The Journal of Experimental Medicine
Rockland Immunochemicals for Research
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 184K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lauzurica, P.
Right arrow Articles by Roberts, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lauzurica, P.
Right arrow Articles by Roberts, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Exp. Med.
© The Rockefeller University Press
0022-1007/97/04/1193/10 $2.00
Volume 185, Number 7, April 7, 1997 1193-1202

Regulation of  T Cell Receptor delta  Gene Rearrangement by CBF/PEBP2

By Pilar Lauzurica, Xiao-Ping Zhong, Michael S. Krangel, and Joseph L. Roberts

From the Department of Immunology, Duke University Medical Center, Durham, North Carolina 27710

Summary
Materials and Methods
Results
Discussion
Footnotes
Acknowledgements
References


Summary

We have analyzed transgenic mice carrying versions of a human T cell receptor (TCR)-delta gene minilocus to study the developmental control of  VDJ (variable/diversity/joining) recombination. Previous data indicated that a 1.4-kb DNA fragment carrying the TCR-delta enhancer (Edelta ) efficiently activates minilocus VDJ recombination in vivo. We tested whether the transcription factor CBF/PEBP2 plays an important role in the ability of Edelta to activate VDJ recombination by analyzing VDJ recombination in mice carrying a minilocus in which the delta E3 element of Edelta includes a mutated CBF/PEBP2 binding site. The enhancer-dependent VD to J step of minilocus rearrangement was dramatically inhibited in three of four transgenic lines, arguing that the binding of CBF/PEBP2 plays a role in modulating local accessibility to the VDJ recombinase in vivo. Because mutation of the delta E3 binding site for the transcription factor c-Myb had previously established a similar role for c-Myb, and because a 60-bp fragment of Edelta carrying delta E3 and delta E4 binding sites for CBF/PEBP2, c-Myb, and GATA-3 displays significant enhancer activity in transient transfection experiments, we tested whether this fragment of Edelta is sufficient to activate VDJ recombination in vivo. This fragment failed to efficiently activate the enhancerdependent VD to J step of minilocus rearrangement in all three transgenic lines examined, indicating that the binding of CBF/PEBP2 and c-Myb to their cognate sites within Edelta , although necessary, is not sufficient for the activation of VDJ recombination by Edelta . These results imply that CBF/PEBP2 and c-Myb collaborate with additional factors that bind elsewhere within Edelta to modulate local accessibility to the VDJ recombinase in vivo.


The process of VDJ recombination assembles variable (V)1, diversity (D), and joining (  J) gene segments at TCR and Ig loci during lymphocyte development, generating the diverse antigen receptor repertoires that characterize mature T and B lymphocytes (1). VDJ recombination is under stringent developmental control, as it is activated at individual antigen receptor loci with unique cell lineage-specific and developmental stage-specific properties. Thus, fully rearranged TCR genes are only generated in developing T lymphocytes, and fully rearranged Ig genes are only generated in developing B lymphocytes. Further, TCR-beta , -gamma , and -delta rearrangement occurs earlier during thymocyte development than TCR-alpha rearrangement (6), and IgH rearrangement occurs earlier in B cell development than Igkappa and lambda  rearrangement (1). Because all of these loci are thought to share both recombination signal sequences and the known components of the recombinase machinery, it is generally believed that these factors cannot account for locus-specific regulation of VDJ recombination. Rather, it is thought that locus-specific regulation is accomplished by modulating the accessibility of chromosomal recombination substrates to the recombinase (1).

The expression of fully rearranged TCR and Ig genes is controlled by a promoter flanking the V gene segment, and one or more transcriptional enhancers located adjacent to the C gene segment (7, 8). Recent studies have indicated that these cis-acting elements are also required for the developmental activation of VDJ recombination at individual antigen receptor loci. This has been accomplished by eliminating, mutating, or substituting enhancer or promoter elements within chromosomally integrated VDJ recombination substrates in transgenic mice (9), as well as by eliminating enhancer elements from endogenous antigen receptor loci by homologous recombination (17). These studies show that the efficiency of VDJ recombination is dramatically inhibited in the absence of a functional enhancer, and that the developmental activation of VDJ recombination can be modified by substitution of one enhancer for another.

We have previously studied the developmental control of VDJ recombination in transgenic mice carrying a human TCR-delta gene minilocus (13, 14). Efficient VDJ recombination of this minilocus requires the presence of Edelta within the Jdelta 3-Cdelta intron. Interestingly, the first step of minilocus rearrangement, V to D, occurs even in the absence of Edelta , whereas the second step of minilocus rearrangement, VD to J, is Edelta dependent (13). Thus, a functional enhancer is critical for establishing J segment accessibility to the VDJ recombinase machinery. Furthermore, substitution of Ealpha for Edelta within the minilocus reveals that Edelta and Ealpha regulate both the T cell subset and developmental stage specificity of the VD to J step of minilocus rearrangement in a manner that mimics the developmental activation of Vdelta Ddelta Jdelta and Valpha Jalpha rearrangement, respectively, at the endogenous TCR-alpha /delta locus (14). These results lead to the conclusion that Edelta and Ealpha are indeed responsible for the developmental regulation of VDJ recombination at the endogenous TCR-alpha /delta locus.

The developmental properties of Edelta and Ealpha presumably result from the binding of specific trans-acting factors to discrete sites within the enhancers. Therefore, to better understand the mechanism by which these enhancers control VDJ recombination, we have begun to introduce mutations into previously defined cis-acting enhancer elements within the context of the TCR-delta gene minilocus, and to measure the effects of these mutations on the process of VDJ recombination in vivo.

Edelta was initially defined and functionally dissected in transient transfection and in vitro protein binding studies (24- 28). These experiments identified an essential element of the enhancer, delta E3, that contains adjacent binding sites for the transcription factors CBF/PEBP2 (29) and c-Myb (32). Intact binding sites for both CBF/PEBP2 (the "core" site) (25) and c-Myb (27) are required for transcriptional activation by Edelta . Because CBF/PEBP2 has been implicated in TCR-alpha , -beta , and -gamma enhancer activity as well (30, 33- 36), it appears to be a crucial and broadly important regulator of T cell development and T cell-specific gene expression. Mice carrying a homozygous mutation within the gene encoding one particular CBF/PEBP2 isoform (alpha B) display a very early defect in hematopoiesis and early embryonic lethality (37). Although these results clearly demonstrate an important role for CBF/PEBP2 in the development of early hematopoietic precursor cells, they do not provide information regarding subsequent molecular events that might be regulated by CBF/PEBP2 within developing thymocytes in vivo.

The present study was initiated to determine whether CBF/PEBP2 plays an important role in the developmental activation of TCR genes in vivo, by specifically testing its role in the activation of VDJ recombination by Edelta . We found that disruption of the delta E3 core site significantly impairs the ability of Edelta to activate VDJ recombination within the TCR-delta gene minilocus, suggesting that CBF/PEBP2 is an important regulator of VDJ recombination in vivo. Since previous data had indicated an important role for c-Myb as well, we then asked whether a small fragment of Edelta carrying binding sites for these factors as well as GATA-3 was sufficient to activate VDJ recombination. We found that this was not the case, arguing that additional cis-acting elements of Edelta are also required to establish local accessibility to the VDJ recombinase.


Materials and Methods

Production of Transgenic Mice. The CBF/PEBP2 binding site mutation was generated by PCR using as a template the 1.4-kb wild-type Edelta subcloned into the XbaI site of pBluescript KS+ (1.4Edelta BS). PCR overlap extension was performed as described (38) using mutagenic oligonucleotides ACOREM (AGCAATGCATGACCTTTCCAACCG) and BCOREM (CGGTTGGAAAGGTCATGCATTGCT) along with EDRA (CTTTTAAAATTCTAGCAAGC) and the reverse primer as outside primers. The final PCR product was digested with NsiI and BamHI to generate a 170-bp fragment of Edelta carrying the 3-bp change in delta E3 that eliminates CBF/PEBP2 binding. The plasmid 1.4Edelta BS was also digested with PfiMI and NsiI to obtain an adjacent 590-bp fragment of Edelta . The two fragments were ligated together into PfiMI and BamHI cut 1.4Edelta BS. The structure of the resulting plasmid was determined by restriction mapping and dideoxynucleotide sequence analysis. The 1.4-kb Edelta mCore was excised from this plasmid with XbaI and cloned into XbaI-digested, phosphatase-treated pBluescript carrying the previously described enhancerless minilocus (13).

A minilocus construct containing the delta E3,4 region was generated as follows. A 60-bp Nsi-AluI fragment of Edelta (delta E3,4) had been previously subcloned into PstI and EcoRV cut pBluescript KS+. The insert was excised from this plasmid by digestion with BamHI and HindIII and the ends were blunted by treatment with the Klenow fragment of Escherichia coli DNA polymerase I. This fragment was then ligated into Xba I-digested, blunted, and phosphatase-treated pBluescript carrying the enhancerless minilocus. The structures of both minilocus constructs were confirmed by dideoxynucleotide sequence analysis.

Minilocus DNA was purified as described previously (13), and was microinjected into fertilized C57BL/6 × SJL F2 eggs by the Duke University Comprehensive Cancer Center Transgenic Mouse Shared Resource. Progeny tail DNA samples were analyzed on Southern blots as described previously (13). Transgenes were maintained on a mixed C57BL/6 × SJL background. Copy number was determined by analysis of tail DNA on a slot blot (Schleicher and Schuell, Keene, NH) using a radiolabeled Cdelta cDNA probe. Hybridization signals were quantified relative to previously identified single copy integrants using a Betascope (Betagen, Waltham, MA).

Preparation and Analysis of Genomic DNA. Genomic DNA preparation, PCR, gel electrophoresis, blotting onto nylon membranes (Hybond-N; Amersham, Arlington Heights, IL or MAGNA nylon; Micron Separations Inc., Westboro, MA), and hybridization with 32P-labeled probes were performed as described previously (13). The amount of DNA template used in PCR reactions (2-12 ng) was adjusted based on the results of amplification using Cdelta primers to account for differences in transgene copy number and PCR efficiency between samples, so that all PCR signals were maintained in the linear range. TCR-delta minilocus PCR primers 1 (VD1), 2 (VD2), 3 (JD1), 4 (JD3), 5 (CDA), and 6 (CDB), as well as the Vdelta 1, Vdelta 2, and Cdelta fragments used as probes to develop Southern blots of PCR products or genomic restriction digests, were described previously (13). These primers and probes allow detection of human TCR-delta minilocus sequences, but do not allow detection of endogenous murine TCR-delta locus sequences. Quantification of PCR signals was accomplished using either a Betascope or a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).


Results

An Intact CBF/PEBP2 Binding Site Is Necessary for Efficient TCR-delta Gene Rearrangement In Vivo.

The previously studied human TCR-delta gene minilocus is a 22.5-kb construct containing germline Vdelta 1, Vdelta 2, Ddelta 3, Jdelta 1, Jdelta 3, and Cdelta gene segments, along with a wild-type version of Edelta within the Jdelta 3Cdelta intron (13) (Fig. 1 A). The Vdelta 1 and Vdelta 2 coding segments carry mutations to prevent a rearranged transgene from encoding a TCR protein that might interfere with normal murine T cell development. Thus, the minilocus serves as a phenotypically neutral in vivo reporter of VDJ recombination.



Fig. 1. Structure and analysis of the Edelta , Edelta mCore, and delta E3,4 transgenes. (A) Schematic representations of the Edelta and Edelta mCore minilocus recombination substrates includes coding exons (filled boxes) and protein binding sites within Edelta (open boxes). The 3-bp substitution in the delta E3 core site is shown. (B) Schematic representation of the delta E3,4 minilocus recombination substrate. (C) Primers used for analysis of minilocus rearrangement by PCR from genomic DNA (arrowheads). (D) Depiction of PCR products generated from Vdelta 1 rearrangements using primers 1, 3, and 4. A similar set of PCR products are generated from Vdelta 2 rearrangements using primers 2, 3, and 4.
[View Larger Versions of these Images (23 + 19K GIF file)]

For this study, we initially constructed a new version of the minilocus, referred to as Edelta mCore, that carries a three- basepair change in the delta E3 core sequence within Edelta (Fig. 1 A). The identical mutation was previously shown to eliminate CBF/PEBP2 binding to delta E3 in vitro, and to eliminate transcriptional activation by Edelta in transient transfection experiments (25). Three transgenic founders, designated U, Y, and Z, were initially obtained. Breeding experiments indicated that in each of founders U and Z, the Edelta mCore minilocus was integrated at a single site in the mouse genome, whereas in founder Y there were two independently segregating transgene integration sites. As a result, four different Edelta mCore transgenic lines (U, Z, Y1, Y2) were established. As assessed by slot blot, the transgene copy numbers were: U, 8 copies; Z, 3 copies; Y1, 1 copy; and Y2, 2 copies. The single copy integrant in line Y1 was truncated so as to delete ~4-5 kb at the 3' end of the minilocus. This truncation leaves Vdelta , Ddelta , Jdelta gene segments, Edelta and the first Cdelta exon intact, and as such, is not expected to have a significant effect on minilocus VDJ recombination.

Analysis of wild-type and Edelta mCore minilocus VDJ recombination was performed by PCR from thymus genomic DNA templates, using specific Vdelta 1, Vdelta 2, Jdelta 1, and Jdelta 3 primers (primers 1, 2, 3 and 4; Fig. 1 C) as described previously (13). Previous studies have shown the wild-type minilocus to rearrange stepwise, first V to D, and then VD to J (13). Amplification with Vdelta and Jdelta 1 primers yields 0.3kb fragments that represent complete VDJ rearrangements, and in addition, 1.2-kb fragments that represent the VD rearrangement intermediates (Fig. 1 D). Amplification with Vdelta and Jdelta 3 primers yields 0.3-kb VDJ products only. PCR reactions were also performed with a pair of Cdelta primers (primers 5 and 6; Fig. 1 C), to control for differences in transgene copy number and PCR efficiency between samples; the amount of genomic DNA template used in PCR reactions was typically adjusted to obtain similar Cdelta amplification signals in each sample. PCR products were detected and quantified by agarose gel electrophoresis followed by blotting and hybridization with appropriate 32P-labeled probes. In agreement with our previous studies (13), quantification of PCR signals revealed amplification to be linear over a broad range of template concentrations (Fig. 2).


Fig. 2. Quantification of minilocus VDJ rearrangement. Serially diluted samples of thymus genomic DNA from Edelta line A were amplified by PCR using primers 1 and 3 or primers 5 and 6, and Southern blots were developed using radiolabeled Vdelta 1 and Cdelta cDNA probes. The Vdelta 1Ddelta 3-Jdelta 1 (solid line) and Cdelta (dotted line) hybridization signals were quantified using a PhosphorImager. The results are expressed log hybridization signal in arbitrary units versus log DNA concentration in µg/ml. The second most concentrated DNA sample in this experiment corresponds to the amount of DNA used for analysis of single copy integrants in all subsequent experiments. Lower amounts of DNA were used for multicopy integrants.
[View Larger Version of this Image (16K GIF file)]

We analyzed the effect of the core site mutation on minilocus VDJ recombination by comparing VD and VDJ rearrangement levels in thymocytes from three previously characterized lines of mice carrying a minilocus with a wild-type Edelta (A, B, C) (13) to thymocytes in the four lines of mice carrying the Edelta mCore minilocus (Fig. 3, A and B). All Edelta lines of mice carry single copy integrations of the minilocus. Whereas the minilocus integrations in lines A and B include all relevant gene segments, the integration in line C is truncated at the 5' end and is missing the Vdelta 1 gene segment. Thus, lines A and B are informative for both Vdelta 1 and Vdelta 2 rearrangement, whereas line C is informative for Vdelta 2 rearrangement only. As in previous studies, PCR analysis of VDJ recombination in the Edelta lines revealed high levels of 0.3-kb VDJ rearrangement products in each case (Fig. 3, A and B). Levels of 1.2-kb VD rearrangement products were lower and more variable (Fig. 3 A). Thus, as observed previously (13), the enhancer-dependent VD to J step of transgene rearrangement occurs efficiently in each of the Edelta lines.



Fig. 3. PCR analysis of Edelta and Edelta mCore minilocus rearrangement. (A) Genomic DNA from thymi of wild-type Edelta mice from lines A, B, and C, and from Edelta mCore mice from lines U, Y1, Z, and Y2 were amplified by PCR using primers 5 and 6 (top), primers 1 and 3 (middle) and primers 2 and 3 (bottom). Southern blots were developed using radiolabeled Cdelta , Vdelta 1 or Vdelta 2 cDNA probes. The mice analyzed were A-26 (3 wk old), B-29 (2 wk old), C-306 (6 wk old), U-19 (5 wk old), Y1-83 (2 wk old), Z-92 (3 wk old), and Y287 (2 wk old). (B) Genomic DNA from the thymi of mice from lines A, U, Z, and Y2 were amplified by PCR using primers 5 and 6 (top), primers 1 and 4 (middle) and primers 2 and 4 (bottom). The mice analyzed were A-866, U-339, Z-419 and Y2-280 (all 4 wk old).
[View Larger Versions of these Images (46 + 42K GIF file)]

Analysis of VDJ recombination in the four Edelta mCore lines revealed quite different results. In three of the lines (U, Y1, and Z), 0.3-kb products representing VDJ rearrangement were barely detectable, even though 1.2-kb VD rearrangement products were readily apparent (Fig 3, A and B). In the fourth line (Y2), VD and VDJ rearrangement products were both detected at levels that were comparable to their representation in Edelta lines. The analysis of a second animal in each line (data not shown) yielded quite similar results, arguing that these VDJ recombination phenotypes are stable and reproducible characteristics of the individual transgenic lines. Because PCR amplifications with the Cdelta primer pair and with the Vdelta 1-Jdelta 1 primer pair were shown to be linear over several orders of magnitude (Fig. 2) we were justified in quantifying the level of VDJ recombination in the different lines by normalizing the Vdelta 1-Jdelta 1 PCR signal to the Cdelta PCR signal in each line. The levels of VDJ recombination in lines U, Y1 and Z, each calculated as the mean of three independent determinations, were found to be 0.8, 1.3, and 0.3%, respectively, of the level in Edelta line A, and 3.1, 4.9, and 1.2%, respectively, of the level in Edelta line B (Table 1). Similar quantification revealed VDJ recombination in line Y2 to be 41.7% of the level in line A, and 159.8% of the level in line B (Table 1).

Table 1. VDJ Rearrangement in Edelta , Edelta mCore, and delta E3,4 Transgenic Lines


Construct Line Vdelta 1-Ddelta 3-Jdelta 1/Cdelta

Edelta A (100)
B 26.1 ± 11.1
Edelta mCore U 0.8 ± 0.4
Y1 0.3 ± 0.3
Z 1.3 ± 0.8
Y2      41.7 ± 7.8
 delta E3,4 JA 1.4 ± 0.6
JG 4.7 ± 2.6

The Vdelta 1-Ddelta 3-Jdelta 1 and Cdelta hybridization signals were measured in three independent experiments. In each experiment, the Vdelta 1-Ddelta 3-Jdelta 1 signal was normalized to the Cdelta signal, and the results are reported as the mean ± SD. VDJ recombination expressed as a percentage of VDJ recombination in line A. 

The conclusions drawn from PCR analysis were confirmed through analysis of Vdelta 1-Ddelta 3 and Vdelta 1-Ddelta 3-Jdelta 1 rearrangements by genomic Southern blot (Fig. 4). Edelta line A thymocytes displayed nearly undetectable germline Vdelta 1 (1.0 kb), moderate Vdelta 1-Ddelta 3 rearrangement (0.9 kb), and substantial Vdelta 1-Ddelta 3-Jdelta 1 rearrangement (1.7 kb). In accord with the PCR data, Vdelta 1-Ddelta 3-Jdelta 1 rearrangement was not detected in lines U and Z, even though transgene copy was higher in these lines than in Edelta line A. Importantly, Vdelta 1Ddelta 3 rearrangement was readily detected in both lines, and accounted for almost all of the Vdelta 1 signal in line Z. Although the reduced sensitivity of genomic Southern blot analysis as compared to PCR analysis does not allow an independent evaluation of the extent to which VDJ recombination is reduced in lines U and Z, the readily detectable Vdelta 1-Ddelta 3 rearrangement demonstrates that the ratio of  VD to VDJ rearrangement has been dramatically perturbed in these lines. As these results argue that the VD to J step of transgene rearrangement has been specifically inhibited, they provide strong support for the PCR data. Also in accord with the PCR data, Vdelta 1-Ddelta 3 and Vdelta 1-Ddelta 3-Jdelta 1 rearrangements were both detected in line Y2. Thus, on the basis of both PCR and genomic Southern blot analyses, we conclude that the enhancer-dependent step of minilocus rearrangement is dramatically and preferentially impaired in three of the four Edelta mCore transgenic lines, but occurs quite normally in the fourth line.


Fig. 4. Edelta , delta E3,4, and Edelta mCore minilocus rearrangement analyzed by genomic Southern blot. A Southern blot carrying PstI plus EcoRI digested tail (germline control) and thymus DNA samples from Edelta line A, delta E3,4 lines JA and JG, and Edelta mCore lines U, Z, and Y2 was developed with a radiolabeled 1.0 kb Vdelta 1 genomic PstI fragment as a probe. The mice analyzed were A-866, JA-81, JG-42, U-339, Z-352, and Y2-280 (all 4 wk old).
[View Larger Version of this Image (44K GIF file)]

These results are reminiscent of our previous work analyzing VDJ recombination within a TCR-delta minilocus lacking Edelta (13) or containing a disrupted binding site for c-Myb (39). In four of five transgenic lines carrying the minilocus construct lacking Edelta , and in three of four transgenic lines carrying the minilocus construct with a disrupted binding site for c-Myb, inhibition of the VD to J rearrangement step was almost complete. However, in each case one of the transgenic lines displayed higher levels of VD to J rearrangement. Such heterogeneity in TCR-delta minilocus transgenic lines in which Ealpha has been eliminated or inactivated probably reflects the distinct properties of the different transgene integration sites. We propose that in E-, Edelta mMyb, and Edelta mCore lines in which the VD to J step still occurs, the minilocus has integrated adjacent to active regulatory elements that partially or completely supplant the need for Edelta . Heterogeneity of this magnitude has not been observed in transgenic lines carrying an intact enhancer, as VD to J rearrangement is efficient in three of three Edelta lines (Fig. 3) and four of four Ealpha lines (14). On the basis of the phenotype displayed by the majority of Edelta mCore transgenic lines, we conclude that elimination of a functional CBF/PEBP2 binding site within Edelta has a dramatic effect on the ability of Edelta to provide the regional accessibility to the VDJ recombinase that is required for efficient VDJ recombination in vivo.

Intact Binding Sites for CBF/PEBP2, c-Myb, and GATA-3 Are not Sufficient for Efficient TCR-delta Gene Rearrangement In Vivo.

Previous in vitro binding and transient transfection studies identified a functionally important binding site for c-Myb that is within the delta E3 element and adjacent to the CBF/PEBP2 binding site (27), as well as two functionally important binding sites for GATA-3 within the adjacent delta E4 element (40, 41). A 60-bp delta E3,4 fragment of Edelta containing only these binding sites displays 20-50% of the activity of the intact 1.4-kb Edelta in transient transfection experiments (25). Since CBF/PEBP2 (this study) and c-Myb (39) were implicated as important regulators of VDJ recombination in vivo, we asked whether the combination of CBF/ PEBP2, c-Myb and GATA-3 binding sites within delta E3 and delta E4 was sufficient to activate this process.

Therefore, the 60-bp delta E3,4 fragment of Edelta was introduced into the TCR-delta gene minilocus in place of Edelta (Fig. 1 B). Three transgenic founders were obtained and were used to generate independent lines of transgenic mice designated JA, JE, and JG. Slot blot analysis indicated transgene copy numbers of 2, 1, and 24 for JA, JE, and JG, respectively. As in Edelta line C, the single copy delta E3,4 line JE is truncated such that it lacks Vdelta 1 but retains Vdelta 2. Hence, this line is informative for Vdelta 2 rearrangement only.

Analysis of wild-type Edelta and delta E3,4 minilocus VDJ recombination was performed by PCR as described above. All three delta E3,4 lines revealed dramatically reduced levels of VDJ rearrangement as compared to Edelta lines A, B, and C (Fig. 5, A and B). In lines JA and JE, VDJ rearrangement was essentially undetectable, whereas in line JG, VDJ rearrangement was detectable at reduced levels. Nevertheless, VD rearrangement signals were readily detected by PCR in all three lines, and were detected at particularly high levels in line JA. Quantification of Vdelta 1-Jdelta 1 and Cdelta PCR signals indicated that VDJ rearrangement in lines JA and JG were reduced to 1.4 and 4.7%, respectively, of the level in Edelta line A, and to 5.2 and 17.9%, respectively, of the level in Edelta line B (Table 1). Analysis of Vdelta 1-Ddelta 3 and Vdelta 1-Ddelta 3-Jdelta 1 rearrangements by genomic Southern blot confirmed that essentially all copies of Vdelta 1 were rearranged to Ddelta 3 in line JA, but that rearrangement was blocked at this stage (Fig. 4). Although the low level of VDJ rearrangement detected in line JG could not be confirmed due to both the limited sensitivity of detection and the presence of comigrating germline fragments in the tail DNA control, the results for JG did suggest that PCR may have underestimated the level of Vdelta 1-Ddelta 3 rearrangement in this line. Also of note is the significant reduction in transgene copy number in thymus relative to tail in this line (Fig. 4 and data not shown). This most likely results from the rearrangement of Vdelta 1 in one copy of the tandemly arrayed transgene to Ddelta 3 in another copy, with deletion of intervening copies. In summary, on the basis of the dramatic inhibition of VD to J recombination detected in both PCR and genomic Southern blot analyses, we conclude that the combination of CBF/ PEBP2, Myb, and GATA-3 binding sites contained within delta E3 and delta E4 is not by itself capable of promoting the accessible chromatin configuration required for efficient minilocus VDJ recombination.



Fig. 5. PCR analysis of Edelta and delta E3,4 minilocus rearrangement. Genomic DNA from thymi of wild-type Edelta mice from lines A, B, and C, and from delta E3,4 mice from lines JA, JE, and JG were amplified by PCR using primers 5 and 6 (top), primers 1 and 3 (middle) and primers 2 and 3 (bottom). Southern blots were developed using radiolabeled Cdelta , Vdelta 1, or Vdelta 2 cDNA probes. The mice analyzed were A-765 (4 wk old), B-31 (8 wk old), C-114 (4 wk old), JA-81 (4 wk old), JE101 (4 wk old), and JG-42 (4 wk old). (B) Genomic DNA from the thymi of mice from lines A, JA, JE, and JG were amplified by PCR using primers 5 and 6 (top), primers 1 and 4 (middle) and primers 2 and 4 (bottom). The mice analyzed were A-866, JA-81, JE-101, and JG-42 (all 4 wk old).
[View Larger Versions of these Images (49 + 40K GIF file)]


Discussion

We previously documented enhancer-dependent VDJ recombination within a human TCR-delta gene minilocus construct in transgenic mice (13, 14), and have now begun to address the mechanisms by which Edelta exerts its effects on VDJ recombination in this system. The data presented here indicates that a mutation that destroys the binding site for the transcription factor CBF/PEBP2 within the delta E3 element of Edelta seriously compromises the ability of Edelta to activate the VD to J step of minilocus rearrangement. Hence, by binding to Edelta , this or a very closely related factor plays a crucial role in the developmental activation of minilocus rearrangement in vivo. We interpret the pattern of transgene rearrangement in the presence or absence of a functional Edelta to indicate that a functional Edelta is required to promote the accessibility of Jdelta gene segments to the VDJ recombinase within the transgenic minilocus. Although not directly proven, we infer that a functional Edelta is also required to promote Jdelta gene segment accessibility, and hence VDJ recombination, within the endogenous TCR-delta locus. Our data therefore suggest strongly that CBF/PEBP2 family transcription factors are likely to be important regulators of TCR-delta gene rearrangement at the endogenous TCR-delta locus in vivo. Nevertheless, formal proof for this notion would require elimination of the Edelta CBF/PEBP2 binding site from the endogenous locus by homologous recombination.

CBF/PEBP2 was initially identified by virtue of its ability to bind to and activate transcription from polyoma virus enhancer and the long terminal repeats of murine T lymphotropic retroviruses (42, 43). Functional CBF/PEBP2 binding sites have been identified in the regulatory elements of several cellular genes expressed in either the T lymphoid or myeloid cell lineages (44), including the enhancers of all four TCR genes (30, 33). CBF/PEBP2 is actually a complex family of transcription factors, each of which is composed of a DNA-binding alpha  subunit and an associated beta  subunit (29). Three distinct genes (alpha A, alpha B, and alpha C) encode related alpha subunits (30, 49), a separate gene encodes a shared beta  subunit (29, 31), and additional complexity is introduced by production of multiple alpha  and beta  isoforms from the individual genes (29, 53). Thus, any one of a number of CBF/PEBP2 species might be the crucial regulator of TCR-delta gene rearrangement in vivo. Although recent analysis of CBF/PEBP2 alpha B null mice emphasizes a crucial role for this particular factor in hematopoiesis, the early lethality and pleiotropic effects of this mutation preclude any specific conclusions regarding a role in TCR-delta gene rearrangement (37). A candidate regulator of  TCR-delta gene rearrangement would have to be expressed as early as the CD4-CD8- stage of thymocyte development, since the endogenous TCR-delta locus (54, 55) and our transgenic minilocus (14) are both activated during this stage. Notably, CBF/PEBP2 alpha A and alpha B are both expressed at highest levels in the thymus and are both expressed in CD4-CD8- thymocytes (56). Thus, both of these factors have expression patterns that would be consistent with a role in the activation TCR-delta gene rearrangement and expression in vivo.

Related studies using the transgenic minilocus approach have also implicated the transcription factor c-Myb in the activation of TCR-delta gene rearrangement in vivo (39). Hence CBF/PEBP2 and c-Myb appear to synergize to activate TCR-delta gene VDJ recombination in vivo, much as they were found to synergistically activate TCR-delta gene transcription in transient transfection studies (27, 28). Nevertheless, our results indicate that the combination of CBF/PEBP2, Myb, and GATA-3 binding sites within delta E3 and delta E4 is not, by itself, sufficient to promote the accessibility required for efficient activation of VDJ recombination within the TCR-delta gene minilocus. This suggests that additional cis-acting elements contained within the 1.4-kb Edelta are crucial for this process. Such elements may be contained within the 370-bp fragment of Edelta found to contain maximal enhancer activity in transient transfection experiments. Analyses of truncated forms of the enhancer suggest delta E2, delta E5, and delta E6 as candidate cis-acting elements of Edelta that might individually or in combination increase the activity of the minimal enhancer by two- to threefold (24, 25). Little is known about the identities of the factors that interact with these elements. Nevertheless, it may be misleading to identify candidate determinants of Edelta recombinational enhancer activity in a chromosomally integrated context in transgenic mice by extrapolating from those required for transcriptional enhancer activity in transient transfection experiments. For example, nuclear matrix attachment sites that flank Eµ are irrelevant for transcriptional activity as measured in transient transfection experiments or in chromosomally integrated substrates in stably transfected cells, but are important for the induction of transcriptional activity and general sensitivity to DNase I digestion in a chromosomally integrated substrate in transgenic mice (57). Similarly sequences that flank the human adenosine deaminase gene enhancer are irrelevant for transcriptional activity in transient transfection experiments, but are required for high level expression and the establishment of enhancer DNase I hypersensitivity in transgenic mice (58, 59). It is therefore quite possible that cis-elements contained within the 1.4-kb Edelta might not appear relevant for gene expression on the basis of transient transfection experiments, but might be critical for Edelta induced accessibility and VDJ recombination in transgenic mice. These additional cis-acting elements could be required for the stable assembly of CBF/PEBP2, c-Myb, and GATA-3 onto their delta E3 and delta E4 binding sites in a chromatin context. Alternatively, delta E3 and delta E4 might by themselves be able to support the assembly of a stable nucleoprotein complex, but additional cis-acting enhancer elements might contribute independently to accessibility and VDJ recombination. The hierarchy of assembly of nucleoprotein complexes at Edelta , and the mechanisms by which assembled nucleoprotein complexes modulate regional chromatin accessibility and VDJ recombination, will be important issues to address in future studies.


Footnotes

Address correspondence to Dr. Michael S. Krangel, Department of Immunology, PO Box 3010, Duke University Medical Center, Durham, NC 27710. Dr. Lauzurica's present address is Seccion de Inmunologia, Hospital de la Princesa, 28006 Madrid, Spain.

Received for publication 3 December 1996.

   1 Abbreviations used in this paper: D, diversity; J, joining; V, variable.

We thank Cristina Hernandez-Munain for helpful comments on the manuscript, and Cheryl Bock and Wendy Callahan of the Duke University Comprehensive Cancer Center Transgenic Mouse Shared Resource for production of transgenic mice.

This work was supported by Public Health Service grant GM41052. M.S. Krangel is the recipient of American Cancer Society Faculty Research Award FRA-414. J.L. Roberts was supported in part by Public Health Service training grant CA09058.


References

1. Alt, F.W., T.K. Blackwell, and G.D. Yancopoulos. 1987. Development of the primary antibody repertoire. Science (Wash. DC). 238: 1079-1087 [Medline]. [Abstract/Free Full Text]
2. Alt, F.W., E.M. Oltz, F. Young, J. Gorman, G. Taccioli, and J. Chen. 1992. VDJ recombination. Immunol. Today. 13: 306-314 [Medline]. [Medline]
3. Schatz, D.G., M.A. Oettinger, and M.S. Schlissel. 1992. V(D)J recombination: molecular biology and regulation. Annu. Rev. Immunol. 10: 359-383 [Medline]. [Medline]
4. Lewis, S.M.. 1994. The mechanism of V(D)J joining: lessons from molecular, immunological and comparative analyses. Adv. Immunol. 56: 27-150 [Medline]. [Medline]
5. Sleckman, B.P., J.R. Gorman, and F.W. Alt. 1996. Accessibility control of antigen receptor variable region gene assembly: role of cis-acting elements. Annu. Rev. Immunol. 14: 459-481 [Medline]. [Medline]
6. Fowlkes, B.J., and D.M. Pardoll. 1989. Molecular and cellular events of T cell development. Adv. Immunol. 44: 207-264 [Medline]. [Medline]
7. Staudt, L.M., and M.J. Lenardo. 1991. Immunoglobulin gene transcription. Annu. Rev. Immunol. 9: 373-398 [Medline]. [Medline]
8. Leiden, J.M.. 1993. Transcriptional regulation of T cell receptor genes. Annu. Rev. Immunol. 11: 539-570 [Medline]. [Medline]
9. Ferrier, P., B. Krippl, T.K. Blackwell, A.J.W. Furley, H. Suh, A. Winoto, W.D. Cook, L. Hood, F. Costantini, and F.W. Alt. 1990. Separate elements control DJ and VDJ rearrangement in a transgenic recombination substrate. EMBO (Eur. Mol. Biol. Organ.) J. 9: 117-125 [Medline]. [Medline]
10. Lauster, R., C.-A. Reynaud, I.-L. Martensson, A. Peter, D. Bucchini, J. Jami, and J.-C. Weill. 1993. Promoter, enhancer and silencer elements regulate rearrangement of an immunoglobulin transgene. EMBO (Eur. Mol. Biol. Organ.) J. 12: 4615-4623 [Medline]. [Medline]
11. Kallenbach, S., C. Babinet, S. Pournin, P. Cavelier, M. Goodhardt, and F. Rougeon. 1993. The intronic immunoglobulin kappa  gene enhancer acts independently on rearrangement and on transcription. Eur. J. Immunol. 23: 1917-1921 [Medline]. [Medline]
12. Capone, M., F. Watrin, C. Fernex, B. Horvat, B. Krippl, L. Wu, R. Scollay, and P. Ferrier. 1993. TCRbeta and TCRalpha gene enhancers confer tissue- and stage-specificity on V(D)J recombination events. EMBO (Eur. Mol. Biol. Organ.) J. 12: 4335-4346 [Medline]. [Medline]
13. Lauzurica, P., and M.S. Krangel. 1994. Enhancer-dependent and -independent steps in the rearrangement of a human T cell receptor delta  transgene. J. Exp. Med. 179: 43-55 [Medline]. [Abstract/Free Full Text]
14. Lauzurica, P., and M.S. Krangel. 1994. Temporal and lineage-specific control of T cell receptor alpha /delta gene rearrangement by T cell receptor alpha  and delta  enhancers. J. Exp. Med. 179: 1913-1921 [Medline]. [Abstract/Free Full Text]
15. Okada, A., M. Mendelsohn, and F. Alt. 1994. Differential activation of transcription versus recombination of transgenic T cell receptor beta  variable region gene segments in B and T lineage cells. J. Exp. Med. 180: 261-272 [Medline]. [Abstract/Free Full Text]
16. Fernex, C., M. Capone, and P. Ferrier. 1995. The V(D)J recombinational and transcriptional activities of the immunoglobulin heavy-chain intronic enhancer can be mediated through distinct protein-binding sites in a transgenic substrate. Mol. Cell. Biol. 15: 3217-3226 [Medline]. [Abstract]
17. Chen, J., F. Young, A. Bottaro, V. Stewart, R.K. Smith, and F.W. Alt. 1993. Mutations of the intronic IgH enhancer and its flanking sequences differentially affect accessibility of the JH locus. EMBO (Eur. Mol. Biol. Organ.) J. 12: 4635-4645 [Medline]. [Medline]
18. Takeda, S., Y.-R. Zou, H. Bluethmann, D. Kitamura, U. Muller, and K. Rajewsky. 1993. Deletion of the immunoglobulin kappa chain intron enhancer abolishes kappa chain gene rearrangement in cis but not lambda chain gene rearrangement in trans. EMBO (Eur. Mol. Biol. Organ.) J. 12: 2329-2336 [Medline]. [Medline]
19. Serwe, M., and F. Sablitzky. 1993. V(D)J recombination in B cells is impaired but not blocked by targeted deletion of the immunoglobulin heavy chain intron enhancer. EMBO (Eur. Mol. Biol. Organ.) J. 12: 2321-2327 [Medline]. [Medline]
20. Gorman, J.R., N. van der Stoep, R. Monroe, M. Cogne, L. Davidson, and F.W. Alt. 1996. The Igkappa 3' enhancer influences the ration of Igkappa versus Iglambda B lymphocytes. Immunity. 5: 241-252 [Medline]. [Medline]
21. Xu, Y., L. Davidson, F.W. Alt, and D. Baltimore. 1996. Deletion of the Igkappa light chain intronic enhancer/matrix attachment region impairs but does not abolish Vkappa Jkappa rearrangement. Immunity. 4: 377-385 [Medline]. [Medline]
22. Bories, J.-C., J. Demengeot, L. Davidson, and F.W. Alt. 1996. Gene-targeted deletion and replacement of the T-cell receptor beta -chain enhancer: the role of enhancer elements in controlling V(D)J recombination accessibility. Proc. Natl. Acad. Sci. USA. 93: 7871-7876 [Medline]. [Abstract/Free Full Text]
23. Bouvier, G., F. Watrin, M. Naspetti, C. Verthuy, P. Naquet, and P. Ferrier. 1996. Deletion of the mouse T-cell receptor beta  gene enhancer blocks alpha beta T-cell development. Proc. Natl. Acad. Sci. USA. 93: 7877-7881 [Medline]. [Abstract/Free Full Text]
24. Redondo, J.M., S. Hata, C. Brocklehurst, and M.S. Krangel. 1990. A T cell specific transcriptional enhancer within the human T cell receptor delta  locus. Science (Wash. DC). 247: 1225-1229 [Medline]. [Abstract/Free Full Text]
25. Redondo, J.M., J.L. Pfohl, and M.S. Krangel. 1991. Identification of an essential site for transcriptional activation within the human T cell receptor delta  enhancer. Mol. Cell. Biol. 11: 5671-5680 [Medline]. [Abstract/Free Full Text]
26. Redondo, J.M., J.L. Pfohl, C. Hernandez-Munain, S. Wang, N.A. Speck, and M.S. Krangel. 1992. Indistinguishable nuclear factor binding to functional core sites of the T-cell receptor delta  and murine leukemia virus enhancers. Mol. Cell. Biol. 12: 4817-4823 [Medline]. [Abstract/Free Full Text]
27. Hernandez-Munain, C., and M.S. Krangel. 1994. Regulation of the T-cell receptor delta  enhancer by functional cooperation between c-Myb and core-binding factors. Mol. Cell. Biol. 14: 473-483 . [Abstract/Free Full Text]
28. Hernandez-Munain, C., and M.S. Krangel. 1995. c-Myb and core-binding factor (CBF/PEBP2) display functional synergy but bind independently to adjacent sites in the TCR delta  enhancer. Mol. Cell. Biol. 15: 3090-3099 . [Abstract]
29. Wang, S., Q. Wang, B.E. Crute, I.N. Melnikova, S.R. Keller, and N.A. Speck. 1993. Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor. Mol. Cell. Biol. 13: 3324-3339 [Medline]. [Abstract/Free Full Text]
30. Ogawa, E., M. Maruyama, H. Kagoshima, I. Inuzuka, J. Lu, M. Satake, K. Shigesada, and Y. Ito. 1993. PEBP2/PEA2 represents a new family of transcription factor homologous to the products of the Drosophila runt and the human AML1. Proc. Natl. Acad. Sci. USA. 90: 6859-6863 [Medline]. [Abstract/Free Full Text]
31. Ogawa, E., M. Inuzuka, M. Maruyama, M. Satake, M. Naito-Fujimoto, Y. Ito, and K. Shigesada. 1993. Molecular cloning and characterization of PEBP2beta , the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2alpha . Virol. 194: 314-331 [Medline].
32. Shen-Ong, G.L.C.. 1990. The myb oncogene. Biochim. Biophys. Acta. 1032: 39-52 . [Medline]
33. Prosser, H.M., D. Wotton, A. Gegonne, J. Ghysdael, S. Wang, N.A. Speck, and M.J. Owen. 1992. A phorbol ester response element within the human T-cell receptor beta -chain enhancer. Proc. Natl. Acad. Sci. USA. 89: 9934-9938 [Medline]. [Abstract/Free Full Text]
34. Hsiang, Y.H., D. Spencer, S. Wang, N.A. Speck, and D.H. Raulet. 1993. The role of viral enhancer "core" motif-related sequences in regulating T cell receptor-gamma and -delta gene expression. J. Immunol. 150: 3905-3916 [Medline]. [Abstract]
35. Wotton, D., J. Ghysdael, S. Wang, N.A. Speck, and M.J. Owen. 1994. Cooperative binding of Ets-1 and core binding factor to DNA. Mol. Cell. Biol. 14: 840-850 [Medline]. [Abstract/Free Full Text]
36. Giese, K., C. Kingsley, J.R. Kirshner, and R. Grosschedl. 1995. Assembly and function of a TCRalpha enhancer complex is dependent on LEF-1-induced DNA bending and mutliple protein-protein interactions. Genes Dev. 9: 995-1008 [Medline]. [Abstract/Free Full Text]
37. Okuda, T., J. van Deursen, S.W. Hiebert, G. Grosveld, and J.R. Downing. 1996. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell. 84: 321-330 [Medline]. [Medline]
38. Ho, S.N., H.D. Hunt, R.M. Horton, J.K. Pullen, and L.R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene (Amst.). 77: 51-59 [Medline]. [Medline]
39. Hernandez-Munain, C., P. Lauzurica, and M.S. Krangel. 1996. Regulation of T cell receptor delta  gene rearrangement by c-Myb. J. Exp. Med. 183: 289-293 . [Abstract/Free Full Text]
40. Joulin, V., D. Bories, J.-F. Eleouet, M.-C. Labasteie, S. Chretien, M.-G. Mattei, and P.H. Romeo. 1991. A T-cell specific TCR delta  DNA binding protein is a member of the human GATA family. EMBO (Eur. Mol. Biol. Organ.) J. 10: 1809-1816 [Medline]. [Medline]
41. Marine, J., and A. Winoto. 1991. The human enhancerbinding protein Gata3 binds to several T-cell receptor regulatory elements. Proc. Natl. Acad. Sci. USA. 88: 7284-7288 [Medline]. [Abstract/Free Full Text]
42. Kamachi, Y., E. Ogawa, M. Asano, S. Ishida, Y. Murakami, M. Satake, Y. Ito, and K. Shigesada. 1990. Purification of a mouse nuclear factor that binds to both the A and B cores of the polyomavirus enhancer. J. Virol. 64: 4808-4819 [Medline]. [Abstract/Free Full Text]
43. Wang, S., and N.A. Speck. 1992. Purification of core-binding factor, a protein that binds the conserved core site in murine leukemia virus enhancers. Mol. Cell. Biol. 12: 89-102 [Medline]. [Abstract/Free Full Text]
44. Suzow, J., and A.D. Friedman. 1993. The murine myeloperoxidase promoter contains several functional elements, one of which binds a cell type-restricted transcription factor, myeloid nuclear factor 1 (MyNF1). Mol. Cell. Biol. 13: 2141-2151 [Medline]. [Abstract/Free Full Text]
45. Nuchprayoon, I., S. Meyers, L.M. Scott, J. Suzow, S. Hiebert, and A.D. Friedman. 1994. PEBP2/CBF, the murine homolog of the human myeloid AML1 and PEBP2beta /CBFbeta proto-oncoproteins, regulates the murine myeloperoxidase and neutrophil elastase genes in immature myeloid cells. Mol. Cell. Biol. 14: 5558-5568 [Medline]. [Abstract/Free Full Text]
46. Zhang, D.-E., K.-I. Fujioka, C.J. Hetherington, L.H. Shapiro, H.-M. Chen, A.T. Look, and G.T. Tenen. 1994. Identification of a region which directs the monocytic activity of the colony-stimulating factor 1 (macrophage colony-stimulating factor) receptor promoter and binds PEBP2/CBF (AML1). Mol. Cell. Biol. 14: 8085-8095 [Medline]. [Abstract/Free Full Text]
47. Cameron, S., D.S. Taylor, E.C. TePas, N.A. Speck, and B. Mathey-Prevot. 1994. Identification of a critical regulatory site in the human interleukin-3 promoter by in vivo footprinting. Blood. 83: 2851-2859 [Medline]. [Abstract/Free Full Text]
48. Takahashi, A., M. Satake, Y. Yamaguchi-Iwai, S.-C. Bae, J. Lu, M. Maruyama, Y.W. Zhang, H. Oka, N. Arai, K. Aria, et al . 1995. Positive and negative regulation of granulocytemacrophage colony-stimulating factor promoter activity by AML1-related transcription factor, PEBP2. Blood. 86: 607-616 [Medline]. [Abstract/Free Full Text]
49. Bae, S.C., Y. Yamaguchi-Iwai, E. Ogawa, M. Maruyama, M. Inuzuka, H. Kagoshima, K. Shigesada, M. Satake, and Y. Ito. 1993. Isolation of PEBP2alpha B cDNA representing the mouse homolog of human acute myeloid leukemia gene, AML1. Oncogene. 8: 809-814 [Medline]. [Medline]
50. Levanon, D., V. Negreanu, Y. Bernstein, I. Bar-Am, L. Avivi, and Y. Groner. 1994. AML1, AML2, and AML3, the human members of the runt domain gene family: cDNA structure, expression, and chromosomal localization. Genomics. 23: 425-432 [Medline]. [Medline]
51. Bae, S.-C., E. Takahashi, Y.W. Zhang, E. Ogawa, K. Shigesada, Y. Namba, M. Satake, and Y. Ito. 1995. Cloning, mapping and expression of PEBP2alpha C, a third gene encoding the mammalian Runt domain. Gene (Amst.). 159: 245-248 [Medline]. [Medline]
52. Wijmenga, C., N.A. Speck, N.C. Dracopoli, M.H. Hofker, P. Liu, and F.S. Collins. 1995. Identification of a new murine runt domain-containing gene, Cbfa3, and localization of the human homolog, CBFA3, to chromosome 1p35-pter. Genomics. 26: 611-614 [Medline]. [Medline]
53. Bae, S.-C., E. Ogawa, M. Maruyama, H. Oka, M. Satake, K. Shigesada, N.A. Jenkins, D.J. Gilbert, N.G. Copeland, and Y. Ito. 1994. PEBP2 B/mouse AML1 consist of multiple isoforms that possess differential transactivation potentials. Mol. Cell. Biol. 14: 3242-3252 [Medline]. [Abstract/Free Full Text]
54. Chien, Y.-H., M. Iwashima, D.A. Wettstein, K.B. Kaplan, J.F. Elliot, W. Born, and M.M. Davis. 1987. T-cell receptor delta  gene rearrangements in early thymocytes. Nature (Lond.). 330: 722-727 [Medline]. [Medline]
55. Wilson, A., W. Held, and H.R. MacDonald. 1994. Two waves of recombinase gene expression in developing thymocytes. J. Exp. Med. 179: 1355-1360 [Medline]. [Abstract/Free Full Text]
56. Satake, M., S. Nomura, Y. Yamaguchi-Iwai, Y. Takahama, Y. Hashimoto, M. Niki, Y. Kitamura, and Y. Ito. 1995. Expression of the runt domain-encoding PEBP2alpha genes in T cells during thymic development. Mol. Cell. Biol. 15: 1662-1670 [Medline]. [Abstract]
57. Forrester, W.C., C. van Genderen, T. Jenuwein, and R. Grosschedl. 1994. Dependence of enhancer-mediated transcription of the immunoglobulin µ gene on nuclear matrix attachment regions. Science (Wash. DC). 265: 1221-1225 [Medline]. [Abstract/Free Full Text]
58. Aronow, B.J., R.N. Silbiger, M.R. Dusing, J.L. Stock, K.L. Yager, S.S. Potter, J.J. Hutton, and D.A. Wiginton. 1992. Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate positionindependent transgene expression. Mol. Cell. Biol. 12: 4170-4185 [Medline]. [Abstract/Free Full Text]
59. Aronow, B.J., C.A. Ebert, M.T. Valerius, S.S. Potter, D.A. Wiginton, D.P. Witte, and J.J. Hutton. 1995. Dissecting a locus control region: facilitation of enhancer function by extended enhancer-flanking sequences. Mol. Cell. Biol. 15: 1123-1135 [Medline]. [Abstract]

Copyright © 1997 by The Rockefeller University Press.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 184K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lauzurica, P.
Right arrow Articles by Roberts, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lauzurica, P.
Right arrow Articles by Roberts, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS