|
||
Gene
Rearrangement by CBF/PEBP2
By
From the Department of Immunology, Duke University Medical Center, Durham, North Carolina 27710
We have analyzed transgenic mice carrying versions of a human T cell receptor (TCR)-
gene
minilocus to study the developmental control of VDJ (variable/diversity/joining) recombination. Previous data indicated that a 1.4-kb DNA fragment carrying the TCR-
enhancer (E
)
efficiently activates minilocus VDJ recombination in vivo. We tested whether the transcription
factor CBF/PEBP2 plays an important role in the ability of E
to activate VDJ recombination by analyzing VDJ recombination in mice carrying a minilocus in which the
E3 element of E
includes a mutated CBF/PEBP2 binding site. The enhancer-dependent VD to J step of minilocus rearrangement was dramatically inhibited in three of four transgenic lines, arguing that the
binding of CBF/PEBP2 plays a role in modulating local accessibility to the VDJ recombinase in
vivo. Because mutation of the
E3 binding site for the transcription factor c-Myb had previously established a similar role for c-Myb, and because a 60-bp fragment of E
carrying
E3 and
E4 binding sites for CBF/PEBP2, c-Myb, and GATA-3 displays significant enhancer activity
in transient transfection experiments, we tested whether this fragment of E
is sufficient to activate VDJ recombination in vivo. This fragment failed to efficiently activate the enhancerdependent VD to J step of minilocus rearrangement in all three transgenic lines examined, indicating that the binding of CBF/PEBP2 and c-Myb to their cognate sites within E
, although
necessary, is not sufficient for the activation of VDJ recombination by E
. These results imply
that CBF/PEBP2 and c-Myb collaborate with additional factors that bind elsewhere within E
to modulate local accessibility to the VDJ recombinase in vivo.
The process of VDJ recombination assembles variable
(V)1, diversity (D), and joining ( J) gene segments at
TCR and Ig loci during lymphocyte development, generating the diverse antigen receptor repertoires that characterize mature T and B lymphocytes (1). VDJ recombination is under stringent developmental control, as it is
activated at individual antigen receptor loci with unique cell lineage-specific and developmental stage-specific properties. Thus, fully rearranged TCR genes are only generated in developing T lymphocytes, and fully rearranged Ig
genes are only generated in developing B lymphocytes.
Further, TCR- The expression of fully rearranged TCR and Ig genes is
controlled by a promoter flanking the V gene segment, and
one or more transcriptional enhancers located adjacent to
the C gene segment (7, 8). Recent studies have indicated
that these cis-acting elements are also required for the developmental activation of VDJ recombination at individual
antigen receptor loci. This has been accomplished by eliminating, mutating, or substituting enhancer or promoter elements within chromosomally integrated VDJ recombination substrates in transgenic mice (9), as well as by eliminating enhancer elements from endogenous antigen receptor
loci by homologous recombination (17). These studies
show that the efficiency of VDJ recombination is dramatically inhibited in the absence of a functional enhancer, and
that the developmental activation of VDJ recombination
can be modified by substitution of one enhancer for another.
We have previously studied the developmental control of
VDJ recombination in transgenic mice carrying a human
TCR- The developmental properties of E E The present study was initiated to determine whether
CBF/PEBP2 plays an important role in the developmental
activation of TCR genes in vivo, by specifically testing its
role in the activation of VDJ recombination by E Production of Transgenic Mice.
The CBF/PEBP2 binding site
mutation was generated by PCR using as a template the 1.4-kb
wild-type E
, -
, and -
rearrangement occurs earlier
during thymocyte development than TCR-
rearrangement (6), and IgH rearrangement occurs earlier in B cell
development than Ig
and
rearrangement (1). Because all
of these loci are thought to share both recombination signal
sequences and the known components of the recombinase
machinery, it is generally believed that these factors cannot
account for locus-specific regulation of VDJ recombination.
Rather, it is thought that locus-specific regulation is accomplished by modulating the accessibility of chromosomal
recombination substrates to the recombinase (1).
gene minilocus (13, 14). Efficient VDJ recombination
of this minilocus requires the presence of E
within the J
3-C
intron. Interestingly, the first step of minilocus rearrangement, V to D, occurs even in the absence of E
, whereas
the second step of minilocus rearrangement, VD to J, is E
dependent (13). Thus, a functional enhancer is critical for
establishing J segment accessibility to the VDJ recombinase
machinery. Furthermore, substitution of E
for E
within
the minilocus reveals that E
and E
regulate both the T cell
subset and developmental stage specificity of the VD to J
step of minilocus rearrangement in a manner that mimics
the developmental activation of V
D
J
and V
J
rearrangement, respectively, at the endogenous TCR-
/
locus (14).
These results lead to the conclusion that E
and E
are indeed responsible for the developmental regulation of VDJ
recombination at the endogenous TCR-
/
locus.
and E
presumably
result from the binding of specific trans-acting factors to
discrete sites within the enhancers. Therefore, to better understand the mechanism by which these enhancers control
VDJ recombination, we have begun to introduce mutations into previously defined cis-acting enhancer elements
within the context of the TCR-
gene minilocus, and to
measure the effects of these mutations on the process of VDJ
recombination in vivo.
was initially defined and functionally dissected in transient transfection and in vitro protein binding studies (24- 28). These experiments identified an essential element of
the enhancer,
E3, that contains adjacent binding sites for
the transcription factors CBF/PEBP2 (29) and c-Myb
(32). Intact binding sites for both CBF/PEBP2 (the "core"
site) (25) and c-Myb (27) are required for transcriptional
activation by E
. Because CBF/PEBP2 has been implicated
in TCR-
, -
, and -
enhancer activity as well (30, 33-
36), it appears to be a crucial and broadly important regulator of T cell development and T cell-specific gene expression. Mice carrying a homozygous mutation within the
gene encoding one particular CBF/PEBP2 isoform (
B)
display a very early defect in hematopoiesis and early embryonic lethality (37). Although these results clearly demonstrate an important role for CBF/PEBP2 in the development of early hematopoietic precursor cells, they do not
provide information regarding subsequent molecular events that might be regulated by CBF/PEBP2 within developing
thymocytes in vivo.
. We
found that disruption of the
E3 core site significantly impairs the ability of E
to activate VDJ recombination within
the TCR-
gene minilocus, suggesting that CBF/PEBP2 is
an important regulator of VDJ recombination in vivo.
Since previous data had indicated an important role for c-Myb
as well, we then asked whether a small fragment of E
carrying binding sites for these factors as well as GATA-3 was sufficient to activate VDJ recombination. We found that this
was not the case, arguing that additional cis-acting elements
of E
are also required to establish local accessibility to the
VDJ recombinase.
subcloned into the XbaI site of pBluescript KS+
(1.4E
BS). PCR overlap extension was performed as described (38)
using mutagenic oligonucleotides ACOREM (AGCAATGCATGACCTTTCCAACCG) and BCOREM (CGGTTGGAAAGGTCATGCATTGCT) along with EDRA (CTTTTAAAATTCTAGCAAGC) and the reverse primer as outside primers. The final
PCR product was digested with NsiI and BamHI to generate a
170-bp fragment of E
carrying the 3-bp change in
E3 that eliminates CBF/PEBP2 binding. The plasmid 1.4E
BS was also digested
with PfiMI and NsiI to obtain an adjacent 590-bp fragment of E
.
The two fragments were ligated together into PfiMI and BamHI
cut 1.4E
BS. The structure of the resulting plasmid was determined by restriction mapping and dideoxynucleotide sequence
analysis. The 1.4-kb E
mCore was excised from this plasmid with
XbaI and cloned into XbaI-digested, phosphatase-treated pBluescript carrying the previously described enhancerless minilocus (13).
E3,4 region was generated as follows. A 60-bp Nsi-AluI fragment of E
(
E3,4) had
been previously subcloned into PstI and EcoRV cut pBluescript KS+. The insert was excised from this plasmid by digestion with BamHI and HindIII and the ends were blunted by treatment with the Klenow fragment of Escherichia coli DNA polymerase I. This fragment was then ligated into Xba I-digested, blunted, and phosphatase-treated pBluescript carrying the enhancerless minilocus.
The structures of both minilocus constructs were confirmed by
dideoxynucleotide sequence analysis.
cDNA probe.
Hybridization signals were quantified relative to previously identified single copy integrants using a Betascope (Betagen, Waltham, MA).
Preparation and Analysis of Genomic DNA.
Genomic DNA preparation, PCR, gel electrophoresis, blotting onto nylon membranes
(Hybond-N; Amersham, Arlington Heights, IL or MAGNA nylon; Micron Separations Inc., Westboro, MA), and hybridization with 32P-labeled probes were performed as described previously
(13). The amount of DNA template used in PCR reactions (2-12
ng) was adjusted based on the results of amplification using C
primers to account for differences in transgene copy number and PCR efficiency between samples, so that all PCR signals were
maintained in the linear range. TCR-
minilocus PCR primers 1 (VD1), 2 (VD2), 3 (JD1), 4 (JD3), 5 (CDA), and 6 (CDB), as well
as the V
1, V
2, and C
fragments used as probes to develop
Southern blots of PCR products or genomic restriction digests,
were described previously (13). These primers and probes allow
detection of human TCR-
minilocus sequences, but do not allow detection of endogenous murine TCR-
locus sequences.
Quantification of PCR signals was accomplished using either a
Betascope or a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Gene Rearrangement In Vivo.
The previously studied
human TCR-
gene minilocus is a 22.5-kb construct containing germline V
1, V
2, D
3, J
1, J
3, and C
gene segments, along with a wild-type version of E
within the J
3C
intron (13) (Fig. 1 A). The V
1 and V
2 coding segments carry mutations to prevent a rearranged transgene from encoding a TCR protein that might interfere with normal murine T cell development. Thus, the minilocus serves as a phenotypically neutral in vivo reporter of VDJ recombination.
, E
mCore, and
E3,4 transgenes. (A) Schematic representations of the E
and E
mCore minilocus
recombination substrates includes coding exons (filled boxes) and protein
binding sites within E
(open boxes). The 3-bp substitution in the
E3 core
site is shown. (B) Schematic representation of the
E3,4 minilocus recombination substrate. (C) Primers used for analysis of minilocus rearrangement by PCR from genomic DNA (arrowheads). (D) Depiction of
PCR products generated from V
1 rearrangements using primers 1, 3, and 4. A similar set of PCR products are generated from V
2 rearrangements using primers 2, 3, and 4.
For this study, we initially constructed a new version of
the minilocus, referred to as E
mCore, that carries a three- basepair change in the
E3 core sequence within E
(Fig. 1 A). The identical mutation was previously shown to
eliminate CBF/PEBP2 binding to
E3 in vitro, and to
eliminate transcriptional activation by E
in transient transfection experiments (25). Three transgenic founders, designated U, Y, and Z, were initially obtained. Breeding experiments indicated that in each of founders U and Z, the
E
mCore minilocus was integrated at a single site in the
mouse genome, whereas in founder Y there were two independently segregating transgene integration sites. As a result, four different E
mCore transgenic lines (U, Z, Y1,
Y2) were established. As assessed by slot blot, the transgene
copy numbers were: U, 8 copies; Z, 3 copies; Y1, 1 copy;
and Y2, 2 copies. The single copy integrant in line Y1 was
truncated so as to delete ~4-5 kb at the 3
end of the
minilocus. This truncation leaves V
, D
, J
gene segments,
E
and the first C
exon intact, and as such, is not expected
to have a significant effect on minilocus VDJ recombination.
Analysis of wild-type and E
mCore minilocus VDJ recombination was performed by PCR from thymus genomic DNA templates, using specific V
1, V
2, J
1, and J
3 primers (primers 1, 2, 3 and 4; Fig. 1 C) as described previously (13). Previous studies have shown the wild-type
minilocus to rearrange stepwise, first V to D, and then VD
to J (13). Amplification with V
and J
1 primers yields 0.3kb fragments that represent complete VDJ rearrangements,
and in addition, 1.2-kb fragments that represent the VD rearrangement intermediates (Fig. 1 D). Amplification with
V
and J
3 primers yields 0.3-kb VDJ products only. PCR
reactions were also performed with a pair of C
primers
(primers 5 and 6; Fig. 1 C), to control for differences in
transgene copy number and PCR efficiency between samples; the amount of genomic DNA template used in PCR
reactions was typically adjusted to obtain similar C
amplification signals in each sample. PCR products were detected
and quantified by agarose gel electrophoresis followed by
blotting and hybridization with appropriate 32P-labeled
probes. In agreement with our previous studies (13), quantification of PCR signals revealed amplification to be linear over a broad range of template concentrations (Fig. 2).
line
A were amplified by PCR using
primers 1 and 3 or primers 5 and
6, and Southern blots were developed using radiolabeled V
1
and C
cDNA probes. The V
1D
3-J
1 (solid line) and C
(dotted
line) hybridization signals were
quantified using a PhosphorImager. The results are expressed
log hybridization signal in arbitrary units versus log DNA concentration
in µg/ml. The second most concentrated DNA sample in this experiment corresponds to the amount of DNA used for analysis of single copy
integrants in all subsequent experiments. Lower amounts of DNA were
used for multicopy integrants.
We analyzed the effect of the core site mutation on minilocus VDJ recombination by comparing VD and VDJ rearrangement levels in thymocytes from three previously characterized lines of mice carrying a minilocus with a wild-type
E
(A, B, C) (13) to thymocytes in the four lines of mice
carrying the E
mCore minilocus (Fig. 3, A and B). All E
lines of mice carry single copy integrations of the minilocus. Whereas the minilocus integrations in lines A and B
include all relevant gene segments, the integration in line C
is truncated at the 5
end and is missing the V
1 gene segment. Thus, lines A and B are informative for both V
1 and
V
2 rearrangement, whereas line C is informative for V
2
rearrangement only. As in previous studies, PCR analysis of
VDJ recombination in the E
lines revealed high levels of
0.3-kb VDJ rearrangement products in each case (Fig. 3, A
and B). Levels of 1.2-kb VD rearrangement products were
lower and more variable (Fig. 3 A). Thus, as observed previously (13), the enhancer-dependent VD to J step of transgene rearrangement occurs efficiently in each of the E
lines.
and E
mCore minilocus rearrangement. (A) Genomic DNA from
thymi of wild-type E
mice from
lines A, B, and C, and from E
mCore mice from lines U, Y1, Z,
and Y2 were amplified by PCR
using primers 5 and 6 (top), primers
1 and 3 (middle) and primers 2 and
3 (bottom). Southern blots were developed using radiolabeled C
, V
1
or V
2 cDNA probes. The mice
analyzed were A-26 (3 wk old), B-29 (2 wk old), C-306 (6 wk
old), U-19 (5 wk old), Y1-83 (2 wk old), Z-92 (3 wk old), and Y287 (2 wk old). (B) Genomic DNA
from the thymi of mice from lines A, U, Z, and Y2 were amplified by PCR using primers 5 and 6 (top), primers 1 and 4 (middle) and primers 2 and 4 (bottom). The mice analyzed were A-866, U-339, Z-419 and Y2-280 (all 4 wk old).
Analysis of VDJ recombination in the four E
mCore
lines revealed quite different results. In three of the lines
(U, Y1, and Z), 0.3-kb products representing VDJ rearrangement were barely detectable, even though 1.2-kb VD
rearrangement products were readily apparent (Fig 3, A
and B). In the fourth line (Y2), VD and VDJ rearrangement products were both detected at levels that were comparable to their representation in E
lines. The analysis of a
second animal in each line (data not shown) yielded quite
similar results, arguing that these VDJ recombination phenotypes are stable and reproducible characteristics of the individual transgenic lines. Because PCR amplifications with
the C
primer pair and with the V
1-J
1 primer pair were
shown to be linear over several orders of magnitude (Fig. 2)
we were justified in quantifying the level of VDJ recombination in the different lines by normalizing the V
1-J
1 PCR signal to the C
PCR signal in each line. The levels of VDJ recombination in lines U, Y1 and Z, each calculated as the mean of three independent determinations, were
found to be 0.8, 1.3, and 0.3%, respectively, of the level in
E
line A, and 3.1, 4.9, and 1.2%, respectively, of the level
in E
line B (Table 1). Similar quantification revealed VDJ
recombination in line Y2 to be 41.7% of the level in line
A, and 159.8% of the level in line B (Table 1).
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The conclusions drawn from PCR analysis were confirmed through analysis of V
1-D
3 and V
1-D
3-J
1 rearrangements by genomic Southern blot (Fig. 4). E
line A
thymocytes displayed nearly undetectable germline V
1 (1.0 kb), moderate V
1-D
3 rearrangement (0.9 kb), and substantial V
1-D
3-J
1 rearrangement (1.7 kb). In accord with
the PCR data, V
1-D
3-J
1 rearrangement was not detected in lines U and Z, even though transgene copy was
higher in these lines than in E
line A. Importantly, V
1D
3 rearrangement was readily detected in both lines, and
accounted for almost all of the V
1 signal in line Z. Although the reduced sensitivity of genomic Southern blot analysis as compared to PCR analysis does not allow an independent evaluation of the extent to which VDJ recombination is reduced in lines U and Z, the readily detectable
V
1-D
3 rearrangement demonstrates that the ratio of VD
to VDJ rearrangement has been dramatically perturbed in
these lines. As these results argue that the VD to J step of
transgene rearrangement has been specifically inhibited, they
provide strong support for the PCR data. Also in accord
with the PCR data, V
1-D
3 and V
1-D
3-J
1 rearrangements were both detected in line Y2. Thus, on the basis of
both PCR and genomic Southern blot analyses, we conclude that the enhancer-dependent step of minilocus rearrangement is dramatically and preferentially impaired in
three of the four E
mCore transgenic lines, but occurs
quite normally in the fourth line.
,
E3,4, and E
mCore minilocus rearrangement analyzed
by genomic Southern blot. A Southern blot carrying PstI plus EcoRI digested tail (germline control) and thymus DNA samples from E
line A,
E3,4 lines JA and JG, and E
mCore lines U, Z, and Y2 was developed
with a radiolabeled 1.0 kb V
1 genomic PstI fragment as a probe. The
mice analyzed were A-866, JA-81, JG-42, U-339, Z-352, and Y2-280
(all 4 wk old).
These results are reminiscent of our previous work analyzing VDJ recombination within a TCR-
minilocus lacking E
(13) or containing a disrupted binding site for c-Myb
(39). In four of five transgenic lines carrying the minilocus
construct lacking E
, and in three of four transgenic lines
carrying the minilocus construct with a disrupted binding
site for c-Myb, inhibition of the VD to J rearrangement
step was almost complete. However, in each case one of
the transgenic lines displayed higher levels of VD to J rearrangement. Such heterogeneity in TCR-
minilocus transgenic lines in which E
has been eliminated or inactivated probably reflects the distinct properties of the different
transgene integration sites. We propose that in E
, E
mMyb, and E
mCore lines in which the VD to J step still occurs, the minilocus has integrated adjacent to active regulatory elements that partially or completely supplant the need
for E
. Heterogeneity of this magnitude has not been observed in transgenic lines carrying an intact enhancer, as
VD to J rearrangement is efficient in three of three E
lines (Fig. 3) and four of four E
lines (14). On the basis of the
phenotype displayed by the majority of E
mCore transgenic lines, we conclude that elimination of a functional
CBF/PEBP2 binding site within E
has a dramatic effect
on the ability of E
to provide the regional accessibility to
the VDJ recombinase that is required for efficient VDJ recombination in vivo.
Gene Rearrangement In
Vivo.
Previous in vitro binding and transient transfection
studies identified a functionally important binding site for
c-Myb that is within the
E3 element and adjacent to the
CBF/PEBP2 binding site (27), as well as two functionally
important binding sites for GATA-3 within the adjacent
E4 element (40, 41). A 60-bp
E3,4 fragment of E
containing only these binding sites displays 20-50% of the activity of the intact 1.4-kb E
in transient transfection experiments (25). Since CBF/PEBP2 (this study) and c-Myb (39)
were implicated as important regulators of VDJ recombination in vivo, we asked whether the combination of CBF/
PEBP2, c-Myb and GATA-3 binding sites within
E3 and
E4 was sufficient to activate this process.
Therefore, the 60-bp
E3,4 fragment of E
was introduced into the TCR-
gene minilocus in place of E
(Fig.
1 B). Three transgenic founders were obtained and were
used to generate independent lines of transgenic mice designated JA, JE, and JG. Slot blot analysis indicated transgene copy numbers of 2, 1, and 24 for JA, JE, and JG, respectively. As in E
line C, the single copy
E3,4 line JE is
truncated such that it lacks V
1 but retains V
2. Hence, this
line is informative for V
2 rearrangement only.
Analysis of wild-type E
and
E3,4 minilocus VDJ recombination was performed by PCR as described above.
All three
E3,4 lines revealed dramatically reduced levels of
VDJ rearrangement as compared to E
lines A, B, and C
(Fig. 5, A and B). In lines JA and JE, VDJ rearrangement
was essentially undetectable, whereas in line JG, VDJ rearrangement was detectable at reduced levels. Nevertheless,
VD rearrangement signals were readily detected by PCR in
all three lines, and were detected at particularly high levels
in line JA. Quantification of V
1-J
1 and C
PCR signals
indicated that VDJ rearrangement in lines JA and JG were
reduced to 1.4 and 4.7%, respectively, of the level in E
line A, and to 5.2 and 17.9%, respectively, of the level in E
line B (Table 1). Analysis of V
1-D
3 and V
1-D
3-J
1 rearrangements by genomic Southern blot confirmed that essentially all copies of V
1 were rearranged to D
3 in line
JA, but that rearrangement was blocked at this stage (Fig. 4).
Although the low level of VDJ rearrangement detected in
line JG could not be confirmed due to both the limited
sensitivity of detection and the presence of comigrating
germline fragments in the tail DNA control, the results for
JG did suggest that PCR may have underestimated the
level of V
1-D
3 rearrangement in this line. Also of note is
the significant reduction in transgene copy number in thymus relative to tail in this line (Fig. 4 and data not shown).
This most likely results from the rearrangement of V
1 in
one copy of the tandemly arrayed transgene to D
3 in another copy, with deletion of intervening copies. In summary, on the basis of the dramatic inhibition of VD to J recombination detected in both PCR and genomic Southern
blot analyses, we conclude that the combination of CBF/
PEBP2, Myb, and GATA-3 binding sites contained within
E3 and
E4 is not by itself capable of promoting the accessible chromatin configuration required for efficient minilocus VDJ recombination.
and
E3,4
minilocus rearrangement. Genomic DNA from
thymi of wild-type E
mice from lines A, B, and
C, and from
E3,4 mice from lines JA, JE, and
JG were amplified by PCR using primers 5 and 6 (top), primers 1 and 3 (middle) and primers 2 and 3 (bottom). Southern blots were developed using radiolabeled C
, V
1, or V
2 cDNA probes. The mice analyzed were A-765 (4 wk old), B-31 (8 wk old), C-114 (4 wk old), JA-81 (4 wk old), JE101 (4 wk old), and JG-42 (4 wk old). (B) Genomic DNA from the thymi of mice from lines
A, JA, JE, and JG were amplified by PCR using
primers 5 and 6 (top), primers 1 and 4 (middle) and
primers 2 and 4 (bottom). The mice analyzed were
A-866, JA-81, JE-101, and JG-42 (all 4 wk old).
We previously documented enhancer-dependent VDJ recombination within a human TCR-
gene minilocus construct in transgenic mice (13, 14), and have now begun to
address the mechanisms by which E
exerts its effects on
VDJ recombination in this system. The data presented here
indicates that a mutation that destroys the binding site for
the transcription factor CBF/PEBP2 within the
E3 element of E
seriously compromises the ability of E
to activate the VD to J step of minilocus rearrangement. Hence,
by binding to E
, this or a very closely related factor plays a
crucial role in the developmental activation of minilocus
rearrangement in vivo. We interpret the pattern of transgene rearrangement in the presence or absence of a functional E
to indicate that a functional E
is required to
promote the accessibility of J
gene segments to the VDJ
recombinase within the transgenic minilocus. Although not
directly proven, we infer that a functional E
is also required to promote J
gene segment accessibility, and hence
VDJ recombination, within the endogenous TCR-
locus.
Our data therefore suggest strongly that CBF/PEBP2 family transcription factors are likely to be important regulators
of TCR-
gene rearrangement at the endogenous TCR-
locus in vivo. Nevertheless, formal proof for this notion
would require elimination of the E
CBF/PEBP2 binding
site from the endogenous locus by homologous recombination.
CBF/PEBP2 was initially identified by virtue of its ability to bind to and activate transcription from polyoma virus
enhancer and the long terminal repeats of murine T lymphotropic retroviruses (42, 43). Functional CBF/PEBP2
binding sites have been identified in the regulatory elements
of several cellular genes expressed in either the T lymphoid
or myeloid cell lineages (44), including the enhancers of
all four TCR genes (30, 33). CBF/PEBP2 is actually a
complex family of transcription factors, each of which is
composed of a DNA-binding
subunit and an associated
subunit (29). Three distinct genes (
A,
B, and
C) encode related
subunits (30, 49), a separate gene encodes
a shared
subunit (29, 31), and additional complexity is introduced by production of multiple
and
isoforms from
the individual genes (29, 53). Thus, any one of a number of CBF/PEBP2 species might be the crucial regulator
of TCR-
gene rearrangement in vivo. Although recent
analysis of CBF/PEBP2
B null mice emphasizes a crucial role for this particular factor in hematopoiesis, the early lethality and pleiotropic effects of this mutation preclude any
specific conclusions regarding a role in TCR-
gene rearrangement (37). A candidate regulator of TCR-
gene rearrangement would have to be expressed as early as the
CD4
CD8
stage of thymocyte development, since the
endogenous TCR-
locus (54, 55) and our transgenic
minilocus (14) are both activated during this stage. Notably,
CBF/PEBP2
A and
B are both expressed at highest levels
in the thymus and are both expressed in CD4
CD8
thymocytes (56). Thus, both of these factors have expression patterns that would be consistent with a role in the activation TCR-
gene rearrangement and expression in vivo.
Related studies using the transgenic minilocus approach
have also implicated the transcription factor c-Myb in the
activation of TCR-
gene rearrangement in vivo (39). Hence
CBF/PEBP2 and c-Myb appear to synergize to activate
TCR-
gene VDJ recombination in vivo, much as they were
found to synergistically activate TCR-
gene transcription
in transient transfection studies (27, 28). Nevertheless, our
results indicate that the combination of CBF/PEBP2, Myb,
and GATA-3 binding sites within
E3 and
E4 is not, by
itself, sufficient to promote the accessibility required for efficient activation of VDJ recombination within the TCR-
gene minilocus. This suggests that additional cis-acting elements contained within the 1.4-kb E
are crucial for this
process. Such elements may be contained within the 370-bp
fragment of E
found to contain maximal enhancer activity
in transient transfection experiments. Analyses of truncated
forms of the enhancer suggest
E2,
E5, and
E6 as candidate cis-acting elements of E
that might individually or in
combination increase the activity of the minimal enhancer by
two- to threefold (24, 25). Little is known about the identities of the factors that interact with these elements. Nevertheless, it may be misleading to identify candidate determinants
of E
recombinational enhancer activity in a chromosomally
integrated context in transgenic mice by extrapolating from
those required for transcriptional enhancer activity in transient transfection experiments. For example, nuclear matrix
attachment sites that flank Eµ are irrelevant for transcriptional activity as measured in transient transfection experiments or in chromosomally integrated substrates in stably
transfected cells, but are important for the induction of
transcriptional activity and general sensitivity to DNase I
digestion in a chromosomally integrated substrate in transgenic mice (57). Similarly sequences that flank the human adenosine deaminase gene enhancer are irrelevant for transcriptional activity in transient transfection experiments,
but are required for high level expression and the establishment of enhancer DNase I hypersensitivity in transgenic
mice (58, 59). It is therefore quite possible that cis-elements
contained within the 1.4-kb E
might not appear relevant
for gene expression on the basis of transient transfection experiments, but might be critical for E
induced accessibility
and VDJ recombination in transgenic mice. These additional cis-acting elements could be required for the stable
assembly of CBF/PEBP2, c-Myb, and GATA-3 onto their
E3 and
E4 binding sites in a chromatin context. Alternatively,
E3 and
E4 might by themselves be able to support
the assembly of a stable nucleoprotein complex, but additional cis-acting enhancer elements might contribute independently to accessibility and VDJ recombination. The hierarchy of assembly of nucleoprotein complexes at E
, and
the mechanisms by which assembled nucleoprotein complexes modulate regional chromatin accessibility and VDJ
recombination, will be important issues to address in future
studies.
Address correspondence to Dr. Michael S. Krangel, Department of Immunology, PO Box 3010, Duke University Medical Center, Durham, NC 27710. Dr. Lauzurica's present address is Seccion de Inmunologia, Hospital de la Princesa, 28006 Madrid, Spain.
Received for publication 3 December 1996.
1 Abbreviations used in this paper: D, diversity; J, joining; V, variable.We thank Cristina Hernandez-Munain for helpful comments on the manuscript, and Cheryl Bock and Wendy Callahan of the Duke University Comprehensive Cancer Center Transgenic Mouse Shared Resource for production of transgenic mice.
This work was supported by Public Health Service grant GM41052. M.S. Krangel is the recipient of American Cancer Society Faculty Research Award FRA-414. J.L. Roberts was supported in part by Public Health Service training grant CA09058.
| 1. |
Alt, F.W.,
T.K. Blackwell, and
G.D. Yancopoulos.
1987.
Development of the primary antibody repertoire.
Science
(Wash. DC).
238:
1079-1087
[Medline].
|
| 2. | Alt, F.W., E.M. Oltz, F. Young, J. Gorman, G. Taccioli, and J. Chen. 1992. VDJ recombination. Immunol. Today. 13: 306-314 [Medline]. [Medline] |
| 3. | Schatz, D.G., M.A. Oettinger, and M.S. Schlissel. 1992. V(D)J recombination: molecular biology and regulation. Annu. Rev. Immunol. 10: 359-383 [Medline]. [Medline] |
| 4. | Lewis, S.M.. 1994. The mechanism of V(D)J joining: lessons from molecular, immunological and comparative analyses. Adv. Immunol. 56: 27-150 [Medline]. [Medline] |
| 5. | Sleckman, B.P., J.R. Gorman, and F.W. Alt. 1996. Accessibility control of antigen receptor variable region gene assembly: role of cis-acting elements. Annu. Rev. Immunol. 14: 459-481 [Medline]. [Medline] |
| 6. | Fowlkes, B.J., and D.M. Pardoll. 1989. Molecular and cellular events of T cell development. Adv. Immunol. 44: 207-264 [Medline]. [Medline] |
| 7. | Staudt, L.M., and M.J. Lenardo. 1991. Immunoglobulin gene transcription. Annu. Rev. Immunol. 9: 373-398 [Medline]. [Medline] |
| 8. | Leiden, J.M.. 1993. Transcriptional regulation of T cell receptor genes. Annu. Rev. Immunol. 11: 539-570 [Medline]. [Medline] |
| 9. | Ferrier, P., B. Krippl, T.K. Blackwell, A.J.W. Furley, H. Suh, A. Winoto, W.D. Cook, L. Hood, F. Costantini, and F.W. Alt. 1990. Separate elements control DJ and VDJ rearrangement in a transgenic recombination substrate. EMBO (Eur. Mol. Biol. Organ.) J. 9: 117-125 [Medline]. [Medline] |
| 10. | Lauster, R., C.-A. Reynaud, I.-L. Martensson, A. Peter, D. Bucchini, J. Jami, and J.-C. Weill. 1993. Promoter, enhancer and silencer elements regulate rearrangement of an immunoglobulin transgene. EMBO (Eur. Mol. Biol. Organ.) J. 12: 4615-4623 [Medline]. [Medline] |
| 11. |
Kallenbach, S.,
C. Babinet,
S. Pournin,
P. Cavelier,
M. Goodhardt, and
F. Rougeon.
1993.
The intronic immunoglobulin gene enhancer acts independently on rearrangement and on transcription.
Eur. J. Immunol.
23:
1917-1921
[Medline].
[Medline] |
| 12. |
Capone, M.,
F. Watrin,
C. Fernex,
B. Horvat,
B. Krippl,
L. Wu,
R. Scollay, and
P. Ferrier.
1993.
TCR and TCR
gene enhancers confer tissue- and stage-specificity on V(D)J
recombination events.
EMBO (Eur. Mol. Biol. Organ.) J.
12:
4335-4346
[Medline].
[Medline] |
| 13. |
Lauzurica, P., and
M.S. Krangel.
1994.
Enhancer-dependent
and -independent steps in the rearrangement of a human T
cell receptor transgene.
J. Exp. Med.
179:
43-55
[Medline].
|
| 14. |
Lauzurica, P., and
M.S. Krangel.
1994.
Temporal and lineage-specific control of T cell receptor / gene rearrangement by T cell receptor and enhancers.
J. Exp. Med.
179:
1913-1921
[Medline].
|
| 15. |
Okada, A.,
M. Mendelsohn, and
F. Alt.
1994.
Differential activation of transcription versus recombination of transgenic T
cell receptor variable region gene segments in B and T lineage cells.
J. Exp. Med.
180:
261-272
[Medline].
|
| 16. | Fernex, C., M. Capone, and P. Ferrier. 1995. The V(D)J recombinational and transcriptional activities of the immunoglobulin heavy-chain intronic enhancer can be mediated through distinct protein-binding sites in a transgenic substrate. Mol. Cell. Biol. 15: 3217-3226 [Medline]. [Abstract] |
| 17. | Chen, J., F. Young, A. Bottaro, V. Stewart, R.K. Smith, and F.W. Alt. 1993. Mutations of the intronic IgH enhancer and its flanking sequences differentially affect accessibility of the JH locus. EMBO (Eur. Mol. Biol. Organ.) J. 12: 4635-4645 [Medline]. [Medline] |
| 18. | Takeda, S., Y.-R. Zou, H. Bluethmann, D. Kitamura, U. Muller, and K. Rajewsky. 1993. Deletion of the immunoglobulin kappa chain intron enhancer abolishes kappa chain gene rearrangement in cis but not lambda chain gene rearrangement in trans. EMBO (Eur. Mol. Biol. Organ.) J. 12: 2329-2336 [Medline]. [Medline] |
| 19. | Serwe, M., and F. Sablitzky. 1993. V(D)J recombination in B cells is impaired but not blocked by targeted deletion of the immunoglobulin heavy chain intron enhancer. EMBO (Eur. Mol. Biol. Organ.) J. 12: 2321-2327 [Medline]. [Medline] |
| 20. |
Gorman, J.R.,
N. van der Stoep,
R. Monroe,
M. Cogne,
L. Davidson, and
F.W. Alt.
1996.
The Ig 3 enhancer influences
the ration of Ig versus Ig B lymphocytes.
Immunity.
5:
241-252
[Medline].
[Medline] |
| 21. |
Xu, Y.,
L. Davidson,
F.W. Alt, and
D. Baltimore.
1996.
Deletion of the Ig light chain intronic enhancer/matrix attachment region impairs but does not abolish V J rearrangement.
Immunity.
4:
377-385
[Medline].
[Medline] |
| 22. |
Bories, J.-C.,
J. Demengeot,
L. Davidson, and
F.W. Alt.
1996.
Gene-targeted deletion and replacement of the T-cell
receptor -chain enhancer: the role of enhancer elements in
controlling V(D)J recombination accessibility.
Proc. Natl.
Acad. Sci. USA.
93:
7871-7876
[Medline].
|
| 23. |
Bouvier, G.,
F. Watrin,
M. Naspetti,
C. Verthuy,
P. Naquet, and
P. Ferrier.
1996.
Deletion of the mouse T-cell receptor gene enhancer blocks ![]() T-cell development.
Proc. Natl.
Acad. Sci. USA.
93:
7877-7881
[Medline].
|
| 24. |
Redondo, J.M.,
S. Hata,
C. Brocklehurst, and
M.S. Krangel.
1990.
A T cell specific transcriptional enhancer within the
human T cell receptor locus.
Science (Wash. DC).
247:
1225-1229
[Medline].
|
| 25. |
Redondo, J.M.,
J.L. Pfohl, and
M.S. Krangel.
1991.
Identification of an essential site for transcriptional activation within
the human T cell receptor enhancer.
Mol. Cell. Biol.
11:
5671-5680
[Medline].
|
| 26. |
Redondo, J.M.,
J.L. Pfohl,
C. Hernandez-Munain,
S. Wang,
N.A. Speck, and
M.S. Krangel.
1992.
Indistinguishable nuclear factor binding to functional core sites of the T-cell receptor and murine leukemia virus enhancers.
Mol. Cell.
Biol.
12:
4817-4823
[Medline].
|
| 27. |
Hernandez-Munain, C., and
M.S. Krangel.
1994.
Regulation
of the T-cell receptor enhancer by functional cooperation
between c-Myb and core-binding factors.
Mol. Cell. Biol.
14:
473-483
.
|
| 28. |
Hernandez-Munain, C., and
M.S. Krangel.
1995.
c-Myb and
core-binding factor (CBF/PEBP2) display functional synergy
but bind independently to adjacent sites in the TCR enhancer.
Mol. Cell. Biol.
15:
3090-3099
.
[Abstract] |
| 29. |
Wang, S.,
Q. Wang,
B.E. Crute,
I.N. Melnikova,
S.R. Keller, and
N.A. Speck.
1993.
Cloning and characterization
of subunits of the T-cell receptor and murine leukemia virus
enhancer core-binding factor.
Mol. Cell. Biol.
13:
3324-3339
[Medline].
|
| 30. |
Ogawa, E.,
M. Maruyama,
H. Kagoshima,
I. Inuzuka,
J. Lu,
M. Satake,
K. Shigesada, and
Y. Ito.
1993.
PEBP2/PEA2
represents a new family of transcription factor homologous to
the products of the Drosophila runt and the human AML1.
Proc. Natl. Acad. Sci. USA.
90:
6859-6863
[Medline].
|
| 31. |
Ogawa, E.,
M. Inuzuka,
M. Maruyama,
M. Satake,
M. Naito-Fujimoto,
Y. Ito, and
K. Shigesada.
1993.
Molecular
cloning and characterization of PEBP2 , the heterodimeric
partner of a novel Drosophila runt-related DNA binding protein PEBP2 .
Virol.
194:
314-331
[Medline].
|
| 32. | Shen-Ong, G.L.C.. 1990. The myb oncogene. Biochim. Biophys. Acta. 1032: 39-52 . [Medline] |
| 33. |
Prosser, H.M.,
D. Wotton,
A. Gegonne,
J. Ghysdael,
S. Wang,
N.A. Speck, and
M.J. Owen.
1992.
A phorbol ester
response element within the human T-cell receptor -chain
enhancer.
Proc. Natl. Acad. Sci. USA.
89:
9934-9938
[Medline].
|
| 34. |
Hsiang, Y.H.,
D. Spencer,
S. Wang,
N.A. Speck, and
D.H. Raulet.
1993.
The role of viral enhancer "core" motif-related
sequences in regulating T cell receptor- and - gene expression.
J. Immunol.
150:
3905-3916
[Medline].
[Abstract] |
| 35. |
Wotton, D.,
J. Ghysdael,
S. Wang,
N.A. Speck, and
M.J. Owen.
1994.
Cooperative binding of Ets-1 and core binding
factor to DNA.
Mol. Cell. Biol.
14:
840-850
[Medline].
|
| 36. |
Giese, K.,
C. Kingsley,
J.R. Kirshner, and
R. Grosschedl.
1995.
Assembly and function of a TCR enhancer complex
is dependent on LEF-1-induced DNA bending and mutliple
protein-protein interactions.
Genes Dev.
9:
995-1008
[Medline].
|
| 37. | Okuda, T., J. van Deursen, S.W. Hiebert, G. Grosveld, and J.R. Downing. 1996. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell. 84: 321-330 [Medline]. [Medline] |
| 38. | Ho, S.N., H.D. Hunt, R.M. Horton, J.K. Pullen, and L.R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene (Amst.). 77: 51-59 [Medline]. [Medline] |
| 39. |
Hernandez-Munain, C.,
P. Lauzurica, and
M.S. Krangel.
1996.
Regulation of T cell receptor gene rearrangement by
c-Myb.
J. Exp. Med.
183:
289-293
.
|
| 40. |
Joulin, V.,
D. Bories,
J.-F. Eleouet,
M.-C. Labasteie,
S. Chretien,
M.-G. Mattei, and
P.H. Romeo.
1991.
A T-cell
specific TCR DNA binding protein is a member of the human GATA family.
EMBO (Eur. Mol. Biol. Organ.) J.
10:
1809-1816
[Medline].
[Medline] |
| 41. |
Marine, J., and
A. Winoto.
1991.
The human enhancerbinding protein Gata3 binds to several T-cell receptor regulatory elements.
Proc. Natl. Acad. Sci. USA.
88:
7284-7288
[Medline].
|
| 42. |
Kamachi, Y.,
E. Ogawa,
M. Asano,
S. Ishida,
Y. Murakami,
M. Satake,
Y. Ito, and
K. Shigesada.
1990.
Purification of a
mouse nuclear factor that binds to both the A and B cores of
the polyomavirus enhancer.
J. Virol.
64:
4808-4819
[Medline].
|
| 43. |
Wang, S., and
N.A. Speck.
1992.
Purification of core-binding factor, a protein that binds the conserved core site in murine leukemia virus enhancers.
Mol. Cell. Biol.
12:
89-102
[Medline].
|
| 44. |
Suzow, J., and
A.D. Friedman.
1993.
The murine myeloperoxidase promoter contains several functional elements, one of
which binds a cell type-restricted transcription factor, myeloid nuclear factor 1 (MyNF1).
Mol. Cell. Biol.
13:
2141-2151
[Medline].
|
| 45. |
Nuchprayoon, I.,
S. Meyers,
L.M. Scott,
J. Suzow,
S. Hiebert, and
A.D. Friedman.
1994.
PEBP2/CBF, the murine
homolog of the human myeloid AML1 and PEBP2 /CBF
proto-oncoproteins, regulates the murine myeloperoxidase
and neutrophil elastase genes in immature myeloid cells.
Mol.
Cell. Biol.
14:
5558-5568
[Medline].
|
| 46. |
Zhang, D.-E.,
K.-I. Fujioka,
C.J. Hetherington,
L.H. Shapiro,
H.-M. Chen,
A.T. Look, and
G.T. Tenen.
1994.
Identification of a region which directs the monocytic activity of
the colony-stimulating factor 1 (macrophage colony-stimulating factor) receptor promoter and binds PEBP2/CBF
(AML1).
Mol. Cell. Biol.
14:
8085-8095
[Medline].
|
| 47. |
Cameron, S.,
D.S. Taylor,
E.C. TePas,
N.A. Speck, and
B. Mathey-Prevot.
1994.
Identification of a critical regulatory
site in the human interleukin-3 promoter by in vivo footprinting.
Blood.
83:
2851-2859
[Medline].
|
| 48. |
Takahashi, A.,
M. Satake,
Y. Yamaguchi-Iwai,
S.-C. Bae,
J. Lu,
M. Maruyama,
Y.W. Zhang,
H. Oka,
N. Arai,
K. Aria, et al
.
1995.
Positive and negative regulation of granulocytemacrophage colony-stimulating factor promoter activity by
AML1-related transcription factor, PEBP2.
Blood.
86:
607-616
[Medline].
|
| 49. |
Bae, S.C.,
Y. Yamaguchi-Iwai,
E. Ogawa,
M. Maruyama,
M. Inuzuka,
H. Kagoshima,
K. Shigesada,
M. Satake, and
Y. Ito.
1993.
Isolation of PEBP2 B cDNA representing the mouse
homolog of human acute myeloid leukemia gene, AML1.
Oncogene.
8:
809-814
[Medline].
[Medline] |
| 50. | Levanon, D., V. Negreanu, Y. Bernstein, I. Bar-Am, L. Avivi, and Y. Groner. 1994. AML1, AML2, and AML3, the human members of the runt domain gene family: cDNA structure, expression, and chromosomal localization. Genomics. 23: 425-432 [Medline]. [Medline] |
| 51. |
Bae, S.-C.,
E. Takahashi,
Y.W. Zhang,
E. Ogawa,
K. Shigesada,
Y. Namba,
M. Satake, and
Y. Ito.
1995.
Cloning, mapping and expression of PEBP2 C, a third gene encoding the
mammalian Runt domain.
Gene (Amst.).
159:
245-248
[Medline].
[Medline] |
| 52. | Wijmenga, C., N.A. Speck, N.C. Dracopoli, M.H. Hofker, P. Liu, and F.S. Collins. 1995. Identification of a new murine runt domain-containing gene, Cbfa3, and localization of the human homolog, CBFA3, to chromosome 1p35-pter. Genomics. 26: 611-614 [Medline]. [Medline] |
| 53. |
Bae, S.-C.,
E. Ogawa,
M. Maruyama,
H. Oka,
M. Satake,
K. Shigesada,
N.A. Jenkins,
D.J. Gilbert,
N.G. Copeland, and
Y. Ito.
1994.
PEBP2 B/mouse AML1 consist of multiple isoforms that possess differential transactivation potentials.
Mol.
Cell. Biol.
14:
3242-3252
[Medline].
|
| 54. |
Chien, Y.-H.,
M. Iwashima,
D.A. Wettstein,
K.B. Kaplan,
J.F. Elliot,
W. Born, and
M.M. Davis.
1987.
T-cell receptor
gene rearrangements in early thymocytes.
Nature (Lond.).
330:
722-727
[Medline].
[Medline] |
| 55. |
Wilson, A.,
W. Held, and
H.R. MacDonald.
1994.
Two
waves of recombinase gene expression in developing thymocytes.
J. Exp. Med.
179:
1355-1360
[Medline].
|
| 56. |
Satake, M.,
S. Nomura,
Y. Yamaguchi-Iwai,
Y. Takahama,
Y. Hashimoto,
M. Niki,
Y. Kitamura, and
Y. Ito.
1995.
Expression of the runt domain-encoding PEBP2 genes in T
cells during thymic development.
Mol. Cell. Biol.
15:
1662-1670
[Medline].
[Abstract] |
| 57. |
Forrester, W.C.,
C. van Genderen,
T. Jenuwein, and
R. Grosschedl.
1994.
Dependence of enhancer-mediated transcription of the immunoglobulin µ gene on nuclear matrix
attachment regions.
Science (Wash. DC).
265:
1221-1225
[Medline].
|
| 58. |
Aronow, B.J.,
R.N. Silbiger,
M.R. Dusing,
J.L. Stock,
K.L. Yager,
S.S. Potter,
J.J. Hutton, and
D.A. Wiginton.
1992.
Functional analysis of the human adenosine deaminase gene
thymic regulatory region and its ability to generate positionindependent transgene expression.
Mol. Cell. Biol.
12:
4170-4185
[Medline].
|
| 59. | Aronow, B.J., C.A. Ebert, M.T. Valerius, S.S. Potter, D.A. Wiginton, D.P. Witte, and J.J. Hutton. 1995. Dissecting a locus control region: facilitation of enhancer function by extended enhancer-flanking sequences. Mol. Cell. Biol. 15: 1123-1135 [Medline]. [Abstract] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|