
H. Akeda,
T. Aoki,
M. Nagata,
K. Ueda,
G. Matsuzaki,
Y. Yoshikai, et al
.
1992.
Predominant activation and expansion of V 9-bearing
![]() T cells in vivo as well as in vitro in salmonella infection.
J.
Clin. Invest.
90:
204-210
[Medline].
|
| 38. |
Hou, S.,
M. Kats,
P.C. Doherty, and
S.R. Carding.
1992.
Extent of ![]() T cells involvement in the pneumonia caused
by Sendai virus.
Cell. Immunol.
143:
183-193
[Medline].
[Medline] |
| 39. |
Hiromatsu, K.,
Y. Yoshikai,
G. Matsuzaki,
S. Ohga,
K. Muramori,
K. Matsumoto,
J. Bluestone, and
K. Nomoto.
1992.
A protective role of - T cells in primary infection with
Listeria monocytogenes in mice.
J. Exp. Med.
175:
49-56
[Medline].
|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|