|
||
By

From the * Department of Medicine and the
Department of Microbiology and the Evans Memorial
Department of Clinical Research, Boston University Medical Center, Boston, Massachusetts 02118;
and § Division of Hematological Malignancies, Dana-Farber Cancer Institute, Boston, Massachusetts
02115
Cytokine and growth factor receptor engagement leads to the rapid phosphorylation and activation of latent, cytosolic signal transducers and activators of transcription (STAT) proteins, which then translocate to the nucleus where they regulate transcriptional events from specific promoter sequences. STAT3 expression in particular has been associated with Abl, Src, and HTLV-1 transformation of normal cells. B-1 lymphocytes are self-renewing, CD5+ B cells that display a propensity for malignant transformation and are the normal counterpart to human chronic lymphocytic leukemias. Further, B-1 cells are characterized by aberrant intracellular signaling, including hyperresponsiveness to phorbol ester PKC agonists. Here we demonstrate that B-1 lymphocytes constitutively express nuclear activated STAT3, which is not expressed by unmanipulated conventional (B-2) lymphocytes. In contrast, STAT3 activation is induced in B-2 cells after antigen receptor engagement in a delayed fashion (after 3 h). Induction of STAT3 is inhibited by both the serine/threonine protein kinase inhibitor H-7 and the immunosuppressive drug rapamycin and requires de novo protein synthesis, demonstrating novel coupling between sIg and STAT proteins that differs from the classical paradigm for STAT induction by cytokine receptors. The inability of prolonged stimulation of conventional B-2 cells with anti-Ig, a treatment sufficient to induce CD5 expression, to result in sustained STAT3 activation suggests that STAT3 is a specific nuclear marker for B-1 cells. Thus, STAT3 may play a role in B cell antigen-specific signaling responses, and its constitutive activation is associated with a normal cell population exhibiting intrinsic proliferative behavior.
The 67-kD pan-T cell surface glycoprotein, CD5, was
first detected on the surface of human and murine B cell
tumors and subsequently found to specify a subset of normal B lymphocytes in both species (1). CD5+ (or B-1) B
lymphocytes are mature B cells that predominate early in
life, decline in relative number as the animal matures, and, in mice, become confined to the peritoneal cavity, with
few, if any, present in the peripheral lymph nodes (2).
Functionally, B-1 cells contribute a disproportionally large
fraction of serum Ig, specifically of the µ, B-1 cells have been linked to both autoantibody production and the pathogenesis of autoimmune disease as well as
malignancy (2, 5). CD5+ B cells have been found to be enriched sources of autoantibody-producing cells specific for
various self-antigens, and several mouse strains that develop
autoimmune pathology have elevated numbers of splenic and peritoneal CD5 B cells (6, 7). Adoptive transfer experiments have demonstrated that B-1 cells have self-renewing
capacity (8), and in vitro, these cells are readily immortalized in culture without the use of exogenously induced
transformation (9). Coupled with their hyperresponsiveness
to PMA stimulation and their inability to enter S phase after sIg cross-linking (10, 11), these observations suggest that
B-1 cells differ from B-2 cells in their biochemical makeup
in ways that may contribute to autoantibody secretion and
unregulated growth.
Signal transducers and activators of transcription (STAT)1
proteins were first characterized by studying signaling in response to interferon and have since been implicated in cellular responses to a plethora of cytokines and growth factors
(12, 13). STAT signaling involves the activation of the
JAK/tyk family of tyrosine kinases that are believed to be
associated with unliganded cytokine receptors and to phosphorylate latent cytoplasmic STAT proteins upon ligand
binding (14). Phosphorylated STATs dimerize via interactions between their SH2 domains (15), allowing nuclear translocation and DNA binding activity specific for distinct
sequence elements in cytokine and growth factor-stimulated genes. We have previously shown that mitogenic
stimulation through surface Ig in B-2 cells induces the activation of STAT proteins (16). This observation, coupled
with the association of STAT3 with abnormal cell growth
and transformation (17), led us to compare the status and activational responses of STAT3 proteins in B-1 and
B-2 cells. Our results indicate that the nuclear expression of
activated STAT proteins differs between B-1 and B-2 cells
and that the STAT protein profile may be a distinguishing
molecular feature of the B-1 cell phenotype.
Animals.
Male BALB/cByJ mice at 8-14 wk of age were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were
housed at least 1 wk before experimentation. Mice were cared for
and handled at all times in accordance with National Institutes of
Health and institutional guidelines.
B Cell Purification.
B-1 lymphocytes were prepared by negative selection from peritoneal wash-out cells as previously described
(21). B-2 cells were purified from spleen cells of 8-12-wk-old naive mice by depletion of T cells using treatment with anti-Thy
1.2 antibody plus rabbit complement and depletion of macrophages by overnight culture on plastic petri dishes, as previously described (22). RBC and nonviable cells were removed by sedimentation over Lympholyte M (Cedarlane, Ontario, Canada). The
resulting B cells were cultured at 37°C with 5% CO2 in RPMI
1640 medium (BioWhittaker, Walkersville, MD) supplemented
with 5% heat inactivated fetal bovine serum (Sigma Chem. Co., St.
Louis, MO), 10 mM Hepes (pH 7.2), 50 µM 2-ME, 2 mM
L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. In some experiments, B-1 cells were prepared in the presence of serum-free RPMI 1640 medium containing 1% bovine serum albumin and cultured in serum-free AIM-V medium (GIBCO BRL,
Gaithersburg, MD).
Nuclear Extracts and Electrophoretic Mobility Shift Assay.
Nuclear
extracts from untreated or stimulated primary B cells were prepared
using 430 mM NaCl at pH 7.9 as previously described (22), except that 1 mM sodium orthovanadate was added to all extraction
buffers. Protein concentrations were determined by the Bradford
method (23) (Bio-Rad, Hercules, CA). Nuclear extracted protein
was incubated with 32P-labeled double-stranded oligonucleotide
containing the high-affinity SIE (m67) derived from the c-fos gene
(24) (5 Western Blotting.
Nuclear extracted protein (5 µg) was resolved by 7.5% SDS-PAGE, transferred to nitrocellulose and blocked
with 5% nonfat powdered milk in wash buffer (20 mM Tris, pH
7.6, 0.14 M NaCl, and 0.1% Tween-20; TBS-T) overnight at
4°C. The nitrocellulose filters were then probed with antiphosphotyrosine701STAT1 (26), or with antiphosphotyrosine705 STAT3
antiserum, generated by immunization of rabbits with a synthetic
peptide containing amino acids 696-709 of human STAT3, with
phosphotyrosine at position 705, which was conjugated to bovine
serum albumin. Blots were incubated for 1 h at room temperature with antibody in 3% BSA-TBS-T. After washing, blots were
developed by ECL.
Shift-Western.
EMSA was performed as described above except 5 µg of nuclear extracts were added to 1.5× the normal
amount of labeled oligonucleotide and electrophoresed on 5%
polyacrylamide gels. SIE-binding proteins were separated from
retarded labeled oligonucleotide by electrophoretic transfer from
the native gel to nitrocellulose paper. Labeled oligonucleotide
was detected bound to DE-81 paper (Whatman, Hillsboro, OR)
placed under the nitrocellulose filter and on top of Whatman filter paper. After transfer, the nitrocellulose filters were blocked
and Western blotted as above and the DE-81/Whatman filters were dried for 10 min before autoradiography.
Reagents.
F(ab To determine whether the unusual growth characteristics
of B-1 cells are accompanied by differences in the regulation of STAT proteins, we compared STAT DNA-binding
activities between resting B-1 and B-2 cells. Nuclear extracts from untreated B-1 cells formed protein-DNA complexes with the high-affinity sis-inducible element (SIE) of
the c-fos gene (27), a recognized STAT-binding site (1), as
detected by EMSA (Fig. 1 A). The major B-1 cell-specific SIE-binding activity was observed to co-migrate with the
IL-6-stimulated sis-inducible factor (SIF) A binding complex, with a smaller amount co-migrating similarly to the
IFN-
The B-1 cell complexes were competed by unlabeled
SIE-containing oligonucleotide but not by the consensus
binding site for the nuclear factor of activated T cells (NF-AT)
(Fig. 1 B), indicating that these complexes are specific for
the SIE. The constitutive expression of SIF complexes in
B-1 cells was not the result of serum induction in vitro, as
these complexes were still formed from nuclear extracts prepared from B-1 cells purified and cultured in serum-free
medium and were not inducible upon subsequent serum treatment (Fig. 1 C). Antibody to the NH2-terminal region
of STAT1
To assess the contribution of phosphorylated STAT3 to
the SIF A complex constitutively present in B-1 cells, we
performed Shift-Western experiments, using nuclear extracted protein, the SIE-containing oligonucleotide, and antiphosphotyrosine705STAT3. The mobility shift assay is shown
in Fig. 2 B, top. Nuclear extracts from either unstimulated
B-1 or B-2 cells or from B-2 cells treated with IL-6 for 15 min were incubated with the SIE oligonucleotide before
EMSA. The SIF A complexes constitutively present in untreated B-1 cells and IL-6-treated B-2 cells were found to
contain phosphotyrosine705STAT3, as determined by immunoblotting material obtained from the native gel (Fig. 2
B, bottom). As a control, phosphotyrosine705STAT3 electrophoresed in the absence of the SIE-containing oligonucleotide (no DNA control) was observed to migrate more
slowly in the gel, distinguishing it from SIE-bound STAT3
(data not shown). These results confirm that STAT3 is
constitutively present in B-1 nuclei, as indicated by the supershifting experiments outlined above and show that it is
present as a tyrosine phosphorylated protein in the SIF A
complex.
We further examined the phosphorylation status of
STAT3 in nuclear extracts from B-1 and B-2 cells. CNTF
has been reported to induce the tyrosine phosphorylation
of two STAT3 isoforms, p88 and p89 (31). These isoforms,
whose phosphorylation is also inducible by IL-6 (29, 32,
33), have been termed STAT3f (p88), for faster migrating
and STAT3s (p89), for slower migrating (32, 34). Immunoblotting with antiserum specific for STAT3 phosphorylated
on tyrosine705 showed that B-2 cells express little nuclear
phosphotyrosine705STAT3s or STAT3f, as expected on the
basis of EMSA analysis (Fig. 1 A). In comparison, B-1 cell
nuclear extracts were found to contain roughly equal levels
of phosphotyrosine705STAT3s and STAT3f, respectively,
which co-migrated with IL-6-induced phosphotyrosine705
STAT3 from B-2 cells (Fig. 2 C). In addition, immunoblotting untreated B-1 cell nuclear extracts with antibody
specific for STAT1 phosphorylated on tyrosine701 (26) detected activated STAT1 of the p91 isoform, which was not
present in nuclear extracts from untreated B-2 cells but was inducible by IFN- The presence of SIF A and phosphotyrosine705STAT3 in
B-1 cells could not be due to macrophage contamination,
because purified macrophages isolated by adherence during
B cell purification from the same animals did not contain
nuclear SIF A or phosphotyrosine705STAT3, and histologic
examination of B-1 populations revealed less than 2% macrophage contamination (data not shown). Further, overnight incubation of B-1 cells with neutralizing antibody to IL-10 before preparation of nuclear extracts did not result
in diminution of the SIF A complex observed by EMSA
(data not shown), suggesting that an IL-10 autocrine loop
does not account for the observed elevated levels of STAT3
in unstimulated B-1 cells and that constitutive STAT3 expression is intrinsic to this population.
Previous work has shown that anti-Ig treatment of B-2
cells results in STAT1 activation (35). It has been suggested
that B-1 cells represent a population of conventional B cells
previously activated through their antigen receptors. For
these reasons, STAT3 activation was evaluated in nuclear
extracts from B-2 cells treated with anti-Ig. Nuclear extracts from anti-Ig-treated B-2 cells formed a SIF A complex with the SIE similar to that observed in untreated B-1
cells, although this activity was only present in extracts from
cells stimulated for 3 h or more (Fig. 3 A). As with B-1 SIF A,
anti-p91N but not antiserum to phosphotyrosine701STAT1
disrupted SIF A induced by anti-Ig in B-2 cells (Fig. 3 B)
and formed a supershifted complex with SIF A that was
visible in longer exposures and co-migrated with a similar
complex recognized by anti-p91N in IL-6-treated B cells
(data not shown). Further, phosphotyrosine705STAT3s was
detected by immunoblotting using nuclear extracts from B-2 cells treated for 3 h with anti-Ig, although little phosphotyrosine705STAT3f was observed (Fig. 4 A). B cells stimulated with anti-Ig for less than 3 h did not contain nuclear
phosphotyrosine705STAT3s or STAT3f (data not shown).
These results suggest that cross-linking sIg in B-2 cells generates activated nuclear STAT3 of predominantly the STAT3s
isoform, much like IL-6 treatment of B-2 cells but dissimilar from the phosphotyrosine705STAT3 profile of unstimulated B-1 cells, in which levels of STAT3s and STAT3f are
nearly equal (Fig. 2 C). Thus, constitutively expressed B-1
cell STAT3 is not the same as STAT3 induced in B-2 cells
by sIg or cytokine receptor engagement.
The formation and transcriptional activity of cytokineinduced STAT3 complexes have been shown to require
inducible serine phosphorylation (32, 36). Because many
sIg triggered downstream events are PKC dependent, we
tested whether anti-Ig induction of STAT3 in B-2 cells is
sensitive to inhibition of serine/threonine phosphorylation,
using the inhibitor, H7. The induction of phosphotyrosine705STAT3s by anti-Ig was completely inhibited by H7
but not by treatment with (the control analog) HA1004
(Fig. 4 A). Preincubation with H7 but not with HA1004
also completely blocked the formation of the SIF A-binding complex in EMSA experiments conducted using nuclear extracts from B-2 cells stimulated with anti-Ig for 3 h
(Fig. 4 B). These results suggest that nuclear localization of
phosphotyrosine705STAT3s and the appearance of nuclear
SIF A in B-2 cells stimulated by anti-Ig requires serine/
threonine phosphorylation and further implicate STAT3s
in the composition of the anti-Ig-induced SIF A complex.
The delayed tyrosine phosphorylation of STAT3 after
sIg ligation in B-2 cells suggested that the synthesis of an
intermediary protein is required for this response. To test
this possibility, B-2 cells were stimulated with anti-Ig in the
presence of the protein synthesis inhibitor cycloheximide
(CHX) and nuclear extracts were prepared. CHX completely blocked the induction of phosphotyrosine705STAT3s in
nuclear extracts from B-2 cells treated with anti-Ig for 3 h,
whereas CHX had no effect on phosphotyrosine705STAT3
stimulated by IL-6 (Fig. 4 C). CHX also abrogated the formation of the SIF A-binding complex in EMSA experiments performed using nuclear extracts from B-2 cells
stimulated with anti-Ig for 3 h (data not shown). Thus, de
novo protein synthesis is required for induction of both SIF
A and of phosphotyrosine705STAT3s by anti-Ig.
Since anti-Ig is a mitogenic stimulus for B-2 cells, we
reasoned that induction of STAT3 via this novel mechanism may be sensitive to immunosuppressive drugs that inhibit B cell proliferation, such as cyclosporin A, FK506,
and rapamycin (37, 38). Immunoblot analysis of nuclear
extracted protein showed substantial inhibition of anti-
Ig-induced phosphotyrosine705STAT3s by rapamycin (Fig.
4 D). Rapamycin also significantly blocked the formation
of the anti-Ig-inducible SIF A complex (Fig. 4 E). This effect of rapamycin is specific for sIg-triggered STAT3 because induction of phosphotyrosine705STAT3 by IL-6 was
not affected by rapamycin (data not shown). Further, B-2
cell treatment with CsA had a minimal effect on nuclear expression of phosphotyrosine705STAT3s after anti-Ig stimulation but completely inhibited nuclear phosphotyrosine705STAT3s induced by the combination of PMA and
the calcium ionophore, ionomycin (data not shown) demonstrating an additional level of specificity for the effect of
rapamycin on anti-Ig-induced STAT3.
Both the delayed appearance and dependence on protein
synthesis of phosphotyrosine705STAT3 in B-2 cells after
anti-Ig stimulation raised the possibility that sIg-mediated
STAT3 induction may be due to the release of cytokines
from the B cells themselves or from other contaminating cells in the B-2 cell preparation after treatment with antiIg. To address this question, nuclear extracts from the mature B cell line BAL-17 were prepared and immunoblotted
for phosphotyrosine705STAT3 after stimulation with anti-Ig.
Phosphotyrosine705STAT3s was induced in BAL-17 B cells
by anti-Ig treatment with similar kinetics to that observed
in B-2 cells (data not shown) ruling out a role for a factor
secreted by a contaminating non-B cell. In addition, culture supernatants from B cells stimulated by anti-Ig for 3 h
were transfered to naive cells, from which nuclear extracts
were prepared after 15 min and tested for the presence of
phosphotyrosine705STAT3 by immunoblotting. Supernatants from cultures treated with anti-Ig for 3 h did not induce
appreciable rapid tyrosine phosphorylation of STAT3 in previously naive cells (data not shown), as would be expected
of a cytokine-mediated response. These results, coupled with the sensitivity of this response to rapamycin, which
does not inhibit cytokine-mediated STAT signaling, suggest that the delayed tyrosine phosphorylation of STAT3 is
specific to anti-Ig treatment and is not the result of cytokine release or synthesis triggered by cell activation.
Prolonged exposure of B-2 cells to anti-Ig (e.g., for 2.5 d)
has been shown to result in the acquisition of surface CD5
expression and proliferative responsiveness to PMA (39,
40). The possibility that prolonged sIg crosslinking produces a B-1-like basal level of nuclear activated STAT3
was tested by treating B-2 cells with anti-Ig for several days
before nuclear extraction. Although B-2 cells treated with
anti-Ig for 2.5 d responded to PMA by cell cycle progression to S phase, sIg-mediated nuclear SIF A (which was apparent at 3 h) had disappeared by this time (Fig. 5). This result indicates that STAT3 induced by anti-Ig in B-2 cells is only transiently expressed, and thus long term T cell-independent type II (TI-2) antigenic stimulation of B-2 cells does
not recapitulate the profile of activated STAT3 characteristic of B-1 cells, despite inducing other B-1-like changes.
These results suggest that activated STAT3 expression is an
intrinsic and unique characteristic of B-1 cells.
In conclusion, we have identified constitutive nuclear
activated STAT3 in normal murine B-1 lymphocytes, representing the first nuclear transcriptional identifier for this
developmentally regulated B cell population. The B-1 cell
subset has been linked to spontaneously arising B cell tumors,
and STAT3 has been found to be activated in v-abl-transformed B cells, HTLV-I-transformed T cells, and v-src-
transformed fibroblasts (17). Basal levels of nuclear phosphorylated STAT3 may reflect, or may cause, the activated
state of B-1 cells, and may contribute to the self-renewing growth characteristics and the oncogenic potential of normal B-1 cells in vivo. In contrast, both egr-1 and c-myc
mRNA levels do not differ between B-1 and B-2 cells (41).
There has been considerable debate over whether B-1
cells are derived from a separate lineage of progenitor cells
or represent B-2 cells that have undergone internal biochemical and external cell surface marker changes due to
prior activational or differentiative responses, such as those
delivered by TI-2 antigens (42, 43). Our data suggest that
one activity of sIg cross-linking in conventional B cells is to
activate STAT3, which occurs in delayed fashion, involves
phosphorylation of tyrosine705, and is dependent upon de
novo protein synthesis, serine/threonine phosphorylation,
and the participation of a rapamycin-inhibitable kinase.
Thus, the B cell antigen receptor is coupled to nuclear expression of activated STAT proteins (this work and references 16, 35). Notably, many features of this coupling
stand in stark contrast to the accepted paradigm for STAT
activation mediated by cytokine receptors, in which STAT
phosphorylation occurs rapidly, does not require protein
synthesis, and is independent of rapamycin-sensitive kinase
activity. However, the basal presence of both activated STAT3s and STAT3f in unstimulated B-1 cells contrasts with
the transient induction of predominantly the STAT3s isoform in anti-Ig stimulated B-2 cells and suggests that crosslinking sIg alone does not result in similar nuclear expression, in B-2 cells, of this activated transcription factor
present in B-1 cells. Therefore, constitutive B-1 cell STAT3
expression suggests that the development of these B cells
cannot be explained by TI-2 antigen-mediated influences
alone, and that STAT proteins play a role in directing the
unique behavioral and phenotypic characteristics of this
population of normal cells.
, and
classes.
These Igs are noted to express germline encoded specificities, with little somatic mutation and N-insertion and may
be involved in the regulation of idiotype expression (3, 4).
GTGCATTTCCCGTAAATCTTGTCTACAATTC3
) for 20 min before electrophoresis on nondenaturing 5% polyacrylamide gels. Binding reactions contained 1 µg poly(dI-dC) and
2.0 µg salmon sperm DNA. For competition analysis, 20-fold excess unlabeled SIE or NF-AT oligonucleotide (25) was added to
binding reactions before addition of nuclear protein and electrophoresis. Supershift/immunoinhibition analysis was performed by
addition of 1 µl anti-p91N or antiphosphotyrosine701STAT1 for
an additional 30 min at 4°C after the 20-min electrophoretic mobility shift assay (EMSA) binding reaction.
)2 fragments of goat anti-mouse IgM (Jackson
Immunoresearch, Inc., West Grove, PA) were used at a concentration of 15 µg/ml. PMA (Sigma) was used at 100 ng/ml. Cells
were stimulated with murine recombinant IFN-
(5 ng/ml) or
IL-6 (1,000 U/ml), both from Genzyme (Cambridge, MA). Rabbit antiserum to the NH2-terminal domain of p91 (anti-p91N) was
the kind gift of Dr. C. Schindler (Columbia University, New
York). Rabbit antiserum specific for only the tyrosine-phosphorylated form of STAT1 was generated by immunization of rabbits
with a peptide designed from the STAT1
protein containing
phosphorylated Tyr 701 (26). Rapamycin was used at 20 ng/ml,
dissolved in ethanol and 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H-7) and N-(2
-guanidinoethyl)-5-isoquinolinesulfonamide
(HA-1004) (LC Laboratories, Woburn, MA) were used at 25 µM.
-induced SIF C complex (24, 28). In contrast,
no SIF A, and little SIF C activity was detected in nuclear
extracts obtained from unmanipulated B-2 cells.
Fig. 1.
Constitutive expression of specific nuclear SIE-binding activity that co-
migrates with IL-6-induced SIF A in B-1
cells. (A) EMSA analysis of nuclear extracts prepared from B-2 cells (15 × 106) incubated in
medium alone or treated with IL-6 (1,000 U/
ml for 15 min; Genzyme, Cambridge, MA) or
IFN-
(
; 5 ng/ml for 15 min; Genzyme), or
B-1 cells (7.5 × 106) incubated in medium
alone. Nuclear extracts were incubated with radiolabeled oligonucleotide containing the
high-affinity c-fos SIE sequence (28). Arrows
indicate the positions of STAT3 homodimers (SIF A), STAT3-STAT1 heterodimers (SIF
B), and STAT1 homodimers (SIF C). (B)
Specific binding activity of the constitutive B-1 SIE-binding complex. Competition analysis
was performed on nuclear extracts from untreated B-1 cells in an EMSA using 20-fold
excess unlabeled SIE or NF-AT (control) oligonucleotides. Arrows indicate the positions
of SIE-binding complexes containing SIF A,
B, and C. (C) Serum does not induce SIF A
in B-1 cells. SIE-EMSA analysis of nuclear
extracts prepared from B-1 cells purified and
cultured in the presence of serum-free medium alone (lane 1), or in serum-free medium
plus IL-6 (1,000 U/ml for 15 min; lane 3), or
subsequent resuspension in serum-containing
RPMI medium for 15 min (lane 4). B-2 cells
(lane 2) were cultured in serum-containing
RPMI medium alone.
[View Larger Versions of these Images (34 + 28 + 44K GIF file)]
(anti-p91N), which has been shown to recognize STAT3 induced by ciliary neurotrophic factor (CNTF)
(31), disrupted SIF A induced by IL-6 in B cells (Fig. 2 A).
The constitutively expressed B-1 SIF A-like complex was
also disrupted by anti-p91N but not by an antibody to phosphotyrosine701STAT1 (Fig. 2 A). Anti-p91N formed supershifted complexes with SIF A in both IL-6-stimulated B cells
and untreated B-1 cells which were apparent in longer exposures and showed identical electrophoretic mobilities; antisera to STAT 4, 5, or 6 failed to react with the B-1 cell SIF
A complex in EMSA supershift assays or with B-1 cell nuclear extracts in Western blotting experiments, and antibody that supershifted STAT1 activated by IFN-
immunoinhibited/supershifted only a small amount of the SIF C
complex of B-1 cells (data not shown). Because STAT3 is
only known to form homodimers or to heterodimerize with
STAT1, these results strongly suggest that B-1 cells differ from B-2 cells in the basal nuclear expression of STAT3
homodimers that comprise the SIF A nucleoprotein complex.
Fig. 2.
Immunoreactivity of B-1 cell SIF A with STAT3-specific
antisera, and detection of constitutively expressed B-1 cell STAT 1 and 3 isoforms. (A) EMSA supershift/immunoinhibition analysis was performed
using nuclear extracts from untreated B-1 cells (M) or B-2 cells stimulated
with IL-6 and antibody to the NH2-terminal region of STAT1, which has
been shown to supershift STAT3 activated by IL-6 or CNTF (
-p91N).
Antiserum specific for phosphorylated STAT1 (
-ptyrSTAT1) (26) was
used as a control. Arrows indicate the positions of SIF A, B, and C. (B) B-1
cells were incubated in medium alone (
) and B-2 cells were either incubated in medium alone or were stimulated with IL-6 (1,000 U/ml) for 15 min, after which nuclear extracts were prepared. Nuclear extracted protein was analyzed by EMSA using the 32P-labeled SIE-containing oligonucleotide
probe and 5% nondenaturing PAGE. Retarded radiolabeled oligonucleotide was separated from DNA-binding proteins by a Shift-Western procedure, using electrotransfer to Whatman DE-81 paper and nitrocellulose
filter paper, respectively. The SIE-containing oligonucleotide was visualized by autoradiography (top) and DNA-binding protein was immunoblotted with STAT3 phosphotyrosine705-specific antibody and detected
by ECL (bottom). The positions of the specific SIE-binding nucleoprotein
complexes and immunoblotted phosphotyrosine705STAT3 are indicated
(arrows). (C) Immunoblot analysis of nuclear extracts from unstimulated
B-2 or B-1 cells (left) or B-2 cells that were incubated with medium alone
(M) or stimulated with IL-6 (B-2/IL-6; 1,000 U/ml for 15 min) (right),
probed with antibody specific for STAT3 phosphorylated on tyrosine 705. Arrows indicate fast (p88) and slow (p89) migrating forms of STAT3. To
test for equal loading of lanes, the blot was reprobed with an antibody to
the constitutively expressed nuclear transcription factor, CREB (UBI, Lake
Placid, NY). (D) Immunoblot analysis of nuclear extracts from untreated
(M) B-1 or B-2 cells (lanes 1 and 2) or B-2 cells stimulated with IFN-
(5 ng/ml for 15 min; lane 3), probed with antibody specific for phosphotyrosine701STAT1 (26). Arrows indicate 91- and 84-kD isoforms of STAT1.
[View Larger Versions of these Images (55 + 73 + 43 + 15 + 36K GIF file)]
treatment (Fig. 2 D). Thus, the B-1-specific expression of SIF A correlates with the presence of the
phosphotyrosine705 forms of STAT3s and STAT3f in nuclei
from unstimulated B-1 cells, and B-1 cells also constitutively express a small amount of activated p91-STAT1.
Fig. 3.
Inducible nuclear expression of STAT3 in B-2 cells treated
with anti-Ig. (A) Delayed nuclear expression of SIF A in anti-Ig-stimulated B-2 cells. EMSA analysis for SIE-binding activity was carried out using
nuclear extracts prepared from B-2 cells incubated in medium alone (
) or
stimulated with F(ab
)2 fragments of goat anti-mouse IgM (aIg; 15 µg/ml),
as indicated. Arrows indicate positions of nucleoprotein complexes containing SIF A, B, and C. (B) Immunoreactivity of anti-Ig-induced B-2 cell
SIF A with a STAT3-specific antiserum. Gel mobility supershift/immunoinhibition analysis was performed using nuclear extracts from B-2 cells
stimulated with F(ab
)2 GaMIgM (aIg) for 3 h and added to radiolabeled
SIE-containing oligonucleotide before addition of antiserum specific for
STAT3 (
-p91N) or for phosphorylated STAT1 (
-ptyrSTAT1); see legend to Fig. 1. Arrows indicate the position of nucleoprotein complexes containing SIF A, B, and C.
[View Larger Versions of these Images (35 + 33K GIF file)]
Fig. 4.
Unique features of
the surface Ig-mediated STAT3signaling pathway. (A and B) Induction of tyrosine phosphorylated STAT3 by anti-Ig in B-2
cells requires serine/threonine
phosphorylation. Nuclear extracts were obtained from B-2
cells stimulated for 3 h with
F(ab
)2 GaMIgM (aIg) alone or
with aIg in the presence or absence of either the serine/threonine kinase inhibitor H-7, or its
less active structural analogue,
HA1004 (both at 25 µM; LC
Laboratories) and probed with
antibody specific for phosphotyrosine705STAT3 (A). Arrows indicate fast (p88) and slow
(p89) migrating forms of phosphorylated STAT3. To test for
equal loading of lanes, the blot
was reprobed with an antibody to the constitutively expressed nuclear
transcription factor, CREB. Nuclear extracts were also analyzed by
EMSA as described in Fig. 1 (B). Arrows indicate positions of nucleoprotein complexes containing SIF A, B, and C. (C) Induction of STAT3s after anti-Ig treatment is blocked by cycloheximide. Primary B cells were
incubated in medium alone (M) or were treated with IL-6 (1,000 U/ml)
for 15 min, or with F(ab
)2 goat anti-mouse IgM (15 µg/ml; aIg) for 3 h,
after which nuclear extracts were prepared. Before stimulation, some B
cell cultures were pretreated for 30 min with CHX (10 µg/ml) as indicated. Nuclear extracted protein was size separated by SDS-PAGE on
7.5% gels followed by immunoblotting with phosphotyrosine705STAT3-
specific antibody, detected by ECL. Arrows indicate fast (p88) and slow
(p89) migrating forms of phosphorylated STAT3. (D and E) Rapamycin
inhibits anti-Ig-induced activation of STAT3. Primary B cells (1.5 × 107)
were incubated in medium alone (
) or were stimulated with F(ab
)2 goat anti-mouse IgM (15 µg/ml; aIg) for the indicated times, after which
nuclear extracts were prepared. Before stimulation, some B cell cultures
were pretreated for 15 min with either rapamycin at 20 ng/ml (rapa) or
ethanol (vehicle, VH). Nuclear extracted protein was size separated by
SDS-PAGE on 7.5% gels followed by immunoblotting with phosphotyrosine705STAT3-specific antibody, detected by ECL (D). The positions of molecular size markers and phospho-STAT3 (arrow) are indicated. Nuclear extracts were also analyzed by EMSA as described in Fig. 1 (E).
Arrows indicate positions of nucleoprotein complexes containing SIF A,
B, and C.
[View Larger Versions of these Images (17 + 17 + 17 + 62 + 29K GIF file)]
Fig. 5.
Failure of prolonged
anti-Ig treatment of B-2 cells to reproduce the B-1 cell nuclear STAT3
profile. Nuclear extracts were prepared from untreated B-1 cells and
from B-2 cells incubated with either
medium alone (
), or treated with
IL-6 for 15 min; nuclear extracts
were also prepared from B-2 cells
treated with anti-Ig (2.5 µg/ml) for
2.5 d or 2.5 d anti-Ig-treated B-2
cells subsequently stimulated with either PMA for 1 h or IL-6 for 15 min,
as indicated. EMSA was performed
as described in Fig. 1. Arrows indicate positions of nucleoprotein complexes containing SIF A, B, and C.
[View Larger Version of this Image (31K GIF file)]
Address correspondence to Thomas L. Rothstein, Department of Medicine, Evans-556, Boston Medical Center, 88 East Newton St., Boston, MA 02118.
Received for publication 7 October 1996 and in revised form 13 January 1997.
1Abbreviations used in this paper: CHX, cycloheximide; CNTF, ciliary neurotrophic factor; EMSA, electrophoretic mobility shift assay; PKC, protein kinase C; SIE, sis-inducible element; SIF, sis-inducible factor; STAT, signal transducers and activators of transcription; TI-2, T cell-independent type II.We are grateful to C. Schindler for his gift of anti-p91N antibody and D. Francis for valuable input.
This work was supported by United States Public Health Service Grant AI29690 to T.L. Rothstein.
| 1. | Kantor, A.B., and L.A. Herzenberg. 1993. Origin of murine B cell lineages. Annu. Rev. Immunol. 11: 501-538 [Medline]. |
| 2. | Hayakawa, K., R.R. Hardy, and L.A. Herzenberg. 1986. Peritoneal Ly-1 B cells: genetic control, autoantibody production, increased lambda light chain expression. Eur. J. Immunol. 16: 450-456 [Medline]. |
| 3. |
Sherr, D.H., and
M.E. Dorf.
1984.
An idiotype-specific
helper population that bears immunoglobulin, Ia, and Lyt-1
determinants.
J. Exp. Med.
159:
1189-1200
|
| 4. | Hardin, J.A., K. Vos, Y. Kawano, and D.H. Sherr. 1990. A function for Ly-1+ B cells. Proc. Soc. Exp. Biol. Med. 195: 172-182 [Medline]. |
| 5. |
Caligaris-Cappio, F.,
M. Gobbi,
M. Bofill, and
G. Janossy.
1982.
Infrequent normal B lymphocytes express features of
B-chronic lymphocytic leukemia.
J. Exp. Med.
155:
623-632
|
| 6. |
Burastero, S.E.,
P. Casali,
R.L. Wilder, and
A.L. Notkins.
1988.
Monoreactive high affinity and polyreactive low affinity rheumatoid factors are produced by CD5+ B cells from patients
with rheumatoid arthritis.
J. Exp. Med.
168:
1979-1992
|
| 7. |
Sidman, C.L.,
L.D. Shultz,
R.R. Hardy,
K. Hayakawa, and
L.A. Herzenberg.
1986.
Production of immunoglobulin isotypes by Ly-1+ B cells in viable motheaten and normal mice.
Science (Wash. DC).
232:
1423-1425
|
| 8. |
Kroese, F.G.M.,
E.C. Butcher,
A.M. Stall,
P.A. Lalor,
S. Adams, and
L.A. Herzenberg.
1989.
Many of the IgA producing
plasma cells in murine gut are derived from self-replenishing
precursors in the peritoneal cavity.
Intl. Immunol.
1:
75-84
|
| 9. | Braun, J., Y. Citri, D. Baltimore, F. Forouzanpour, L. King, K. Teheranizadeh, M. Bray, and S. Kliewer. 1986. B-Ly1 cells: immortal Ly-1+ B lymphocyte cell lines spontaneously arising in murine splenic cultures. Immunol. Rev. 93: 5-28 [Medline]. |
| 10. | Rothstein, T.L., and D.L. Kolber. 1988. Peritoneal B cells respond to phorbol esters in the absence of co-mitogen. J. Immunol. 140: 2880-2885 [Abstract]. |
| 11. | Rothstein, T.L., and D.L. Kolber. 1988. Anti-Ig antibody inhibits the phorbol ester-induced stimulation of peritoneal B cells. J. Immunol. 141: 4089-4093 [Abstract]. |
| 12. |
Darnell, J.E.,
Jr,
I.M. Kerr, and
G.M. Stark.
1994.
Jak-STAT
pathways and transcriptional activation in response to IFNs
and other extracellular signaling proteins.
Science (Wash. DC).
264:
1415-1421
|
| 13. | Schindler, C., and J.E. Darnell Jr.. 1995. Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu. Rev. Biochem. 64: 621-651 [Medline]. |
| 14. | Ihle, J.N.. 1995. Cytokine receptor signaling. Nature (Lond.). 377: 591-594 [Medline]. |
| 15. | Shuai, K., C.M. Horvarth, L.H. Tsai-Huang, S.A. Quereshi, D. Cowburn, and J.E. Darnell Jr.. 1994. Interferon activation of the transcription factor stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell. 76: 821-828 [Medline]. |
| 16. |
Karras, J.G.,
Z. Wang,
S.J. Coniglio,
D.A. Frank, and
T.L. Rothstein.
1996.
Antigen receptor engagement in B cells induces nuclear expression of STAT5 and STAT6 proteins that
bind and transactivate an IFN- activation site.
J. Immunol.
157:
39-47
[Abstract].
|
| 17. |
Migone, T-S.,
J-X. Lin,
A. Cereseto,
J.C. Mulloy,
J.J. O'Shea,
G. Franchini, and
W.J. Leonard.
1995.
Constitutively activated Jak-STAT pathway in T cells transformed
with HTLV-I.
Science (Wash. DC).
269:
79-81
|
| 18. |
Yu, C-L.,
D.J. Meyer,
G.S. Campbell,
A.C. Larner,
C. Carter-Su,
J. Schwartz, and
R. Jove.
1995.
Enhanced DNAbinding activity of a Stat3-related protein in cells transformed
by the Src oncoprotein.
Science (Wash. DC).
269:
81-83
|
| 19. | Hilbert, D.M., T.-S. Migone, M. Kopf, W.J. Leonard, and S. Rudikoff. 1996. Distinct tumorigenic potential of abl and raf in B cell neoplasia: abl activates the IL-6 signaling pathway. Immunity. 5: 81-89 [Medline]. |
| 20. | Cao, X., A. Tay, G.R. Guy, and Y.H. Tan. 1996. Activation and association of STAT3 with Src in v-Src-transformed cell lines. Mol. Cell. Biol. 16: 1595-1603 [Abstract]. |
| 21. |
Morris, D.L., and
T.L. Rothstein.
1993.
Abnormal transcription factor induction through the surface immunoglobulin M
receptor of B-1 lymphocytes.
J. Exp. Med.
177:
857-861
|
| 22. |
Liu, J.,
T.C. Chiles,
R. Sen, and
T.L. Rothstein.
1991.
Inducible nuclear expression of NF- B in primary B cells stimulated through the surface Ig receptor.
J. Immunol.
146:
1685-1691
[Abstract].
|
| 23. | Bradford, M.M.. 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-257 [Medline]. |
| 24. |
Sadowski, H.B.,
K. Shuai,
J.E. Darnell Jr., and
M.Z. Gilman.
1993.
A common nuclear signal transduction pathway activated by growth factor and cytokine receptors.
Science (Wash.
DC).
261:
1739-1744
|
| 25. |
Francis, D.A.,
J.G. Karras,
X. Ke,
R. Sen, and
T.L. Rothstein.
1995.
Induction of the transcription factors NF- B,
AP-1 and NF-AT during B cell stimulation through the
CD40 receptor.
Int. Immunol.
7:
151-161
|
| 26. |
Frank, D.A.,
M.J. Robertson,
A. Bonni,
J. Ritz, and
M.E. Greenberg.
1995.
Interleukin 2 signaling involves the phosphorylation of Stat proteins.
Proc. Natl. Acad. Sci. USA.
92:
7779-7783
|
| 27. | Wagner, B.J., T.E. Hayes, C.J. Hoban, and B.H. Cochran. 1990. The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO (Eur. Mol. Biol. Organ.) J. 9: 4477-4484 [Medline]. |
| 28. |
Ruff-Jamison, S.,
K. Chen, and
S. Cohen.
1993.
Induction
by EGF and interferon- of tyrosine-phosphorylated DNA
binding proteins in mouse liver nuclei.
Science (Wash. DC).
261:
1733-1736
|
| 29. |
Zhong, Z.,
Z. Wen, and
J.E. Darnell Jr..
1994.
Stat3 and
Stat4: members of the family of signal transducers and activators of transcription.
Proc. Natl. Acad. Sci. USA.
91:
4806-4810
|
| 30. | Rothman, P., B. Kreider, M. Azam, D. Levy, U. Wegenka, A. Eilers, T. Decker, F. Horn, H. Kashleva, J. Ihle, and C. Schindler. 1994. Cytokines and growth factors signal through tyrosine phosphorylation of a family of related transcription factors. Immunity. 1: 457-468 [Medline]. |
| 31. |
Bonni, A.,
D.A. Frank,
C. Schindler, and
M.E. Greenberg.
1993.
Characterization of a pathway for ciliary neurotrophic
factor signaling to the nucleus.
Science (Wash. DC).
262:
1575-1579
|
| 32. |
Zhang, X.,
J. Blenis,
H-C Li,
C. Schindler, and
S. ChenKiang.
1995.
Requirement of serine phosphorylation for formation of STAT-promoter complexes.
Science (Wash. DC).
267:
1990-1994
|
| 33. | Akira, S., Y. Nishio, M. Inoue, X.-J. Wang, S. Wei, T. Matsusaka, K. Yoshida, T. Sudo, M. Naruto, and T. Kishimoto. 1994. Molecular cloning of APRF, a novel IFN-stimulated gene factor 3 p91-related transcription factor involved in the gp130mediated signaling pathway. Cell. 77: 63-71 [Medline]. |
| 34. |
Wegenka, U.M.,
C. Lutticken,
J. Buschmann,
J. Yuan,
F. Lottspeich,
W. Muller-Esterl,
C. Schindler,
E. Roeb,
P.C. Heinrich, and
F. Horn.
1994.
The interleukin-6-activated
acute-phase response factor is antigenically and functionally
related to members of the signal transducer and activator of
transcription (STAT) family.
Mol. Cell. Biol.
14:
3186-3196
|
| 35. | Karras, J.G., L. Huo, Z. Wang, D.A. Frank, J.M. Zimmet, and T.L. Rothstein. 1996. Delayed tyrosine phosphorylation and nuclear expression of STAT1 following antigen receptor stimulation of B lymphocytes. J. Immunol. 157: 2299-2308 [Abstract]. |
| 36. | Wen, Z., Z. Zhong, and J.E. Darnell Jr.. 1995. Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell. 82: 241-250 [Medline]. |
| 37. | Wicker, L.S., R.C. Boltz, V. Matt, E.A. Nichols, L.B. Peterson, and N.H. Sigal. 1990. Suppression of B cell activation by cyclosporin A, FK506 and rapamycin. Eur. J. Immunol. 20: 2277-2283 [Medline]. |
| 38. | Kunz, J., and M.N. Hall. 1993. Cyclosporin A, FK506 and rapamycin: more than just immunosuppression. Trends Biochem. Sci. 18: 334-338 [Medline]. |
| 39. |
Ying-zi, C.,
E. Rabin, and
H.H. Wortis.
1991.
Treatment of
murine CD5 B cells with anti-Ig, but not LPS, induces surface CD5: two B cell activation pathways.
Intl. Immunol.
3:
467-476
|
| 40. | Rothstein, T.L., D.L. Kolber, T.P. Murphy, and D.P. Cohen. 1991. Induction of phorbol ester responsiveness in conventional B cells after activation via surface Ig. J. Immunol. 147: 3728-3735 [Abstract]. |
| 41. | Wang, Z., D.L. Morris, and T.L. Rothstein. 1995. Constitutive and inducible levels of egr-1 and c-myc early growth response gene expression in B-1 lymphocytes. Cell. Immunol. 162: 309-314 [Medline]. |
| 42. | Herzenberg, L.A., and A.B. Kantor. 1993. B cell lineages exist in the mouse. Immunol. Today. 14: 79-83 [Medline]. |
| 43. | Haughton, G., L.W. Arnold, A.C. Whitmore, and S.H. Clarke. 1993. B-1 cells are made, not born. Immunol. Today. 14: 84-87 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|