Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article Abstract Full Text (PDF, 184K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Lauzurica, P. Articles by Roberts, J. L. Search for Related Content PubMed PubMed Citation Articles by Lauzurica, P. Articles by Roberts, J. L. Social Bookmarking                            What's this?

Article

Regulation of T Cell Receptor Gene Rearrangement by CBF/PEBP2

From the Department of Immunology, Duke University Medical Center, Durham, North Carolina 27710

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
We have analyzed transgenic mice carrying versions of a human T cell receptor (TCR)- gene minilocus to study the developmental control of VDJ (variable/diversity/joining) recombination. Previous data indicated that a 1.4-kb DNA fragment carrying the TCR- enhancer (E) efficiently activates minilocus VDJ recombination in vivo. We tested whether the transcription factor CBF/PEBP2 plays an important role in the ability of E to activate VDJ recombination by analyzing VDJ recombination in mice carrying a minilocus in which the E3 element of E includes a mutated CBF/PEBP2 binding site. The enhancer-dependent VD to J step of minilocus rearrangement was dramatically inhibited in three of four transgenic lines, arguing that the binding of CBF/PEBP2 plays a role in modulating local accessibility to the VDJ recombinase in vivo. Because mutation of the E3 binding site for the transcription factor c-Myb had previously established a similar role for c-Myb, and because a 60-bp fragment of E carrying E3 and E4 binding sites for CBF/PEBP2, c-Myb, and GATA-3 displays significant enhancer activity in transient transfection experiments, we tested whether this fragment of E is sufficient to activate VDJ recombination in vivo. This fragment failed to efficiently activate the enhancerdependent VD to J step of minilocus rearrangement in all three transgenic lines examined, indicating that the binding of CBF/PEBP2 and c-Myb to their cognate sites within E, although necessary, is not sufficient for the activation of VDJ recombination by E. These results imply that CBF/PEBP2 and c-Myb collaborate with additional factors that bind elsewhere within E to modulate local accessibility to the VDJ recombinase in vivo.

The process of VDJ recombination assembles variable (V)¹, diversity (D), and joining ( J) gene segments at TCR and Ig loci during lymphocyte development, generating the diverse antigen receptor repertoires that characterize mature T and B lymphocytes (1–5). VDJ recombination is under stringent developmental control, as it is activated at individual antigen receptor loci with unique cell lineage-specific and developmental stage-specific properties. Thus, fully rearranged TCR genes are only generated in developing T lymphocytes, and fully rearranged Ig genes are only generated in developing B lymphocytes. Further, TCR-β, -, and - rearrangement occurs earlier during thymocyte development than TCR- rearrangement (6), and IgH rearrangement occurs earlier in B cell development than Ig and rearrangement (1). Because all of these loci are thought to share both recombination signal sequences and the known components of the recombinase machinery, it is generally believed that these factors cannot account for locus-specific regulation of VDJ recombination. Rather, it is thought that locus-specific regulation is accomplished by modulating the accessibility of chromosomal recombination substrates to the recombinase (1–5).

The expression of fully rearranged TCR and Ig genes is controlled by a promoter flanking the V gene segment, and one or more transcriptional enhancers located adjacent to the C gene segment (7, 8). Recent studies have indicated that these cis-acting elements are also required for the developmental activation of VDJ recombination at individual antigen receptor loci. This has been accomplished by eliminating, mutating, or substituting enhancer or promoter elements within chromosomally integrated VDJ recombination substrates in transgenic mice (9–16), as well as by eliminating enhancer elements from endogenous antigen receptor loci by homologous recombination (17–23). These studies show that the efficiency of VDJ recombination is dramatically inhibited in the absence of a functional enhancer, and that the developmental activation of VDJ recombination can be modified by substitution of one enhancer for another.

We have previously studied the developmental control of VDJ recombination in transgenic mice carrying a human TCR- gene minilocus (13, 14). Efficient VDJ recombination of this minilocus requires the presence of E within the J3-C intron. Interestingly, the first step of minilocus rearrangement, V to D, occurs even in the absence of E, whereas the second step of minilocus rearrangement, VD to J, is E dependent (13). Thus, a functional enhancer is critical for establishing J segment accessibility to the VDJ recombinase machinery. Furthermore, substitution of E for E within the minilocus reveals that E and E regulate both the T cell subset and developmental stage specificity of the VD to J step of minilocus rearrangement in a manner that mimics the developmental activation of VDJ and VJ rearrangement, respectively, at the endogenous TCR-/ locus (14). These results lead to the conclusion that E and E are indeed responsible for the developmental regulation of VDJ recombination at the endogenous TCR-/ locus.

The developmental properties of E and E presumably result from the binding of specific trans-acting factors to discrete sites within the enhancers. Therefore, to better understand the mechanism by which these enhancers control VDJ recombination, we have begun to introduce mutations into previously defined cis-acting enhancer elements within the context of the TCR- gene minilocus, and to measure the effects of these mutations on the process of VDJ recombination in vivo.

E was initially defined and functionally dissected in transient transfection and in vitro protein binding studies (24– 28). These experiments identified an essential element of the enhancer, E3, that contains adjacent binding sites for the transcription factors CBF/PEBP2 (29–31) and c-Myb (32). Intact binding sites for both CBF/PEBP2 (the "core" site) (25) and c-Myb (27) are required for transcriptional activation by E. Because CBF/PEBP2 has been implicated in TCR-, -β, and - enhancer activity as well (30, 33– 36), it appears to be a crucial and broadly important regulator of T cell development and T cell–specific gene expression. Mice carrying a homozygous mutation within the gene encoding one particular CBF/PEBP2 isoform (B) display a very early defect in hematopoiesis and early embryonic lethality (37). Although these results clearly demonstrate an important role for CBF/PEBP2 in the development of early hematopoietic precursor cells, they do not provide information regarding subsequent molecular events that might be regulated by CBF/PEBP2 within developing thymocytes in vivo.

The present study was initiated to determine whether CBF/PEBP2 plays an important role in the developmental activation of TCR genes in vivo, by specifically testing its role in the activation of VDJ recombination by E. We found that disruption of the E3 core site significantly impairs the ability of E to activate VDJ recombination within the TCR- gene minilocus, suggesting that CBF/PEBP2 is an important regulator of VDJ recombination in vivo. Since previous data had indicated an important role for c-Myb as well, we then asked whether a small fragment of E carrying binding sites for these factors as well as GATA-3 was sufficient to activate VDJ recombination. We found that this was not the case, arguing that additional cis-acting elements of E are also required to establish local accessibility to the VDJ recombinase.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Production of Transgenic Mice.
The CBF/PEBP2 binding site mutation was generated by PCR using as a template the 1.4-kb wild-type E subcloned into the XbaI site of pBluescript KS+ (1.4EBS). PCR overlap extension was performed as described (38) using mutagenic oligonucleotides ACOREM (AGCAATGCATGACCTTTCCAACCG) and BCOREM (CGGTTGGAAAGGTCATGCATTGCT) along with EDRA (CTTTTAAAATTCTAGCAAGC) and the reverse primer as outside primers. The final PCR product was digested with NsiI and BamHI to generate a 170-bp fragment of E carrying the 3-bp change in E3 that eliminates CBF/PEBP2 binding. The plasmid 1.4EBS was also digested with PfiMI and NsiI to obtain an adjacent 590-bp fragment of E. The two fragments were ligated together into PfiMI and BamHI cut 1.4EBS. The structure of the resulting plasmid was determined by restriction mapping and dideoxynucleotide sequence analysis. The 1.4-kb EmCore was excised from this plasmid with XbaI and cloned into XbaI-digested, phosphatase-treated pBluescript carrying the previously described enhancerless minilocus (13).

A minilocus construct containing the E3,4 region was generated as follows. A 60-bp Nsi–AluI fragment of E (E3,4) had been previously subcloned into PstI and EcoRV cut pBluescript KS+. The insert was excised from this plasmid by digestion with BamHI and HindIII and the ends were blunted by treatment with the Klenow fragment of Escherichia coli DNA polymerase I. This fragment was then ligated into Xba I-digested, blunted, and phosphatase-treated pBluescript carrying the enhancerless minilocus. The structures of both minilocus constructs were confirmed by dideoxynucleotide sequence analysis.

Minilocus DNA was purified as described previously (13), and was microinjected into fertilized C57BL/6 x SJL F2 eggs by the Duke University Comprehensive Cancer Center Transgenic Mouse Shared Resource. Progeny tail DNA samples were analyzed on Southern blots as described previously (13). Transgenes were maintained on a mixed C57BL/6 x SJL background. Copy number was determined by analysis of tail DNA on a slot blot (Schleicher and Schuell, Keene, NH) using a radiolabeled C cDNA probe. Hybridization signals were quantified relative to previously identified single copy integrants using a Betascope (Betagen, Waltham, MA).

Preparation and Analysis of Genomic DNA.
Genomic DNA preparation, PCR, gel electrophoresis, blotting onto nylon membranes (Hybond-N; Amersham, Arlington Heights, IL or MAGNA nylon; Micron Separations Inc., Westboro, MA), and hybridization with ³²P-labeled probes were performed as described previously (13). The amount of DNA template used in PCR reactions (2–12 ng) was adjusted based on the results of amplification using C primers to account for differences in transgene copy number and PCR efficiency between samples, so that all PCR signals were maintained in the linear range. TCR- minilocus PCR primers 1 (VD1), 2 (VD2), 3 (JD1), 4 (JD3), 5 (CDA), and 6 (CDB), as well as the V1, V2, and C fragments used as probes to develop Southern blots of PCR products or genomic restriction digests, were described previously (13). These primers and probes allow detection of human TCR- minilocus sequences, but do not allow detection of endogenous murine TCR- locus sequences. Quantification of PCR signals was accomplished using either a Betascope or a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

	Results

Top Abstract Materials and Methods Results Discussion References

 
An Intact CBF/PEBP2 Binding Site Is Necessary for Efficient TCR- Gene Rearrangement In Vivo.
The previously studied human TCR- gene minilocus is a 22.5-kb construct containing germline V1, V2, D3, J1, J3, and C gene segments, along with a wild-type version of E within the J3C intron (13) (Fig. 1 A). The V1 and V2 coding segments carry mutations to prevent a rearranged transgene from encoding a TCR protein that might interfere with normal murine T cell development. Thus, the minilocus serves as a phenotypically neutral in vivo reporter of VDJ recombination.

View larger version (28K): [in this window] [in a new window] [Download PPT slide]   Figure 1 Structure and analysis of the E, EmCore, and E3,4 transgenes. (A) Schematic representations of the E and EmCore minilocus recombination substrates includes coding exons (filled boxes) and protein binding sites within E (open boxes). The 3-bp substitution in the E3 core site is shown. (B) Schematic representation of the E3,4 minilocus recombination substrate. (C) Primers used for analysis of minilocus rearrangement by PCR from genomic DNA (arrowheads). (D) Depiction of PCR products generated from V1 rearrangements using primers 1, 3, and 4. A similar set of PCR products are generated from V2 rearrangements using primers 2, 3, and 4.

 
For this study, we initially constructed a new version of the minilocus, referred to as EmCore, that carries a three– basepair change in the E3 core sequence within E (Fig. 1 A). The identical mutation was previously shown to eliminate CBF/PEBP2 binding to E3 in vitro, and to eliminate transcriptional activation by E in transient transfection experiments (25). Three transgenic founders, designated U, Y, and Z, were initially obtained. Breeding experiments indicated that in each of founders U and Z, the EmCore minilocus was integrated at a single site in the mouse genome, whereas in founder Y there were two independently segregating transgene integration sites. As a result, four different EmCore transgenic lines (U, Z, Y1, Y2) were established. As assessed by slot blot, the transgene copy numbers were: U, 8 copies; Z, 3 copies; Y1, 1 copy; and Y2, 2 copies. The single copy integrant in line Y1 was truncated so as to delete 4–5 kb at the 3' end of the minilocus. This truncation leaves V, D, J gene segments, E and the first C exon intact, and as such, is not expected to have a significant effect on minilocus VDJ recombination.

Analysis of wild-type and EmCore minilocus VDJ recombination was performed by PCR from thymus genomic DNA templates, using specific V1, V2, J1, and J3 primers (primers 1, 2, 3 and 4; Fig. 1 C) as described previously (13). Previous studies have shown the wild-type minilocus to rearrange stepwise, first V to D, and then VD to J (13). Amplification with V and J1 primers yields 0.3kb fragments that represent complete VDJ rearrangements, and in addition, 1.2-kb fragments that represent the VD rearrangement intermediates (Fig. 1 D). Amplification with V and J3 primers yields 0.3-kb VDJ products only. PCR reactions were also performed with a pair of C primers (primers 5 and 6; Fig. 1 C), to control for differences in transgene copy number and PCR efficiency between samples; the amount of genomic DNA template used in PCR reactions was typically adjusted to obtain similar C amplification signals in each sample. PCR products were detected and quantified by agarose gel electrophoresis followed by blotting and hybridization with appropriate ³²P-labeled probes. In agreement with our previous studies (13), quantification of PCR signals revealed amplification to be linear over a broad range of template concentrations (Fig. 2).

View larger version (12K): [in this window] [in a new window] [Download PPT slide]   Figure 2 Quantification of minilocus VDJ rearrangement. Serially diluted samples of thymus genomic DNA from E line A were amplified by PCR using primers 1 and 3 or primers 5 and 6, and Southern blots were developed using radiolabeled V1 and C cDNA probes. The V1D3-J1 (solid line) and C (dotted line) hybridization signals were quantified using a PhosphorImager. The results are expressed log hybridization signal in arbitrary units versus log DNA concentration in µg/ml. The second most concentrated DNA sample in this experiment corresponds to the amount of DNA used for analysis of single copy integrants in all subsequent experiments. Lower amounts of DNA were used for multicopy integrants.

 
We analyzed the effect of the core site mutation on minilocus VDJ recombination by comparing VD and VDJ rearrangement levels in thymocytes from three previously characterized lines of mice carrying a minilocus with a wild-type E (A, B, C) (13) to thymocytes in the four lines of mice carrying the EmCore minilocus (Fig. 3, A and B). All E lines of mice carry single copy integrations of the minilocus. Whereas the minilocus integrations in lines A and B include all relevant gene segments, the integration in line C is truncated at the 5' end and is missing the V1 gene segment. Thus, lines A and B are informative for both V1 and V2 rearrangement, whereas line C is informative for V2 rearrangement only. As in previous studies, PCR analysis of VDJ recombination in the E lines revealed high levels of 0.3-kb VDJ rearrangement products in each case (Fig. 3, A and B). Levels of 1.2-kb VD rearrangement products were lower and more variable (Fig. 3 A). Thus, as observed previously (13), the enhancer-dependent VD to J step of transgene rearrangement occurs efficiently in each of the E lines.

View larger version (42K): [in this window] [in a new window] [Download PPT slide]   Figure 3 PCR analysis of E and EmCore minilocus rearrangement. (A) Genomic DNA from thymi of wild-type E mice from lines A, B, and C, and from EmCore mice from lines U, Y1, Z, and Y2 were amplified by PCR using primers 5 and 6 (top), primers 1 and 3 (middle) and primers 2 and 3 (bottom). Southern blots were developed using radiolabeled C, V1 or V2 cDNA probes. The mice analyzed were A-26 (3 wk old), B-29 (2 wk old), C-306 (6 wk old), U-19 (5 wk old), Y1-83 (2 wk old), Z-92 (3 wk old), and Y287 (2 wk old). (B) Genomic DNA from the thymi of mice from lines A, U, Z, and Y2 were amplified by PCR using primers 5 and 6 (top), primers 1 and 4 (middle) and primers 2 and 4 (bottom). The mice analyzed were A-866, U-339, Z-419 and Y2-280 (all 4 wk old).

 
Analysis of VDJ recombination in the four EmCore lines revealed quite different results. In three of the lines (U, Y1, and Z), 0.3-kb products representing VDJ rearrangement were barely detectable, even though 1.2-kb VD rearrangement products were readily apparent (Fig 3, A and B). In the fourth line (Y2), VD and VDJ rearrangement products were both detected at levels that were comparable to their representation in E lines. The analysis of a second animal in each line (data not shown) yielded quite similar results, arguing that these VDJ recombination phenotypes are stable and reproducible characteristics of the individual transgenic lines. Because PCR amplifications with the C primer pair and with the V1-J1 primer pair were shown to be linear over several orders of magnitude (Fig. 2) we were justified in quantifying the level of VDJ recombination in the different lines by normalizing the V1-J1 PCR signal to the C PCR signal in each line. The levels of VDJ recombination in lines U, Y1 and Z, each calculated as the mean of three independent determinations, were found to be 0.8, 1.3, and 0.3%, respectively, of the level in E line A, and 3.1, 4.9, and 1.2%, respectively, of the level in E line B (Table 1). Similar quantification revealed VDJ recombination in line Y2 to be 41.7% of the level in line A, and 159.8% of the level in line B (Table 1).

View this table: [in this window] [in a new window]   Table 1 VDJ Rearrangement in E, EmCore, and E3,4 Transgenic Lines

 
The conclusions drawn from PCR analysis were confirmed through analysis of V1-D3 and V1-D3-J1 rearrangements by genomic Southern blot (Fig. 4). E line A thymocytes displayed nearly undetectable germline V1 (1.0 kb), moderate V1-D3 rearrangement (0.9 kb), and substantial V1-D3-J1 rearrangement (1.7 kb). In accord with the PCR data, V1-D3-J1 rearrangement was not detected in lines U and Z, even though transgene copy was higher in these lines than in E line A. Importantly, V1D3 rearrangement was readily detected in both lines, and accounted for almost all of the V1 signal in line Z. Although the reduced sensitivity of genomic Southern blot analysis as compared to PCR analysis does not allow an independent evaluation of the extent to which VDJ recombination is reduced in lines U and Z, the readily detectable V1-D3 rearrangement demonstrates that the ratio of VD to VDJ rearrangement has been dramatically perturbed in these lines. As these results argue that the VD to J step of transgene rearrangement has been specifically inhibited, they provide strong support for the PCR data. Also in accord with the PCR data, V1-D3 and V1-D3-J1 rearrangements were both detected in line Y2. Thus, on the basis of both PCR and genomic Southern blot analyses, we conclude that the enhancer-dependent step of minilocus rearrangement is dramatically and preferentially impaired in three of the four EmCore transgenic lines, but occurs quite normally in the fourth line.

View larger version (22K): [in this window] [in a new window] [Download PPT slide]   Figure 4 E, E3,4, and EmCore minilocus rearrangement analyzed by genomic Southern blot. A Southern blot carrying PstI plus EcoRI digested tail (germline control) and thymus DNA samples from E line A, E3,4 lines JA and JG, and EmCore lines U, Z, and Y2 was developed with a radiolabeled 1.0 kb V1 genomic PstI fragment as a probe. The mice analyzed were A-866, JA-81, JG-42, U-339, Z-352, and Y2-280 (all 4 wk old).

 
These results are reminiscent of our previous work analyzing VDJ recombination within a TCR- minilocus lacking E (13) or containing a disrupted binding site for c-Myb (39). In four of five transgenic lines carrying the minilocus construct lacking E, and in three of four transgenic lines carrying the minilocus construct with a disrupted binding site for c-Myb, inhibition of the VD to J rearrangement step was almost complete. However, in each case one of the transgenic lines displayed higher levels of VD to J rearrangement. Such heterogeneity in TCR- minilocus transgenic lines in which E has been eliminated or inactivated probably reflects the distinct properties of the different transgene integration sites. We propose that in E^–, EmMyb, and EmCore lines in which the VD to J step still occurs, the minilocus has integrated adjacent to active regulatory elements that partially or completely supplant the need for E. Heterogeneity of this magnitude has not been observed in transgenic lines carrying an intact enhancer, as VD to J rearrangement is efficient in three of three E lines (Fig. 3) and four of four E lines (14). On the basis of the phenotype displayed by the majority of EmCore transgenic lines, we conclude that elimination of a functional CBF/PEBP2 binding site within E has a dramatic effect on the ability of E to provide the regional accessibility to the VDJ recombinase that is required for efficient VDJ recombination in vivo.

Intact Binding Sites for CBF/PEBP2, c-Myb, and GATA-3 Are not Sufficient for Efficient TCR- Gene Rearrangement In Vivo.
Previous in vitro binding and transient transfection studies identified a functionally important binding site for c-Myb that is within the E3 element and adjacent to the CBF/PEBP2 binding site (27), as well as two functionally important binding sites for GATA-3 within the adjacent E4 element (40, 41). A 60-bp E3,4 fragment of E containing only these binding sites displays 20–50% of the activity of the intact 1.4-kb E in transient transfection experiments (25). Since CBF/PEBP2 (this study) and c-Myb (39) were implicated as important regulators of VDJ recombination in vivo, we asked whether the combination of CBF/ PEBP2, c-Myb and GATA-3 binding sites within E3 and E4 was sufficient to activate this process.

Therefore, the 60-bp E3,4 fragment of E was introduced into the TCR- gene minilocus in place of E (Fig. 1 B). Three transgenic founders were obtained and were used to generate independent lines of transgenic mice designated JA, JE, and JG. Slot blot analysis indicated transgene copy numbers of 2, 1, and 24 for JA, JE, and JG, respectively. As in E line C, the single copy E3,4 line JE is truncated such that it lacks V1 but retains V2. Hence, this line is informative for V2 rearrangement only.

Analysis of wild-type E and E3,4 minilocus VDJ recombination was performed by PCR as described above. All three E3,4 lines revealed dramatically reduced levels of VDJ rearrangement as compared to E lines A, B, and C (Fig. 5, A and B). In lines JA and JE, VDJ rearrangement was essentially undetectable, whereas in line JG, VDJ rearrangement was detectable at reduced levels. Nevertheless, VD rearrangement signals were readily detected by PCR in all three lines, and were detected at particularly high levels in line JA. Quantification of V1-J1 and C PCR signals indicated that VDJ rearrangement in lines JA and JG were reduced to 1.4 and 4.7%, respectively, of the level in E line A, and to 5.2 and 17.9%, respectively, of the level in E line B (Table 1). Analysis of V1-D3 and V1-D3-J1 rearrangements by genomic Southern blot confirmed that essentially all copies of V1 were rearranged to D3 in line JA, but that rearrangement was blocked at this stage (Fig. 4). Although the low level of VDJ rearrangement detected in line JG could not be confirmed due to both the limited sensitivity of detection and the presence of comigrating germline fragments in the tail DNA control, the results for JG did suggest that PCR may have underestimated the level of V1-D3 rearrangement in this line. Also of note is the significant reduction in transgene copy number in thymus relative to tail in this line (Fig. 4 and data not shown). This most likely results from the rearrangement of V1 in one copy of the tandemly arrayed transgene to D3 in another copy, with deletion of intervening copies. In summary, on the basis of the dramatic inhibition of VD to J recombination detected in both PCR and genomic Southern blot analyses, we conclude that the combination of CBF/ PEBP2, Myb, and GATA-3 binding sites contained within E3 and E4 is not by itself capable of promoting the accessible chromatin configuration required for efficient minilocus VDJ recombination.

View larger version (45K): [in this window] [in a new window] [Download PPT slide]   Figure 5 PCR analysis of E and E3,4 minilocus rearrangement. Genomic DNA from thymi of wild-type E mice from lines A, B, and C, and from E3,4 mice from lines JA, JE, and JG were amplified by PCR using primers 5 and 6 (top), primers 1 and 3 (middle) and primers 2 and 3 (bottom). Southern blots were developed using radiolabeled C, V1, or V2 cDNA probes. The mice analyzed were A-765 (4 wk old), B-31 (8 wk old), C-114 (4 wk old), JA-81 (4 wk old), JE101 (4 wk old), and JG-42 (4 wk old). (B) Genomic DNA from the thymi of mice from lines A, JA, JE, and JG were amplified by PCR using primers 5 and 6 (top), primers 1 and 4 (middle) and primers 2 and 4 (bottom). The mice analyzed were A-866, JA-81, JE-101, and JG-42 (all 4 wk old).

 

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
We previously documented enhancer-dependent VDJ recombination within a human TCR- gene minilocus construct in transgenic mice (13, 14), and have now begun to address the mechanisms by which E exerts its effects on VDJ recombination in this system. The data presented here indicates that a mutation that destroys the binding site for the transcription factor CBF/PEBP2 within the E3 element of E seriously compromises the ability of E to activate the VD to J step of minilocus rearrangement. Hence, by binding to E, this or a very closely related factor plays a crucial role in the developmental activation of minilocus rearrangement in vivo. We interpret the pattern of transgene rearrangement in the presence or absence of a functional E to indicate that a functional E is required to promote the accessibility of J gene segments to the VDJ recombinase within the transgenic minilocus. Although not directly proven, we infer that a functional E is also required to promote J gene segment accessibility, and hence VDJ recombination, within the endogenous TCR- locus. Our data therefore suggest strongly that CBF/PEBP2 family transcription factors are likely to be important regulators of TCR- gene rearrangement at the endogenous TCR- locus in vivo. Nevertheless, formal proof for this notion would require elimination of the E CBF/PEBP2 binding site from the endogenous locus by homologous recombination.

CBF/PEBP2 was initially identified by virtue of its ability to bind to and activate transcription from polyoma virus enhancer and the long terminal repeats of murine T lymphotropic retroviruses (42, 43). Functional CBF/PEBP2 binding sites have been identified in the regulatory elements of several cellular genes expressed in either the T lymphoid or myeloid cell lineages (44–48), including the enhancers of all four TCR genes (30, 33–36). CBF/PEBP2 is actually a complex family of transcription factors, each of which is composed of a DNA-binding subunit and an associated β subunit (29–31). Three distinct genes (A, B, and C) encode related subunits (30, 49–52), a separate gene encodes a shared β subunit (29, 31), and additional complexity is introduced by production of multiple and β isoforms from the individual genes (29–31, 53). Thus, any one of a number of CBF/PEBP2 species might be the crucial regulator of TCR- gene rearrangement in vivo. Although recent analysis of CBF/PEBP2 B null mice emphasizes a crucial role for this particular factor in hematopoiesis, the early lethality and pleiotropic effects of this mutation preclude any specific conclusions regarding a role in TCR- gene rearrangement (37). A candidate regulator of TCR- gene rearrangement would have to be expressed as early as the CD4^–CD8^– stage of thymocyte development, since the endogenous TCR- locus (54, 55) and our transgenic minilocus (14) are both activated during this stage. Notably, CBF/PEBP2 A and B are both expressed at highest levels in the thymus and are both expressed in CD4^–CD8^– thymocytes (56). Thus, both of these factors have expression patterns that would be consistent with a role in the activation TCR- gene rearrangement and expression in vivo.

Related studies using the transgenic minilocus approach have also implicated the transcription factor c-Myb in the activation of TCR- gene rearrangement in vivo (39). Hence CBF/PEBP2 and c-Myb appear to synergize to activate TCR- gene VDJ recombination in vivo, much as they were found to synergistically activate TCR- gene transcription in transient transfection studies (27, 28). Nevertheless, our results indicate that the combination of CBF/PEBP2, Myb, and GATA-3 binding sites within E3 and E4 is not, by itself, sufficient to promote the accessibility required for efficient activation of VDJ recombination within the TCR- gene minilocus. This suggests that additional cis-acting elements contained within the 1.4-kb E are crucial for this process. Such elements may be contained within the 370-bp fragment of E found to contain maximal enhancer activity in transient transfection experiments. Analyses of truncated forms of the enhancer suggest E2, E5, and E6 as candidate cis-acting elements of E that might individually or in combination increase the activity of the minimal enhancer by two- to threefold (24, 25). Little is known about the identities of the factors that interact with these elements. Nevertheless, it may be misleading to identify candidate determinants of E recombinational enhancer activity in a chromosomally integrated context in transgenic mice by extrapolating from those required for transcriptional enhancer activity in transient transfection experiments. For example, nuclear matrix attachment sites that flank E_µ are irrelevant for transcriptional activity as measured in transient transfection experiments or in chromosomally integrated substrates in stably transfected cells, but are important for the induction of transcriptional activity and general sensitivity to DNase I digestion in a chromosomally integrated substrate in transgenic mice (57). Similarly sequences that flank the human adenosine deaminase gene enhancer are irrelevant for transcriptional activity in transient transfection experiments, but are required for high level expression and the establishment of enhancer DNase I hypersensitivity in transgenic mice (58, 59). It is therefore quite possible that cis-elements contained within the 1.4-kb E might not appear relevant for gene expression on the basis of transient transfection experiments, but might be critical for E induced accessibility and VDJ recombination in transgenic mice. These additional cis-acting elements could be required for the stable assembly of CBF/PEBP2, c-Myb, and GATA-3 onto their E3 and E4 binding sites in a chromatin context. Alternatively, E3 and E4 might by themselves be able to support the assembly of a stable nucleoprotein complex, but additional cis-acting enhancer elements might contribute independently to accessibility and VDJ recombination. The hierarchy of assembly of nucleoprotein complexes at E, and the mechanisms by which assembled nucleoprotein complexes modulate regional chromatin accessibility and VDJ recombination, will be important issues to address in future studies.

	Acknowledgments

This work was supported by Public Health Service grant GM41052. M.S. Krangel is the recipient of American Cancer Society Faculty Research Award FRA-414. J.L. Roberts was supported in part by Public Health Service training grant CA09058.

Submitted: 3 December 1996

	References

Top Abstract Materials and Methods Results Discussion References

 

1 Alt FW, Blackwell TK & Yancopoulos GD. Development of the primary antibody repertoire, Science (Wash DC), 1987, 238, 1079–1087.[Abstract/Free Full Text]

2 Alt FW, Oltz EM, Young F, Gorman J, Taccioli G & Chen J. VDJ recombination, Immunol Today, 1992, 13, 306–314.[Medline]

3 Schatz DG, Oettinger MA & Schlissel MS. V(D)J recombination: molecular biology and regulation, Annu Rev Immunol, 1992, 10, 359–383.[Medline]

4 Lewis SM. The mechanism of V(D)J joining: lessons from molecular, immunological and comparative analyses, Adv Immunol, 1994, 56, 27–150.[Medline]

5 Sleckman BP, Gorman JR & Alt FW. Accessibility control of antigen receptor variable region gene assembly: role of cis-acting elements, Annu Rev Immunol, 1996, 14, 459–481.[Medline]

6 Fowlkes BJ & Pardoll DM. Molecular and cellular events of T cell development, Adv Immunol, 1989, 44, 207–264.[Medline]

7 Staudt LM & Lenardo MJ. Immunoglobulin gene transcription, Annu Rev Immunol, 1991, 9, 373–398.[Medline]

8 Leiden JM. Transcriptional regulation of T cell receptor genes, Annu Rev Immunol, 1993, 11, 539–570.[Medline]

9 Ferrier P, Krippl B, Blackwell TK, Furley AJW, Suh H, Winoto A, Cook WD, Hood L, Costantini F & Alt FW. Separate elements control DJ and VDJ rearrangement in a transgenic recombination substrate, EMBO (Eur Mol Biol Organ) J, 1990, 9, 117–125.[Medline]

10 Lauster R, Reynaud C-A, Martensson I-L, Peter A, Bucchini D, Jami J & Weill J-C. Promoter, enhancer and silencer elements regulate rearrangement of an immunoglobulin transgene, EMBO (Eur Mol Biol Organ) J, 1993, 12, 4615–4623.[Medline]

11 Kallenbach S, Babinet C, Pournin S, Cavelier P, Goodhardt M & Rougeon F. The intronic immunoglobulin gene enhancer acts independently on rearrangement and on transcription, Eur J Immunol, 1993, 23, 1917–1921.[Medline]

12 Capone M, Watrin F, Fernex C, Horvat B, Krippl B, Wu L, Scollay R & Ferrier P. TCRβ and TCR gene enhancers confer tissue- and stage-specificity on V(D)J recombination events, EMBO (Eur Mol Biol Organ) J, 1993, 12, 4335–4346.[Medline]

13 Lauzurica P & Krangel MS. Enhancer-dependent and -independent steps in the rearrangement of a human T cell receptor transgene, J Exp Med, 1994, 179, 43–55.[Abstract/Free Full Text]

14 Lauzurica P & Krangel MS. Temporal and lineage-specific control of T cell receptor / gene rearrangement by T cell receptor and enhancers, J Exp Med, 1994, 179, 1913–1921.[Abstract/Free Full Text]

15 Okada A, Mendelsohn M & Alt F. Differential activation of transcription versus recombination of transgenic T cell receptor β variable region gene segments in B and T lineage cells, J Exp Med, 1994, 180, 261–272.[Abstract/Free Full Text]

16 Fernex C, Capone M & Ferrier P. The V(D)J recombinational and transcriptional activities of the immunoglobulin heavy-chain intronic enhancer can be mediated through distinct protein-binding sites in a transgenic substrate, Mol Cell Biol, 1995, 15, 3217–3226.[Abstract]

17 Chen J, Young F, Bottaro A, Stewart V, Smith RK & Alt FW. Mutations of the intronic IgH enhancer and its flanking sequences differentially affect accessibility of the JH locus, EMBO (Eur Mol Biol Organ) J, 1993, 12, 4635–4645.[Medline]

18 Takeda S, Zou Y-R, Bluethmann H, Kitamura D, Muller U & Rajewsky K. Deletion of the immunoglobulin kappa chain intron enhancer abolishes kappa chain gene rearrangement in cis but not lambda chain gene rearrangement in trans, EMBO (Eur Mol Biol Organ) J, 1993, 12, 2329–2336.[Medline]

19 Serwe M & Sablitzky F. V(D)J recombination in B cells is impaired but not blocked by targeted deletion of the immunoglobulin heavy chain intron enhancer, EMBO (Eur Mol Biol Organ) J, 1993, 12, 2321–2327.[Medline]

20 Gorman JR, van der Stoep N, Monroe R, Cogne M, Davidson L & Alt FW. The Ig 3' enhancer influences the ration of Ig versus Ig B lymphocytes, Immunity, 1996, 5, 241–252.[Medline]

21 Xu Y, Davidson L, Alt FW & Baltimore D. Deletion of the Ig light chain intronic enhancer/matrix attachment region impairs but does not abolish VJ rearrangement, Immunity, 1996, 4, 377–385.[Medline]

22 Bories J-C, Demengeot J, Davidson L & Alt FW. Gene-targeted deletion and replacement of the T-cell receptor β-chain enhancer: the role of enhancer elements in controlling V(D)J recombination accessibility, Proc Natl Acad Sci USA, 1996, 93, 7871–7876.[Abstract/Free Full Text]

23 Bouvier G, Watrin F, Naspetti M, Verthuy C, Naquet P & Ferrier P. Deletion of the mouse T-cell receptor β gene enhancer blocks β T-cell development, Proc Natl Acad Sci USA, 1996, 93, 7877–7881.[Abstract/Free Full Text]

24 Redondo JM, Hata S, Brocklehurst C & Krangel MS. A T cell specific transcriptional enhancer within the human T cell receptor locus, Science (Wash DC), 1990, 247, 1225–1229.[Abstract/Free Full Text]

25 Redondo JM, Pfohl JL & Krangel MS. Identification of an essential site for transcriptional activation within the human T cell receptor enhancer, Mol Cell Biol, 1991, 11, 5671–5680.[Abstract/Free Full Text]

26 Redondo JM, Pfohl JL, Hernandez-Munain C, Wang S, Speck NA & Krangel MS. Indistinguishable nuclear factor binding to functional core sites of the T-cell receptor and murine leukemia virus enhancers, Mol Cell Biol, 1992, 12, 4817–4823.[Abstract/Free Full Text]

27 Hernandez-Munain C & Krangel MS. Regulation of the T-cell receptor enhancer by functional cooperation between c-Myb and core-binding factors, Mol Cell Biol, 1994, 14, 473–483.[Abstract/Free Full Text]

28 Hernandez-Munain C & Krangel MS. c-Myb and core-binding factor (CBF/PEBP2) display functional synergy but bind independently to adjacent sites in the TCR enhancer, Mol Cell Biol, 1995, 15, 3090–3099.[Abstract]

29 Wang S, Wang Q, Crute BE, Melnikova IN, Keller SR & Speck NA. Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor, Mol Cell Biol, 1993, 13, 3324–3339.[Abstract/Free Full Text]

30 Ogawa E, Maruyama M, Kagoshima H, Inuzuka I, Lu J, Satake M, Shigesada K & Ito Y. PEBP2/PEA2 represents a new family of transcription factor homologous to the products of the Drosophila runt and the human AML1, Proc Natl Acad Sci USA, 1993, 90, 6859–6863.[Abstract/Free Full Text]

31 Ogawa E, Inuzuka M, Maruyama M, Satake M, Naito-Fujimoto M, Ito Y & Shigesada K. Molecular cloning and characterization of PEBP2β, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2, Virol, 1993, 194, 314–331.[Medline]

32 Shen-Ong GLC. The myb oncogene, Biochim Biophys Acta, 1990, 1032, 39–52.[Medline]

33 Prosser HM, Wotton D, Gegonne A, Ghysdael J, Wang S, Speck NA & Owen MJ. A phorbol ester response element within the human T-cell receptor β-chain enhancer, Proc Natl Acad Sci USA, 1992, 89, 9934–9938.[Abstract/Free Full Text]

34 Hsiang YH, Spencer D, Wang S, Speck NA & Raulet DH. The role of viral enhancer "core" motif-related sequences in regulating T cell receptor- and - gene expression, J Immunol, 1993, 150, 3905–3916.[Abstract]

35 Wotton D, Ghysdael J, Wang S, Speck NA & Owen MJ. Cooperative binding of Ets-1 and core binding factor to DNA, Mol Cell Biol, 1994, 14, 840–850.[Abstract/Free Full Text]

36 Giese K, Kingsley C, Kirshner JR & Grosschedl R. Assembly and function of a TCR enhancer complex is dependent on LEF-1-induced DNA bending and mutliple protein-protein interactions, Genes Dev, 1995, 9, 995–1008.[Abstract/Free Full Text]

37 Okuda T, van Deursen J, Hiebert SW, Grosveld G & Downing JR. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis, Cell, 1996, 84, 321–330.[Medline]

38 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR. Site-directed mutagenesis by overlap extension using the polymerase chain reaction, Gene (Amst), 1989, 77, 51–59.[Medline]

39 Hernandez-Munain C, Lauzurica P & Krangel MS. Regulation of T cell receptor gene rearrangement by c-Myb, J Exp Med, 1996, 183, 289–293.[Abstract/Free Full Text]

40 Joulin V, Bories D, Eleouet J-F, Labasteie M-C, Chretien S, Mattei M-G & Romeo PH. A T-cell specific TCR DNA binding protein is a member of the human GATA family, EMBO (Eur Mol Biol Organ) J, 1991, 10, 1809–1816.[Medline]

41 Marine J & Winoto A. The human enhancerbinding protein Gata3 binds to several T-cell receptor regulatory elements, Proc Natl Acad Sci USA, 1991, 88, 7284–7288.[Abstract/Free Full Text]

42 Kamachi Y, Ogawa E, Asano M, Ishida S, Murakami Y, Satake M, Ito Y & Shigesada K. Purification of a mouse nuclear factor that binds to both the A and B cores of the polyomavirus enhancer, J Virol, 1990, 64, 4808–4819.[Abstract/Free Full Text]

43 Wang S & Speck NA. Purification of core-binding factor, a protein that binds the conserved core site in murine leukemia virus enhancers, Mol Cell Biol, 1992, 12, 89–102.[Abstract/Free Full Text]

44 Suzow J & Friedman AD. The murine myeloperoxidase promoter contains several functional elements, one of which binds a cell type-restricted transcription factor, myeloid nuclear factor 1 (MyNF1), Mol Cell Biol, 1993, 13, 2141–2151.[Abstract/Free Full Text]

45 Nuchprayoon I, Meyers S, Scott LM, Suzow J, Hiebert S & Friedman AD. PEBP2/CBF, the murine homolog of the human myeloid AML1 and PEBP2β/CBFβ proto-oncoproteins, regulates the murine myeloperoxidase and neutrophil elastase genes in immature myeloid cells, Mol Cell Biol, 1994, 14, 5558–5568.[Abstract/Free Full Text]

46 Zhang D-E, Fujioka K-I, Hetherington CJ, Shapiro LH, Chen H-M, Look AT & Tenen GT. Identification of a region which directs the monocytic activity of the colony-stimulating factor 1 (macrophage colony-stimulating factor) receptor promoter and binds PEBP2/CBF (AML1), Mol Cell Biol, 1994, 14, 8085–8095.[Abstract/Free Full Text]

47 Cameron S, Taylor DS, TePas EC, Speck NA & Mathey-Prevot B. Identification of a critical regulatory site in the human interleukin-3 promoter by in vivo footprinting, Blood, 1994, 83, 2851–2859.[Abstract/Free Full Text]

48 Takahashi A, Satake M, Yamaguchi-Iwai Y, Bae S-C, Lu J, Maruyama M, Zhang YW, Oka H, Arai N, Aria K et al.. Positive and negative regulation of granulocytemacrophage colony-stimulating factor promoter activity by AML1-related transcription factor, PEBP2, Blood, 1995, 86, 607–616.[Abstract/Free Full Text]

49 Bae SC, Yamaguchi-Iwai Y, Ogawa E, Maruyama M, Inuzuka M, Kagoshima H, Shigesada K, Satake M & Ito Y. Isolation of PEBP2B cDNA representing the mouse homolog of human acute myeloid leukemia gene, AML1, Oncogene, 1993, 8, 809–814.[Medline]

50 Levanon D, Negreanu V, Bernstein Y, Bar-Am I, Avivi L & Groner Y. AML1, AML2, and AML3, the human members of the runt domain gene family: cDNA structure, expression, and chromosomal localization, Genomics, 1994, 23, 425–432.[Medline]

51 Bae S-C, Takahashi E, Zhang YW, Ogawa E, Shigesada K, Namba Y, Satake M & Ito Y. Cloning, mapping and expression of PEBP2C, a third gene encoding the mammalian Runt domain, Gene (Amst), 1995, 159, 245–248.[Medline]

52 Wijmenga C, Speck NA, Dracopoli NC, Hofker MH, Liu P & Collins FS. Identification of a new murine runt domain-containing gene, Cbfa3, and localization of the human homolog, CBFA3, to chromosome 1p35-pter, Genomics, 1995, 26, 611–614.[Medline]

53 Bae S-C, Ogawa E, Maruyama M, Oka H, Satake M, Shigesada K, Jenkins NA, Gilbert DJ, Copeland NG & Ito Y. PEBP2 B/mouse AML1 consist of multiple isoforms that possess differential transactivation potentials, Mol Cell Biol, 1994, 14, 3242–3252.[Abstract/Free Full Text]

54 Chien Y-H, Iwashima M, Wettstein DA, Kaplan KB, Elliot JF, Born W & Davis MM. T-cell receptor gene rearrangements in early thymocytes, Nature (Lond), 1987, 330, 722–727.[Medline]

55 Wilson A, Held W & MacDonald HR. Two waves of recombinase gene expression in developing thymocytes, J Exp Med, 1994, 179, 1355–1360.[Abstract/Free Full Text]

56 Satake M, Nomura S, Yamaguchi-Iwai Y, Takahama Y, Hashimoto Y, Niki M, Kitamura Y & Ito Y. Expression of the runt domain-encoding PEBP2 genes in T cells during thymic development, Mol Cell Biol, 1995, 15, 1662–1670.[Abstract]

57 Forrester WC, van Genderen C, Jenuwein T & Grosschedl R. Dependence of enhancer-mediated transcription of the immunoglobulin µ gene on nuclear matrix attachment regions, Science (Wash DC), 1994, 265, 1221–1225.[Abstract/Free Full Text]

58 Aronow BJ, Silbiger RN, Dusing MR, Stock JL, Yager KL, Potter SS, Hutton JJ & Wiginton DA. Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate positionindependent transgene expression, Mol Cell Biol, 1992, 12, 4170–4185.[Abstract/Free Full Text]

59 Aronow BJ, Ebert CA, Valerius MT, Potter SS, Wiginton DA, Witte DP & Hutton JJ. Dissecting a locus control region: facilitation of enhancer function by extended enhancer-flanking sequences, Mol Cell Biol, 1995, 15, 1123–1135.[Abstract]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Facebook

Reddit

Technorati

Twitter

This article has been cited by other articles:

• del Blanco, B., Roberts, J. L., Zamarreno, N., Balmelle-Devaux, N., Hernandez-Munain, C. (2009). Flexible Stereospecific Interactions and Composition within Nucleoprotein Complexes Assembled on the TCR{alpha} Gene Enhancer. J. Immunol. 183: 1871-1883 [Abstract] [Full Text]  
• Growney, J. D., Shigematsu, H., Li, Z., Lee, B. H., Adelsperger, J., Rowan, R., Curley, D. P., Kutok, J. L., Akashi, K., Williams, I. R., Speck, N. A., Gilliland, D. G. (2005). Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype. Blood 106: 494-504 [Abstract] [Full Text]  
• Balmelle, N., Zamarreno, N., Krangel, M. S., Hernandez-Munain, C. (2004). Developmental Activation of the TCR {alpha} Enhancer Requires Functional Collaboration among Proteins Bound Inside and Outside the Core Enhancer. J. Immunol. 173: 5054-5063 [Abstract] [Full Text]  
• Roumier, C., Eclache, V., Imbert, M., Davi, F., MacIntyre, E., Garand, R., Talmant, P., Lepelley, P., Lai, J. L., Casasnovas, O., Maynadie, M., Mugneret, F., Bilhou-Naberra, C., Valensi, F., Radford, I., Mozziconacci, M. J., Arnoulet, C., Duchayne, E., Dastugue, N., Cornillet, P., Daliphard, S., Garnache, F., Boudjerra, N., Jouault, H., Fenneteau, O., Pedron, B., Berger, R., Flandrin, G., Fenaux, P., Preudhomme, C. (2003). M0 AML, clinical and biologic features of the disease, including AML1 gene mutations: a report of 59 cases by the Groupe Francais d'Hematologie Cellulaire (GFHC) and the Groupe Francais de Cytogenetique Hematologique (GFCH). Blood 101: 1277-1283 [Abstract] [Full Text]  
• Hernandez-Munain, C., Krangel, M. S. (2002). Distinct Roles for c-Myb and Core Binding Factor/Polyoma Enhancer-Binding Protein 2 in the Assembly and Function of a Multiprotein Complex on the TCR {delta} Enhancer In Vivo. J. Immunol. 169: 4362-4369 [Abstract] [Full Text]  
• Bendall, H. H., Sikes, M. L., Oltz, E. M. (2001). Transcription Factor NF-{{kappa}}B Regulates Ig{{lambda}} Light Chain Gene Rearrangement. J. Immunol. 167: 264-269 [Abstract] [Full Text]  
• McMurry, M. T., Krangel, M. S. (2000). A Role for Histone Acetylation in the Developmental Regulation of V(D)J Recombination. Science 287: 495-498 [Abstract] [Full Text]  
• Zhong, X.-P., Carabana, J., Krangel, M. S. (1999). Flanking nuclear matrix attachment regions synergize with the T cell receptor delta enhancer to promote V(D)J recombination. Proc. Natl. Acad. Sci. USA 96: 11970-11975 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF, 184K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Lauzurica, P. Articles by Roberts, J. L. Search for Related Content PubMed PubMed Citation Articles by Lauzurica, P. Articles by Roberts, J. L. Social Bookmarking                            What's this?