|
||
Articles |



Basel Institute for Immunology, CH-4005 Basel, Switzerland
| Abstract |
|---|
|
|
|---|
5 gene. All three strains express human CD25 in parallel to endogenous
5 on pre–B cells, but not on mature B lymphocytes or other blood cell lineages. High expression of human CD25 on B lineage cells of transgenic mice has allowed the identification of a new B220+CD19–
5+ precursor of the B220+CD19+
5+ c-kit+ pre-BI cells. Both types of precursors are clonable on stromal cells in the presence of interleukin-7. The CD19– precursors have a sizeable part of their immunoglobulin heavy chain gene loci in germline configuration, while the CD19+ pre–BI cells are predominantly DJH rearranged. The results indicate that random integration of the 722-bp 5' region of the
5 gene into the mouse genome confers tissue and differentiation stage–specific expression of a transgene.
Two genes, VpreB and
Differentially regulated gene expression has allowed to define, and separate by FACS®, B lymphocyte lineage subpopulations in mouse bone marrow (BM). Hardy et al. (6) have used the surface antigens heat stable antigen (HSA), BP-1 and leukosialin (CD43) to separate B220 (CD45R)+ pre–B cell populations from immature IgM+ and mature IgM+/IgD+ B cells. An analysis of the expression of VpreB,
Rolink et al. ordered B220+ B lineage subpopulations in mouse BM by the analysis of the expression of c-kit, CD25, and surrogate L chain (8) and by a single cell PCR analysis of the IgH and L chain loci (9). Rolink et al. (10) then used the differential expression of B220+ and CD19 to define a B220+ CD19– cell population in BM, which could further be subdivided into three subpopulations, a NK1.1+ precursor population of NK cells, a CD4+ population of unknown function, and a marker-negative population. These cell populations are probably largely identical with Hardy's fraction A, since they were found to be CD43+, HSAlow, BP-1–. The marker negative CD19– B220+ cells were suspected to contain some early B lineage progenitors, since stromal cell/IL-7–reactive cells could be found in low frequencies (10).
In this paper we describe the generation of nine transgenic mouse lines in which the gene for the
The purified 3.2-kb SalI/XhoI fragment was microinjected into (C57Bl/6 x DBA/2)F2 zygotes as described (12). Transgenic lines were maintained in pathogen-free conditions and backcrossed for three generations to C57Bl/6 mice. All experiments were done with transgenic hemizygotes and their wild-type littermates between 4 and 8 wk of age. For the determination of transgene copy numbers DNA isolated from tails was analyzed by slot and Southern blot using the hu-CD25 cDNA and β-actin as probes.
Antibodies, Flow Cytometric Analysis, and Cell Sorting.
Single cell suspensions from BM were prepared by flushing out cells from femurs with either ice-cold staining buffer (PBS containing 2% FCS and 0.1% NaN3) or tissue culture medium (IMDM, 2% FCS). Cells were incubated with a combination of FITC-, PE-, biotin- or allophycocyanin-conjugated antibodies in staining buffer, washed with staining buffer, incubated for 15 min with PE-streptavidin (Southern Biotechnology Associates) to reveal the biotin reagent, and finally washed with staining buffer. Cells were analyzed on a FACScan® instrument (Becton Dickinson, Mountain View, CA). In double staining experiments propidium iodide was included in the staining buffer (1 µg/ml) to gate out dead cells. Cells present in the extended lymphocyte gate (low side scatter) were gated. Cell sorting was performed on a FACStar Plus® instrument. For the sorting of rare populations such as the B220+CD19– fractions in BM, a two step sorting protocol was used to obtain maximum purity. During the first sorting, the instrument was set on enrichment mode. The purity after the first round was generally >85%. After the second sorting of the enriched cells, the purity was generally >96% when reanalyzed with the instrument settings used for the sort.
Pre–B Cell Culture System.
Limiting Dilution Analysis of Pre–B Cells Growth.
Northern Blot Analysis.
Reverse Transcription–PCR.
PCR Analysis of IgH Gene Rearrangements.
5, encode the proteins that together make up the surrogate L chain (1, 2). Both genes are specifically expressed in precursor (pre)1–B cells, but not in immature and mature, surface Ig-positive B cells, nor in any other cell of mouse or human so far tested (for review see reference 3). The pre–B cell–specific control of
5 gene expression has been analyzed in some detail (4, 5). Deletion analysis of a 722-bp 5' region upstream of the
5 gene has defined two parts of the upstream region, A
5 and B
5 (4). A
5, 154 bp directly 5' of the
5 gene, functions as a basal promoter in different types of cells. B
5, 568 bp 5' of A
5, acts in concert with A
5 as a suppressor region in nonpre–B cells, but as an enhancer region on a heterologous promoter in pre–B cells (4, 5).
5, RAG-1 and RAG-2, TdT, mb-1 and bcl-2, and particularly the semiquantitation of DJH, VHDJH and V
J
rearranged Ig genes in populations of these B lineage cells have allowed Li et al. (7) to propose an order of development of the subpopulations. The earliest population, called fraction A, which is CD43+, HSA–, BP-1– has low, if at all detectable, expression of VpreB,
5, RAG-1 and RAG-2, TdT, and mb-1 and has low quantities of DJH rearranged IgH chain genes while VH(J558)DJH and V
J
rearranged Ig genes remained below detection limits.
chain of the human IL-2 receptor (human CD25; hu-CD25) is under the control of the 722-bp 5' region of the
5 gene (5'
5). In three of the lines the 5'
5 confers lineage and differentiation stage specific–expression of the hu-CD25 transgene in vivo.
![]()
Materials and Methods
Top
Abstract
Materials and Methods
Results
Discussion
References
Construction of the Transgene Vector, 5'
5–hu-CD25 and Production of Transgenic Mice.
5'
5 (4) was made by PCR (PCR 1) using the following primers: 5' primer: 5' ACGTCGACTTATATGTCACAGGCTGGCCTTGA 3', 3' primer: 5' CATCAGCAGGTATGAATCCATTGACCCTCAAGTCCAAAGTC 3'. The hu-CD25 cDNA was made by PCR (PCR 2) using the following primers: 5' primer: 5' CTTGAGGGTCAATGGATTCATACCTGCTGATG 3', 3' primer: 5' ACGGATCCCTAGATTGTTCTTCTACTCTTCCT 3'. The 5'
5 3' primer and the hu-CD25 5' primer contain overlapping sequences (underlined) to facilitate the third PCR. This (PCR 3) was made by using the 5'
5 5' primer together with the hu-CD25 3' primer and as template use a 1:1 mixture of PCR 1 and PCR 2. The 5'
5 5' primer contained a SalI site and the hu-CD25 3' primer contained a BamHI site and some extra bases for protection of the respective restriction site. The PCR product (PCR 3) was cloned into the vector pSPex23pA as a SalI/BamHI fragment. The pSPex23pA vector contains human β-globin exon 2, intron 2, exon 3, and polyA site (1.6-kb SalI/PstI fragment) from the vector pHSE3' (11) inserted into pSP73 (Promega Corp., Madison, WI) lacking a BamHI site. The final 5'
5–hu-CD25 vector contained in 5' to 3' order the following: 5'
5 as promoter/enhancer, human CD25 cDNA, human β-globin exon 2, intron 2, exon 3, and polyA site. This 3.2-kb SalI/XhoI fragment was purified and used for injections.
The rat mAb ACK-4 (anti–mouse c-kit; provided by Dr. S. Nishikawa, Kyoto University, Kyoto, Japan; reference 13) the rat anti–mouse IgD mAb NIM-R9; (provided by Dr. R. Parkhouse; reference 14) and the rat anti–mouse CD19 mAb 1D3 (10) were conjugated with biotin using standard procedures. The following rat mAbs were purchased from PharMingen (San Diego, CA) PE- and allophycocyanin-conjugated RA-6B2 (CD45R, B220), biotinylated 7D4 (anti–mouse CD25, TAC), PE-conjugated RM4-5 (anti– mouse CD4), PE-conjugated PK186 (anti–mouse NK1.1), and FITC- and PE-conjugated M-A251 (anti–human CD25). FITCconjugated goat anti–mouse IgM (µ chain specific) was obtained from Southern Biotechnology Associates (Birmingham, AL).
Pre-B cell lines were established from fetal livers of individual day 17 embryos from pregnant transgenic mice. The pre-B cell lines and clones were cultivated as described (15). In brief, pre–B cells were cultured on a semiconfluent layer of
-irradiated (30 Gy) ST-2 stromal cells (16) in IMDM containing 100 µg/ml kanamycin, 5 x 10–5 M 2-mercaptoethanol, 2% heat-inactivated FCS (GIBCO BRL, Gaithersburg, MD) and 100 U/ml IL-7. Culture supernatant of J558L cells transfected with the murine IL-7 cDNA in the BMG neo vector was used as a source of IL-7 (17). When stable pre–B cell lines were established, the cells were transduced with a retrovirus containing the mouse bcl-2 gene (a gift from Dr. M. Busslinger, Research Institute of Molecular Pathology, Vienna, Austria) and transduced cells were selected with 3 µg/ml puromycin on puromycin-resistant ST-2 cells. For the induction of differentiation of bcl-2 transfected pre–B cells, cells were harvested, washed three times in medium without IL-7, and cultured on a semi-confluent layer of
-irradiated ST-2 stromal cells in medium without IL-7.
Cell suspensions from FACS® sorted cells were diluted by serial twofold dilutions in medium with IL-7 and were plated on a semi-confluent layer of
-irradiated (30 Gy) ST-2 cells in 96-well flat-bottom plates. Cultures were scored on day 7 for pre–B cell colonies containing >50 cells, using an inverted microscope. On several occasions, the contents of individual wells with lymphoid colonies were removed and analyzed for B220 and CD19 expression by FACS®. In all cases, the cells uniformly expressed B220 and CD19.
Total cellular RNA was prepared using RNAzol B (Biotecx Laboratories, Inc., Houston, TX) according to the manufacturer's recommendations and analyzed as described (18). The complete cDNA of the hu-CD25 was used as a probe for the detection of hu-CD25 RNA.
RNA extraction, cDNA synthesis, and reverse transcription (RT)-PCR was done exactly as described (19). The following primer-pairs were used: hypoxanthine phosphoribosyl transferase (HPRT): 5' GCTGGTGAAAAG GACCTCT 3', 5' CACAGGACTAGAACACCTGC 3';
5: 5' GAGATCTAGACTGCAAGTGAGGCTAGAG 3', 5' CTTGGGCTGACCTAGGATTG 3'; hu-CD25/β-globin: 5 AGACCAGTCAGTTTCCAGGTGAA 3', 5' AAGCGAGCTTAGTGATACTTGTG 3'. All PCRs were carried out with 1 cycle 94°C for 40 s, followed by 30 cycles at 94°C for 20 s, 55°C for 15 s, and 72°C for 60 s. The probes specific for the HPRT,
5, and hu-CD25 genes were generated by cloning PCR fragments into pBluescript and were used for PCR–Southern blot analysis.
DJH rearrangements of the H chain locus were amplified and detected using PCR as outlined in Fig. 4. Two forward primers binding immediately upstream of DFL/DSP elements or the DQ52 element, respectively, were used in a mixture (DFS and DQ52 as described in reference 20) together with one reverse primer binding downstream of JH4 (JH4A in reference 16). In germline configuration, the DQ52 and JH4A primers will amplify the 2.15-kb germline fragment. DJH1, DJH2, DJH3, and DJH4 rearrangements involving either DFL, DSP, or DQ52 elements will be detected by the emergence of bands of 1.46, 1.15, 0.73, and 0.20 kb, respectively.
|
| Results |
|---|
|
|
|---|
5 upstream regulatory region (4) was inserted upstream of the hu-CD25 cDNA (21) and introduced as a transgene into the germline of mice. Cells from BM and spleen of nine founder strains carrying the transgene were analyzed by FACS® for hu-CD25 expression. Three of the nine strains were found to express surface hu-CD25. As determined by Southern and slot blot analyses (Table 1), transgene copy numbers varied between 10 and 30 in expressing and between 4 and 400 in nonexpressing strains. This indicates that expression of hu-CD25 was most likely influenced by integration sites.
|
0.5% of spleen cells which expressed very low levels of hu-CD25 were found to be IgM+IgD– immature B cells (data not shown). Most hu-CD25 positive BM cells expressed the B cell markers CD19 and CD45R (B220; Fig. 1 A, and data not shown). RT-PCR analysis of BM, spleen, liver, muscle, and heart readily detected huCD25 RNA in the BM and low levels in the spleen but no signal was found in the nonlymphoid samples, while the HPRT control primers detected HPRT RNA in all organs (Fig. 1 B). Thus, the 5'
5 control region contains lineage– and differentiation stage–specific promoter/enhancer activity.
|
|
5 gene. Fig. 2 shows the analyses of the expressor strains 82 and 83 in which cells expressing CD19 and a second marker were gated and the levels of hu-CD25 analyzed. Strain 73 showed virtually identical expression levels of transgenic hu-CD25 to strain 82 (data not shown). Strain 83 displayed
5–10-fold lower levels when compared with the other two strains. While strains 82 and 73 both contained about 30 transgene copies, strain 83 contained about 10 copies. In BM cells from line 82 and 73, high levels of hu-CD25 were found on c-kit+ pre–BI cells, intermediate levels were found on mouse CD25+ large pre– BII cells, low expression on mouse CD25+ small pre–BII cells, while very little or no expression was detected on immature (IgM+IgD–) and mature (IgM+IgD+) B lymphocytes. Expression of hu-CD25 protein correlated with transgenic RNA steady state levels were determined by RT-PCR analysis; high levels of transgenic RNA were detected in pre–BI cells, intermediate and low levels in large and small pre–BII cells, respectively, and very little or no transgenic RNA was detected in immature and mature B cells (not shown). Parallel analysis of endogenous
5 gene transcript levels demonstrated that
5 was expressed in a similar fashion, in agreement with previous analyses (19), with the exception that slightly lower relative amounts were detected in the later differentiation stages as compared to transgenic hu-CD25 RNA. Thus, in general, the expression of huCD25 protein and RNA correlated with that of endogenous
5. Both the endogenous
5 gene and the 5'
5-controlled transgene generate transcripts which are expressed in pre–BI cells and begin to be downregulated as these cells differentiate into pre–BII cells.
|
5 protein (as detected by the LM34 antibody; reference 23) and high levels of hu-CD25, but no detectable IgM on the cell surface. Withdrawal of IL-7 and analysis 1, 2, and 3 d thereafter demonstrated that the level of CD19 expression remained constant while the surface expression of
5 and hu-CD25 decreased with time. In addition,
10% of the cells started to express IgM on the cell surface at day 3 of differentiation. Furthermore, Northern blot analysis of these differentiating cells showed that the RNA steady state levels of hu-CD25 and
5 decreased with time of differentiation (Fig. 3 B). Disappearance of hu-CD25 paralleled the disappearance of
5 RNA (Fig. 3 B). Again, these results indicate that the hu-CD25 transgene, like endogenous
5, is expressed in pre–BI cells. Expression of the endogenous
5 and hu-CD25 transgene is downregulated as these pre–BI cells differentiate in vitro to sIgM+ immature B cells.
|
5–hu-CD25 transgenic mice the B220+ CD19– hu-CD25+ cells did not express NK1.1, or CD4 (Fig. 4), and are therefore found within the marker-negative subpopulation. This marker-negative hu-CD25+ subpopulation comprises 10–15% of all B220+CD19–NK1.1– CD4– cells (Fig. 4), i.e., 0.1–0.3% of all BM cells.
The marker-negative subpopulation was sorted into huCD25+ and hu-CD25– cells and analyzed for other markers, in particular for the expression of endogenous
5. RTPCR analysis shown in Fig. 5 A revealed that these cells, like CD19+ pre–BI cells coexpressed hu-CD25 and endogenous
5, whereas hu-CD25– sorted cells from the same B220+CD19– population contained no detectable
5 or hu-CD25 message. The B220+CD19+ hu-CD25+ cells also expressed VpreB, sterile µ H chain, RAG-1, RAG-2, and B29 transcripts (data not shown). PCR analysis of the H chain gene loci of the B220+CD19– hu-CD25+ cells revealed that a sizeable fraction of all loci were still in germline configuration while the rest of these loci were DJH rearranged (Fig. 5 B, lane 3). VHDJH rearranged loci could not be detected (data not shown). In CD19+ c-kit+ pre–BI cells (lane 2) the H chain gene loci were found to be mostly DJH rearranged in agreement with previous analyses (9).
|
5– BM cells might not belong to the B lineage. These conclusions were further supported by an analysis of the proliferation and differentiation potential of these early B220+CD19– cell populations. Limiting dilution analyses on stromal cells in the presence of IL-7 (15) showed that the CD19+ hu-CD25high pre–BI cells (1 in 12) as well as the B220+CD19– hu-CD25+ B lineage precursors (1 in 15) contained a similarly high frequency of clonable cells (Fig. 5 C). This frequency of clonable cells in the B220+ CD19–NK1.1–CD4– hu-CD25+ cell population is, therefore,
10-fold higher than the frequency found previously by Rolink et al. (10) in the total B220+CD19–NK1.1– CD4– population. We therefore conclude that the huCD25 reporter transgene is preferentially expressed in early clonable B lineage precursors before the expression of CD19. It should be noted that in comparison to the pre–BI– derived colonies, the B220+CD19– hu-CD25+–derived colonies were larger in size and contained more cells. After 7 d in tissue culture, the CD19– hu-CD25+ precursors became CD19 positive and the cells could be induced to differentiate to IgM+ immature B cells upon removal of IL-7 from the cultures (data not shown). The B220+CD19– hu-CD25– cells showed 20–30-fold lower frequency of clonable lymphoid cells in the above mentioned culture system (Fig. 5 C).
Collectively, these results show that the high expression of the transgenic hu-CD25 on the surface of BM cells has allowed the isolation and characterization of an early B lineage cell population that is likely to be precursors of pre–BI cells.
| Discussion |
|---|
|
|
|---|
chain of the human IL-2 receptor (CD25) under the control of the 722-bp 5' regulatory region of the
5 gene. The 5'
5 regulatory region, consisting of A
5 and B
5, conveys lineage and differentiation stage specificity to the expression of the transgenic reporter gene, hu-CD25. This expression pattern in vivo confirms and extends previous results from the analysis of various cell lines representing different stages of B cell development (4, 5). In the previous experiments, however, a heterologous enhancer was used in the reporter gene constructs in addition to the 5'
5 regulatory region to obtain measurable levels of reporter gene expression. We show here that the short stretch of the 722-bp 5' regulatory region contains the essential cis-acting regulatory elements for lineage and differentiation stage specific expression. Our experiments do not provide any evidence for the need of additional enhancer elements for this specific expression. It will now be possible to study the function of the 5'
5 regulatory region in greater detail.
It appears that the copy number of transgenes inserted into the mouse genome is not important for the specificity of expression. Furthermore, insertion of the transgene at different sites in the genome only determines the level, and not the specificity, of expression. These results indicate that it will be possible to express other transgenes in a pre–B cell–specific fashion without inserting them at the
5 locus by homologous recombination.
Lineage- and tissue-specific expression conferred by a short 5' region has also been reported for other genes. Among the earliest genes analyzed in this context was the rat insulin gene in which the 700-bp 5' region was shown to drive the expression of the simian virus 40 large T antigen in β cells of the pancreas, and the transgenic mice developed β cell tumors (24). The insulin 5' region has subsequently been used to direct β cell–specific expression of many genes. The insulin enhancer within these 700 bp, in the context of its own promoter, confers gene expression only in β cells, while in the presence of a heterologous promoter, the same enhancer is not as restricted and allows expression in the brain also (25). Another example is the 620-bp proximal promoter of the lck gene. It was shown to allow expression in thymocytes, but not in peripheral T cells, in agreement with lck proximal promoter driven transcription in T cell development (26), though the defined differentiation stages in the thymus were not analyzed.
Perhaps the most widely used system expressing a transgene within the lymphoid system takes advantage of the well characterized IgH intron enhancer (Eµ) (27–29), either in combination with an Ig promoter or with a heterologous promoter. Such combinations allow expression not only in B, but also in T lymphocytes. Since Eµ seems to overrule the specificity of even a locus control region (30), it appears not suited for transgene expression if a more narrow window of expression is preferred.
In general, expression of the hu-CD25 transgene paralleled that of the endogenous
5 gene. In c-kit+ pre–BI cells and in large pre–BII cells,
5 and transgene expression was highest. In these differentiation stages, using currently available reagents,
5 protein is detectable either in the cytoplasm (8) or on the cell surface (31). Small differences can be seen in the small pre–BII/immature B cell compartments. The data shown in Fig. 2 indicate that the huCD25 is expressed as protein in small pre–BII cells, and at even lower levels in immature B cells in two of the three founder lines. Endogenous
5 protein was not detectable at the later differentiation stages and
5 mRNA was reduced about 20–30-fold when compared to pre–BI cells (reference 19 and unpublished observation). The hu-CD25 transgene contains human β-globin sequences which might prolong mRNA half-life as compared to endogenous
5 and, hence, protein synthesis. In addition, hu-CD25 protein might be more resistant than
5 to degradation which again could contribute to prolonged expression of hu-CD25 in differentiating B lineage cells in BM.
The easily detectable expression of the transgenic huCD25 protein on the surface of cells has permitted the identification of a CD19–B220+ hu-CD25+ cell population in the BM that are NK1.1– and CD4–. These novel cells were also found to express endogenous
5, and as a population, to contain cells that have started to rearrange their IgH gene loci. A high proportion of these CD19– B220+ hu-CD25+ cells are clonable on stromal cells in the presence of IL-7. In fact, the frequency of clonable cells is as high as in the CD19+B220+ hu-CD25high c-kit+ pre–BI cell population. Given that the plating efficiency in these cultures is not 100% (32), the actual frequencies may be even higher. At present it can not be completely ruled out, however, that the CD19–B220+ hu-CD25+ cell population, which represents about 5% of all CD19–B220+ in the BM of transgenic mice, is nevertheless heterogeneous. The finding that the CD19– hu-CD25+ population contains much more of the IgH loci in germline configuration argues that the CD19– hu-CD25+ cells are the precursors of the CD19+ pre–BI cells. Our results agree with previous analyses of the configuration of IgH and L chain loci undertaken by Li et al. (7) for Hardy's fraction A of mouse BM, and suggest that the DJH rearranged IgH chain loci found by these authors are contributed by B220+CD19– NK1.1–CD4– cells, now further marked by the hu-CD25 reporter transgene.
To date, it is clear that cells expressing CD19 are committed to the B cell lineage. However, stages of hemopoiesis before B cell commitment are poorly understood. The hu-CD25 transgenic mice described in this paper may help to further characterize these early stages of B lineage development and commitment. In addition, they may help further in elucidating the early arrests in B cell development observed in mutant mice defective for, e.g., E2A (33, 34) or EBF (35).
| Acknowledgments |
|---|
This work was supported in part by the Swedish Medical Research Council, the Medical Faculty Lund, the Kungliga Fysiografiska Society, the Österlunds, the Kocks, the Crafoords, and the G. Danielssons Foundations (I.-L. Mårtensson). The Basel Institute for Immunology was founded and is supported by F. Hoffmann-La Roche Ltd. (Basel, Switzerland).
Submitted: 9 September 1996
Revised: 2 December 1996
| References |
|---|
|
|
|---|
1 Sakaguchi N & Melchers F. Lambda 5, a new light-chain–related locus selectively expressed in pre-B lymphocytes, Nature (Lond), 1986, 324, 579–582.[Medline]
2 Kudo A & Melchers F. A second gene, VpreB in the lambda 5 locus of the mouse, which appears to be selectively expressed in pre–B lymphocytes, EMBO (Eur Mol Biol Organ) J, 1987, 6, 2267–2272.[Medline]
3 Melchers F, Karasuyama H, Haasner D, Bauer S, Kudo A, Sakaguchi N, Jameson B & Rolink A. The surrogate light chain in B-cell development, Immunol Today, 1993, 14, 60–68.[Medline]
4 Martensson I-L & Melchers F. Pre-B cell specific
5 gene expression due to suppression in non pre–B cells, Int Immunol, 1994, 6, 863–872.
5 Yang J, Glozak MA & Blomberg BB. Identification and localization of a developmentally stage-specific promoter activity from the murine lambda 5 gene, J Immunol, 1995, 155, 2498–2514.[Abstract]
6 Hardy RR, Carmack CE, Shinton SA, Kemp JD & Hayakawa K. Resolution and characterization of proB and pre–pro-B cell stages in normal mouse bone marrow, J Exp Med, 1991, 173, 1213–1225.
7 Li YS, Hayakawa K & Hardy RR. The regulated expression of B lineage associated genes during B cell differentiation in bone marrow and fetal liver, J Exp Med, 1993, 178, 951–960.
8 Rolink A, Grawunder U, Winkler TH, Karasuyama H & Melchers F. IL-2 receptor
chain (CD25, TAC) expression defines a crucial stage in pre–B cell development, Int Immunol, 1994, 6, 1257–1264.
9 ten Boekel E, Melchers F & Rolink A. The status of Ig loci rearrangements in single cells from different stages of B cell development, Int Immunol, 1995, 7, 1013–1019.
10 Rolink A, ten Boekel E, Melchers F, Fearon DT, Krop I & Andersson J. A subpopulation of B220+cells in murine bone marrow does not express CD19 and contains natural killer cell progenitors, J Exp Med, 1996, 183, 187–194.
11 Pircher H, Mak TW, Lang R, Ballhausen W, Rüedi E, Hengartner H, Zinkernagel RM & Bürki K. T cell tolerance to Mlsa encoded antigens in T cell receptor Vβ8.1 chain transgenic mice, EMBO (Eur Mol Biol Organ) J, 1989, 8, 719–727.[Medline]
12 Bucchini D, Reynaud CA, Ripoche MA, Grimal H, Jami J & Weill JC. Rearrangement of a chicken immunoglobulin gene occurs in the lymphoid lineage of transgenic mice, Nature (Lond), 1987, 326, 409–411.[Medline]
13 Ogawa M, Matsuzaki Y, Nishikawa S, Hayashi SI, Kunisada T, Sudo T, Kina T, Nakauchi H & Nishikawa SI. Expression and function of c-kit in hemopoietic precursor cells, J Exp Med, 1991, 174, 63–71.
14 Parkhouse RME, Preece G, Sutton R, Cordell JL & Mason DY. Relative expression of surface IgM, IgD and the Ig-associating
(mb-1) and β (B-29) polypeptide chains, Immunology, 1992, 76, 535–540.[Medline]
15 Rolink A, Kudo A, Karasuyama H, Kikuchi Y & Melchers F. Long-term proliferating early pre B cell lines and clones with the potential to develop to surface Ig-positive, mitogen reactive B cells in vitro and in vivo, EMBO (Eur Mol Biol Organ) J, 1991, 10, 327–336.[Medline]
16 Ogawa M, Nishikawa S, Ikuta K, Yamamura F, Naito M, Takahashi K & Nishikawa SI. B cell ontogeny in murine embryo studied by a culture system with the monolayer of a stromal cell clone, ST-2: B cell progenitor develops first in the embryonal body rather than in the yolk sac, EMBO (Eur Mol Biol Organ) J, 1988, 7, 1337–1343.[Medline]
17 Karasuyama H & Melchers F. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4 or 5, using a modified cDNA expression vectors, Eur J Immunol, 1988, 18, 97–104.[Medline]
18 Grawunder U, Melchers F & Rolink A. Interferon-
arrests proliferation and causes apoptosis in stromal cell/interleukin-7–dependent normal murine pre–B cell lines and clones in vitro, but does not induce differentiation to surface immunoglobulin-positive B cells, Eur J Immunol, 1993, 23, 544–551.[Medline]
19 Grawunder U, Leu TMJ, Schatz DG, Werner A, Rolink AG, Melchers F & Winkler TH. Downregulation of RAG1 and RAG2 gene expression in preB cells after functional immunoglobulin heavy chain rearrangement, Immunity, 1995, 3, 601–608.[Medline]
20 Ehlich A, Martin V, Müller W & Rajewsky K. Analysis of the B-cell progenitor compartment at the level of single cells, Curr Biol, 1994, 4, 573–593.[Medline]
21 Leonard WJ, Depper JM, Crabtree GR, Rudikoff S, Pumphrey J, Robb RJ, Krönke M, Svetlik PB, Peffer NJ, Waldmann TA & Greene WC. Molecular cloning and expression of cDNAs for the human interleukin-2 receptor, Nature (Lond), 1984, 311, 626–631.[Medline]
22 Nishi M, Ishida Y & Honjo T. Expression of functional interleukin-2 receptors in human light chain/Tac transgenic mice, Nature (Lond), 1988, 331, 267–269.[Medline]
23 Karasuyama H, Rolink A & Melchers F. A complex of glycoproteins is associated with VpreB/lambda 5 surrogate light chain on the surface of µ heavy chain–negative early precursor B cell lines, J Exp Med, 1993, 178, 469–478.
24 Hanahan D. Heritable formation of pancreatic β-cell tumours in transgenic mice expressing the recombinant insulin/simian virus 40 oncogenes, Nature (Lond), 1985, 315, 115–122.[Medline]
25 Dandoy-Dron F, Itier J-M, Monthioux E, Bucchini D & Jami J. Tissue-specific expression of a rat insulin 1 gene in vivo requires both the enhancer and the promotor regions, Differentiation, 1995, 58, 291–295.[Medline]
26 Allen JM, Forbush KA & Perlmutter RM. Functional dissection of the lck promotor, Mol Cell Biol, 1992, 12, 2758–2768.
27 Neuberger MS. Expression and regulation of immunoglobulin heavy chain gene transfected into lymphoid cells, EMBO (Eur Mol Biol Organ) J, 1983, 2, 1373–1378.[Medline]
28 Gillies SD, Morrison SL, Oi VT & Tonegawa S. A tissue-specific transcription enhancer element is located in the major intron of a rearranged immunoglobulin heavy chain gene, Cell, 1983, 33, 717–728.[Medline]
29 Banerji J, Olson L & Schaffner W. A lymphocytespecific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes, Cell, 1983, 33, 729–740.[Medline]
30 Elliot JI, Festenstein R, Tolaini M & Kioussis D. Random activation of a transgene under the control of a hybrid hCD2 locus control region/Ig enhancer regulatory element, EMBO (Eur Mol Biol Organ) J, 1995, 14, 575–584.[Medline]
31 Winkler TH, Rolink A, Melchers F & Karasuyama H. Precursor B cells of mouse bone marrow express two different complexes with the surrogate light chain on the surface, Eur J Immunol, 1995, 25, 446–450.[Medline]
32 Rolink A, Haasner D, Nishikawa S & Melchers F. Changes in frequencies of clonable pre B cells during life in different lymphoid organs of mice, Blood, 1993, 81, 2290–2300.
33 Bain G, Maandag EC, Izon DJ, Amsen D, Kruisbeek AM, Weintraub BC, Krop I, Schlissel MS, Feeney AJ, van-Roon M et al.. E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements, Cell, 1994, 79, 885–892.[Medline]
34 Zhuang Y, Soriano P & Weintraub H. The helixloop-helix gene E2A is required for B cell formation, Cell, 1994, 79, 875–884.[Medline]
35 Lin H & Grosschedl R. Failure of B-cell differentiation in mice lacking the transcription factor EBF, Nature (Lond), 1995, 376, 263–267.[Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|