|
||
Is Essential for Destruction of
Cells and
Development of Insulin-dependent Diabetes Mellitus
By
From The Scripps Research Institute, Division of Virology, Department of Neuropharmacology, La Jolla, California 92037
Autoimmune mediated destruction of
cells of the islets of Langerhans leads to insulin-dependent diabetes mellitus (IDDM). Rat insulin promoter (RIP) lymphocytic choriomeningitis virus (LCMV) transgenic mice that express the nucleoprotein (NP) or glycoprotein (GP) of
LCMV under control of the RIP in their
cells develop IDDM after infection with LCMV
and serve as a model for virus-induced IDDM. Recently, Kagi et al. (Kagi, D., B. Odermatt, P. Ohashi, R.M. Zinkernagel, and H. Hengartner. 1996. J. Exp. Med. 183:2143-2149) showed,
using RIP LCMV perforin-deficient mice, that IDDM does not occur in the absence of perforin. They concluded that perforin-mediated killing by cytotoxic T lymphocytes (CTLs) is
the main factor needed for
cell injury and destruction. Here we provide evidence that killing
of
cells is more complex and multifactorial. By the use of our RIP LCMV model, we show that in perforin competent but interferon-
(IFN-
)-deficient mice,
cell injury is limited and
IDDM does not occur. For these studies, double transgenic mice were generated that were genetically deficient in the production of IFN-
and express LCMV NP or GP in their
cells. In
such mice, IDDM was aborted despite the generation of LCMV-specific antiself CTLs that displayed normal cytolytic activity in vitro and in vivo and entered the pancreas. However, mononuclear infiltration into the islets did not occur, and upregulation of class I and II molecules usually found in islets of RIP LCMV single transgenic mice after LCMV infection preceding the onset of clinical IDDM was not present in these bigenic mice. Our findings indicate
that in addition to perforin,
cell destruction, development of insulitis, and IDDM also depend on the cytokine INF-
, presumably through enhancement of major histocompatibility
complex expression and antigen presentation.
Destruction of the insulin-producing We and others have created transgenic (tg) mouse models to dissect the role(s) played by various components of the
immune system leading to IDDM (6, 8, 25). tg mice expressing a viral ("self") nucleoprotein (NP) or glycoprotein
(GP) gene of lymphocytic choriomeningitis virus (LCMV) in
pancreatic RIP LCMV transgenic mice that express the viral transgene in the pancreas and in the thymus delete high affinity,
but not low affinity, antiself CTLs and, as a consequence,
develop slow-onset IDDM that depends on both CD4+
and CD8+ lymphocytes (25, 27). In contrast, RIP-LCMV
transgenic mice that express the viral antigen only in the
pancreas, develop a rapid-onset IDDM (2 wk) that depends
solely on the action of antiself CD8+ CTL.
CTL have been implicated as effector cells in other models of IDDM and in human IDDM. For example, studies
with nonobese diabetic (NOD) mice showed that IDDM
can be transferred by CD8+ T cells (28, 29). More recently
it has been proposed that specific MHC-restricted killing of
We questioned whether cytokines, especially IFN- Transgenic Mouse Lines.
Generation and characterization of RIP
LCMV tg mice with rapid (8-14 d)- or slow-onset (1-6 mo)
IDDM after LCMV infection has been described (25). For rapid
onset we chose the RIP GP 34-20 (H-2b) tg line as a prototype.
These mice express the viral transgene in the pancreas, but not in
the thymus. For the slow-onset IDDM paradigm, the RIP NP
25-3 (H-2d) tg line was selected. RIP NP 25-3 mice express the
viral NP in both the pancreas and the thymus, but do not express
it in any other tissues (25).
cells located in
the islets of Langerhans leads to insulin-dependent diabetes mellitus (IDDM)1 (1). Host genes, T cell autoimmune responses (4), cytokines (5) and viruses (2, 6) have been
implicated in the initiation and progression of this disease
(8). Immune responses including autoimmune reactions
are believed to be regulated by a balance of Th1 (inflammatory) and Th2 (regulatory) cytokines (5, 15). IFN-
is a
Th1-type cytokine that plays an intricate role in antiviral host defense mechanisms, activation of CTLs, and enhancement of inflammatory reactions (18). Expression of IFN-
under control of the rat insulin promoter (RIP) in transgenic mice leads to MHC upregulation, inflammation, and
IDDM (11, 22). When expressed in
cells of transgenic
mice together with viral antigen, it leads to spontaneous development of autoimmune diabetes with generation of antiself (viral) CTLs in the absence of viral challenge (12).
cells under control of the RIP fail to develop
IDDM spontaneously (defined as hyperglycemia, hypoinsulinemia, mononuclear infiltration into and destruction of
the islets of Langerhans) even over a 15-mo observation
period (6). However, these mice are not tolerant to the
transgene. First, peripheral lymphocytes from these transgenic mice can be primed in vitro to generate primary antiLCMV CTLs after incubation with Drosophila cells expressing MHC class I molecules and the appropriate LCMV
peptide (26). Second, upon infection with LCMV, >95%
develop IDDM due to the generation of an antiviral (antiself) CD8+ CTL response. Studies including adoptive transfer of CD8+ cells recovered from islets, immunochemical
depletion, and use of CD8 knockout mice indicate that
these effector CTL are responsible for initiating the process
leading to selective and progressive damage of pancreatic
cells and IDDM (6, 25).
cells could be the initiating event for IDDM (14), and
glutaric acid decarboxylase and insulin-specific CTLs were
isolated from NOD mice (30, 31). CTLs kill target cells by
a MHC-restricted mechanism involving the recognition of
specific peptides presented to the TCR by MHC class I
glycoproteins. Killing is mediated by the release of cytotoxic granules containing perforin (32, 33) or by the perforin-independent FAS pathway (35). Recently, Kagi et al.
showed that killing of
-cells by CTLs is dependent on the
release of perforin, since RIP LCMV transgenic mice with
a disrupted perforin gene were unable to develop IDDM after LCMV infection (34).
,
might also play a role in
cell destruction and IDDM. To
explore the role of IFN-
, we generated tg mice that expressed the LCMV viral ("self") transgene in
cells in the
islets of Langerhans and were either competent or genetically deficient in the production of IFN-
(RIP LCMV
IFN-
+/+ or
/
mice). This allowed us to determine whether
cells can be directly destroyed by antiself CTLs
in the absence of IFN-
. Here we report that despite the
generation of high or low affinity autoreactive CTLs, IDDM
did not occur in IFN-
deficient RIP LCMV transgenic
mice. Antiself (viral) CTLs trafficked to the pancreas and
were found around the islets. However, neither infiltration
into the islets nor upregulation of MHC class I or class II
molecules occurred. We conclude that IFN-
is a key factor required for the induction and maintenance of the autoimmune destruction of
cells in the islets of Langerhans that leads to IDDM.
gene were generated by T. Stewart and his colleagues (23) by replacing the normal IFN-
allele in mouse embryonic stem cells with a defective allele. C57Bl/6 (H-2b) and BALB/c (H-2d) IFN-
-deficient mice were
obtained from Genentech Inc. (South San Francisco, CA). Mice
homozygous for the mutation in the IFN-
gene (IFN-
-deficient or
/
mice) were housed in specific, pathogen-free conditions, were healthy, fertile, had normal life spans, and did not
spontaneously develop IDDM.
-deficient were obtained by crossing
IFN-
-deficient mice with RIP LCMV tg mice, and then backcrossing the LCMV-positive littermates from the F1 generation,
which are heterozygous for the IFN-
gene mutation to IFN
-deficient mice. As a result, IFN-
-deficient (
/
) and IFN-
(+/+) mice were obtained that did or did not express LCMV
proteins in their pancreas. These mice were used in experimental and control groups. For further studies, the LCMV positive F1 littermates from the first mating were backcrossed for five generations to the RIP LCMV (IFN-
+/+) background and the resulting LCMV-positive littermates that were heterozygous for
IFN-
were intercrossed once to generate RIP LCMV IFN-
/
and +/
, or +/+ mice for use in experiments. This backcross was necessary to ensure that no IDDM-protective genes
were linked to the IFN-
/
genetic background.
Biochemical Studies.
Transgenic mice were identified by hybridization of DNA extracted from tail biopsies using an LCMV
NP- or GP-specific probe (6). RNA was extracted from PBL and
organs (thymus, brain, liver, muscle) by the Guanidinium-Isothiocyanate method (25) for analysis. Before PCR analysis, RNA
was treated with RNAse-free RQ1 DNAse to eliminate contaminating the DNA. The reverse transcriptase-PCR was carried out
for 40 cycles. LCMV NP-specific primers used were: 5
CAG
TTA TAG GTG CTC TTC CGC 3
and 5
AGA TCT GGG
AGC CTT GCT TTG 3
. Heterozygosity or homozogosity for
the IFN-
knockout defect was also tested for by PCR. The wildtype IFN-
gene was detected using primers AGAAGTAAGTGGAAGGGCCCAGAAG and AGGGAAACTGGGAGAGGAGAAATAT that resulted in a 220-bp product while the mutant
gene was detected with primers TCAGCGCAGGGGCGCCCGGTTCTTT and ATCGACAAGACCGGCTTCCATCCGA that
defined a 190-bp product (23, 25).
Virus. The virus used was LCMV Armstrong (ARM), clone 53b. Its origin, quantitation by plaquing, sequence, and biological properties have been described (36).
CTL Assay. CTL activity was recorded in a 5-6 h in vitro 51Cr release assay (6, 25, 39). Samples were run in triplicate and variance was <10%. To judge CTL activity, uninfected or infected targets with either LCMV ARM (multiplicity of infection 1), vaccinia virus expressing LCMV NP, or LCMV GP (multiplicity of infection 3) were used. Target cells were H-2b (MC57) or H-2d (BALB Cl7) fibroblasts. Lymphocytes were obtained from spleens of 8-12-wk-old mice either not inoculated or given 2 × 103 PFU of LCMV ARM intraperitoneally 7 d earlier. Single-cell suspensions were made and used at 50:1, 25:1, and 12:1 effector/ target ratios. H-2b- and H-2d- restricted LCMV-specific CTL clones (42) were used at effector/target ratios of 10:1, 5:1, and 1:1. Other secondary CTL lines and clones were generated and cloned by limiting dilution (42). For coating with peptides, target cells were preincubated with the respective peptide at 50 µg/well for 30 min before starting the 4-5 h incubation for the 51Cr release assay.
Recovery of CTL from Pancreas. CTLs were isolated from the pancreas as described (26). Briefly, pancreatic tissues obtained from tg mice were freed from fat and other tissues, digested with collagenase, and lymphoid cells were recovered by centrifugation through a ficoll-hypaque gradient.
Analysis of IDDM. IDDM was defined by hyperglycemia (blood glucose > 300 mg/dl), low levels of pancreatic insulin (<10 µg of insulin/mg of pancreas), and presence of a mononuclear cell infiltration in the islets. Blood samples were obtained from the retroorbital plexus of mice at weekly or monthly intervals. Amount of glucose in the blood was determined using Accucheck II strips (Boehringer Mannheim, Indianapolis, IN). Normal blood glucose for age- and sex-matched control was mean ±1 SE (20-40 mice/ group) 145 ± 7. Insulin concentration in the pancreas was determined by radioimmune assay (6) and normal levels of insulin were 40 µg/mg ± 12. Absence or presence of mononuclear cells in the islets was studied in tissues fixed in 10% zinc formalin, mounted in paraffin, and stained with hematoxylin and eosin (25).
Immunohistochemical Analyses of Tissues. Tissues were quick frozen in O.C.T. compound, 6-10-µm cryomicrotome sections obtained, fixed for 1 min in 1% paraformaldehyde, washed in PBS, and incubated with avidin/biotin to remove nonspecific binding. Primary antibodies consisting of rat anti-mouse CD4 (clone RM 4-5), anti-CD8 (clone 53-6.7), anti-B220 (clone RA3 6B2), antiF4/80 (clone A3-1), anti-MAC-1 (clone M 1/70), anti-class I (clone M 1/42), and anti-class II (clone M5/114), (PharMingen, San Diego, CA and Boehringer Mannheim) were applied for 1 h. After washing, secondary antibody [biotinylated goat anti-rat (or anti-mouse) IgG (Vector Laboratories, Inc., Burlingham, CA)] was added for 1 h. Color reaction was obtained with avidin-peroxidase conjugate (Boehringer Mannheim) and diaminobenzidine in the presence of H2O2 (43).
ELISA Assay for IFN-
.
Sandwich ELISA assays for IFN-
production were carried out as recommended by PharMingen (San
Diego, CA), who also provided matched pairs of capture and detection antibodies. Tissue culture supernatants tested in the ELISA
were harvested after 3 d in vitro culture of 105 splenocytes obtained 7 d after LCMV infection and cultured in 10% RPMI containing 10
5 M LCMV NP H-2d CTL peptide (RPQASGVYM).
-deficient tg mice generate
antiself (virus) CTLs After Infection with LCMV.
As shown
in Table 1, RIP LCMV transgenic mice with a competent
or dysfunctional IFN-
gene generated good levels of
H-2b- or H-2d-restricted primary CTLs after LCMV infection. Note that, as reported previously (25), RIP NP mice
who express the viral transgene in the thymus have a specific reduction in their LCMV NP-specific CTL activities
due to negative thymic selection of high affinity CTLs.
CTL activity, however, is not completely aborted, since low
affinity CTLs escape the negative selection process and are found in the periphery (6, 27). Affinity was assessed by using log dilutions of LCMV NP peptide H-2d-restricted
aa118-126 (RPQASGVYM) to coat target cells in the CTL
assay (Table 1). These low affinity CTLs are able to induce slow-onset IDDM in single tg RIP NP mice (6). RIP GP
tg mice used as a model for fast-onset IDDM do not express the transgene in the thymus and generate high affinity
primary CTLs in the presence and absence of IFN-
after
LCMV infection (Table 1).
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
, Virus-induced Diabetes Does Not
Occur in RIP LCMV tg Mice.
IDDM did not occur in
RIP GP or NP 25-3 single tg mice unless they were challenged with LCMV ARM (Fig. 1). Fig. 1 also shows that
2-8 wk after receiving 1 × 105 PFU of LCMV intraperitoneally, most IFN-
-competent RIP GP (fast-onset IDDM)
or NP (slow-onset IDDM) single tg mice develop IDDM.
In contrast, virus-inoculated double tg mice (10 mice/group)
that were deficient in IFN-
production did not develop
IDDM over a 5-8-mo observation period. Thus, virus induced IDDM does not occur in the absence of IFN-
, regardless of the affinity of the generated antiself (viral) CTLs.
-
deficient or -competent tg mice.
Blood glucose levels were measured at 2-wk intervals as described
in Materials and Methods, 10 mice per group were analyzed.
LCMV-treated mice were challenged with 2 × 103 PFU
LCMV intraperitoneally.
Incidence of IDDM was reduced and delayed in RIP
LCMV IFN-
(+/
) mice. To ensure that the lack of
IDDM in the absence of IFN-
was not due to the effect
of a potential protective gene linked to the IFN-
(
/
)
background, the experiment was repeated using tg mice
that were backcrossed to the RIP LCMV (IFN-
+/+) background for five generations (see Materials and Methods section for breeding scheme). This backcross for five
generations makes an IDDM-protective effect conferred by
genes accidentally linked to the IFN-
(
/
) mutation
statistically unlikely (44). Fig. 1 shows that even after the
backcross, the incidence of IDDM in IFN-
(+/
) RIP
LCMV littermates was still reduced. These findings made
the influence of an IDDM-protective gene linked to the
IFN-
knockout genotype not likely. To address the possibility that an IFN-
gene dose related effect influenced the
kinetics of IDDM, we compared the levels of IFN-
produced by lymphocytes from RIP LCMV × IFN-
(+/+),
(+/
), and (
/
) littermates. The results indicated that
the lower incidence of IDDM observed in RIP LCMV IFN-
(+/
) littermates is due to a relatively lower
amount of IFN-
production. Levels of IFN-
detected in
the supernatant of splenocytes harvested 7 d after LCMV
infection and stimulated for 3 d in the presence of LCMV
H-2d (NP) peptide were 2000 ± 400 U/ml for IFN-
(+/+), 700 ± 320 U/ml for IFN-
(+/
), and nondetectable for IFN-
(
/
) littermates.
-deficient or Competent tg Mice.
Immunohistochemical analysis of islets from RIP LCMV × IFN-
-deficient
or -competent tg mice was carried out 45 d after infection with LCMV. Results are shown in Fig. 2. In the absence of
IFN-
, insulitis was markedly reduced (Fig. 2, C versus B).
IFN-
-deficient mice failed to show infiltration into the islets, while islets from IFN-
-competent RIP LCMV mice
showed insulitis and destruction of most
cells. Further,
CD8+ CTLs were found in infiltrates of single tg RIP
LCMV IFN-
-competent mice as expected (Fig. 2 E, 25).
In contrast, CTL were absent in islets of IFN-
-deficient
mice, but were found in the pancreas or around the islets
(Table 2; Fig. 2 I). Thus, despite generation of antiviral
CTLs (Table 1) that can enter the pancreas,
cells were
not destroyed in IFN-
-deficient mice. CTLs were seen
passing through the pancreas, but were not retained in, or
infiltrated into, the islets (Fig. 2 F). Lastly, MHC class I
(Fig. 2, H and I) expression was upregulated in inflammatory islet lesions and on
cells of RIP LCMV tg mice (Fig.
2 H). In contrast, upregulation of class I (Fig. 2 I) molecules
did not occur in IFN-
-deficient RIP LCMV mice and
cells remained intact. As shown in Fig. 2, A, D, and G,
these events were not observed in non-tg mice infected with LCMV. Further studies showed that expression of
MHC class II that is usually elevated in islets of tg mice
with IDDM, was not detected in islets of IFN-
(
/
)
mice (data not shown).
-deficient or -competent tg mice. Immunohistochemical staining of consecutive 5-6 micron sections of islets was carried out as described in Materials and Methods. At least three
different areas were surveyed per mouse. 10 mice were studied from each experimental group. Representative sections are shown that were similar for
each mouse in that particular group. Sections shown were processed and stained at the same time. Original magnification is 200. Panels A-F indicate tg
mouse strain, time after infection, and staining method applied.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-deficient RIP LCMV tg Mice have less LCMV-specific Memory CTLs in the Pancreas than their IFN-
-Competent
Littermates.
Levels of LCMV-specific memory CTLs were
quantitated in RIP LCMV IFN-
-competent or -deficient
mice. The results are shown in Table 2. Normal and IFN
-deficient mice or RIP LCMV tg IFN-
-competent or
-deficient mice generated nearly equivalent amounts of
LCMV-specific memory CTLs in their spleens (precursor
frequency average 1/1,500). However, fewer LCMV-specific CTLs were detected in the pancreas of RIP LCMV
IFN-
-deficient mice that had not developed IDDM compared to LCMV-specific CTLs recovered from pancreas of
IFN-
-competent RIP LCMV mice that had developed
IDDM (Table 2).
The major finding documented here is that injury to
cells mediated by CTLs does not occur in the absence of
IFN-
(Fig. 1). Further, IFN-
is not required for the generation of LCMV-specific CTLs (Table 1) and killing of
target cells in vitro, and clearance of acute LCMV infection
in vivo can occur in the absence of IFN-
(21). Thus,
CTLs generated in IFN-
-deficient mice can lyse target
cells in vitro, clear virus infections in vivo, and enter the
pancreas in vivo (Fig. 2). A likely mechanism for the ablation of the autoimmune process and the failure of IDDM
to occur in the absence of IFN-
is the insufficient upregulation of MHC class I molecules on
cells and class II molecules on APCs, but not a defect in CTL generation or
function. As a consequence, there is a lack of antigen presentation and functional CTLs are not retained in the islets.
These findings provide a clear rationale for suppressing inflammatory cytokine levels like IFN-
locally in the islets
as a treatment of IDDM.
IFN-
is a key cytokine produced by activated CTLs. It
is involved in the upregulation of MHC molecules and in
antiviral host defense (21, 45). Recent data show that
IFN-
knockout mice generate LCMV-specific primary
and memory CTLs with equivalent activities as found in
non-tg littermates (21). The generation of LCMV-specific
primary CTLs in IFN-
-deficient mice terminates an acute
LCMV viral infection (21). However, when memory CTLs from IFN-
knockout mice are adoptively transferred into
persistently infected recipients, they are unable to clear the
virus showing that, while IFN-
is not required for CTL
activity in vitro or control of acute infection in vivo, it is
required for viral clearance of a persistent infection by
CTLs in vivo (22, 45, 46). The role IFN-
plays in IDDM
is likely mediated by the upregulation of MHC molecules
on
cells and APCs in the islets. First, upregulation of
MHC class I glycoproteins is a frequent marker during the
development of IDDM (11, 26). Second, IDDM does not
occur in the absence of MHC class I expression on
cells
(25). For example, expression of the adenoviral E3 gene
complex can prevent MHC class I trafficking to the cell
surface. When the E3 complex is co-expressed with LCMV
proteins under the RIP in
cells, upregulation of MHC
class I Db molecules is suppressed specifically and IDDM is
prevented (von Herrath, M., S. Efrat, M. Oldstone, and M. Horwitz, manuscript submitted for publication). However,
upregulation of MHC expression itself in the absence of a
specific (viral) trigger or in the absence of autoreactive CTLs
is not sufficient for the development of IDDM (43). Further, APCs expressing MHC class II are not found in islets
of RIP LCMV IFN-
(
/
) mice (data not shown) indicating that the lack of IFN-
also results in a loss of infiltration by APCs that are required to propagate the autoimmune process leading to IDDM.
IFN-
could also contribute to the autoimmune process
in the pancreas by "bystander" activation of autoreactive
CTLs and other inflammatory cells (48). The recovery of
lower numbers of antiself (viral) CTLs from the pancreas of
IFN-
-deficient RIP LCMV mice 60 d after infection
(Table 2) suggests that this may also occur. Hence, both
upregulation of MHC molecules and "bystander" activation may be needed for IDDM to develop.
Recently, Kagi et al. reported that IDDM did not occur
in perforin-deficient RIP LCMV transgenic mice and concluded that
cell destruction was predominantly a consequence of perforin-mediated lysis by antiself (viral) CTLs
(34). In this model, virus-induced MHC class I restricted
CTLs are the key factor for the induction of IDDM. Diabetes does not occur in the absence of MHC class I expression on
cells (25) or the absence of CD8+ CTLs (8, 25).
Both our own (Tishon, T., and M.B.A. Oldstone, unpublished data) and other results (49) indicate that while perforincompetent CTLs are required to lyse target cells in vitro, they are unable to destroy
cells in vivo in the absence of
IFN-
to cause IDDM (Fig. 1). Thus, the cytokine IFN-
plays an important role in the pathogenesis of IDDM and
without it, IDDM does not occur, even after an 8-mo observation period. Kagi et al (34) reported infiltration and
retention of CD8+ lymphocytes in the islets was observed
in the absence of perforin although IDDM did not occur
over the 2-mo observation period after LCMV infection.
Whether IDDM could have occurred at later times in the absence of perforin and in the presence of IFN-
is unknown.
It has been reported (24) that IDDM is delayed, but not
aborted, in NOD mice in the absence of IFN-
. A likely
reason why IDDM occurs in IFN-
-deficient NOD mice,
but fails to occur in the RIP LCMV tg model, is that NOD
mice are usually genetically prone to spontaneously develop IDDM (50). They express genes that convey susceptibility to IDDM, and it is likely that their
cells are more
sensitive to destruction. By contrast the RIP LCMV tg
mice do not spontaneously develop diabetes (6), even after
a 2-yr observation period (Tishon, T., and M.B.A. Oldstone, unpublished data).
From our data, it is unlikely that the lack of IDDM in
IFN-
(
/
) and the lower incidence of IDDM in IFN-
(+/
) mice is due to an IDDM-protective gene linked to
the IFN-
(
/
) mutation for several reasons. First, similar kinetics of IDDM are observed in all groups of mice independent of whether F-1 backcrosses to IFN-
(
/
)
background or F-5 backcrosses to the RIP LCMV background are used (Fig. 1). Second, recent work by Krakowski et al. (51) demonstrated a protective effect of the
IFN-
(+/+) genotype for experimental allergic encephalitis (EAE), whereas the encephalitis was enhanced on the
IFN-
(
/
) background. Such findings were not mirrored in our report. Finally, and most importantly, we find
less IFN-
production by splenocytes from IFN-
(+/
)
compared to IFN-
(+/+) splenocytes. This finding correlates with the lower incidence of IDDM in IFN-
(+/
)
mice and suggests a quantitative gene-dosage effect in IFN-
production as the explanation for the different incidence of
IDDM observed in RIP LCMV IFN-
(+/+) and (+/
)
mice.
In conclusion, a multifactorial process leads to IDDM
and autoimmune destruction of
cells. The development
of insulitis involves a cascade of events. Generation of antiself islet-antigen-specific CTLs, a functional perforin pathway, the presence of IFN-
, upregulation of MHC class I
on
cells, and likely the presence of CD4 lymphocytes are
required. Identification of the factors involved will suggest the strategies that can be applied to hinder or prevent the
autoimmune process from continuing and hopefully prevent IDDM.
Address correspondence to Dr. Matthias G. von Herrath, Division of Virology, Department of Neuropharmacology, The Scripps Research Institute, 10550 N. Torrey Pines Road, La Jolla, CA 92037.
Received for publication 27 August 1996
This work was supported by United States Public Health Service grant AG04342 to M.B.A. Oldstone and National Institutes of Health grant DK995005 and a Career Development Award of the Juvenile Diabetes Foundation International to Matthias G. von Herrath.The authors thank Diana Frye for assistance with the manuscript.
| 1. | Baekkeskov, S., and B. Hansen. 1990. Human diabetes. Curr. Top. Microbiol. Immunol. 164: 1-198 . |
| 2. |
Gamble, D.R..
1980.
The epidemiology of insulin-dependent
diabetes with particular reference to the relationship of virus
infection to its etiology.
Epidemiol. Rev.
2:
49-70
|
| 3. |
Bach, J.F..
1994.
IDDM as an autoimmune disease.
Endocr.
Rev.
15:
516-532
|
| 4. | Tisch, R., X.-D. Yang, S.M. Singer, R.S. Liblau, L. Fugger, and H.O. McDevitt. 1993. Immune response to glutamic acid decarboxylase correlates with insulitis in non-obese diabetic mice. Nature (Lond.). 366: 72-75 [Medline] . |
| 5. | Shehadeh, N., F. La, Rosa, and K. Lafferty. 1993. Altered cytokine activity in adjuvant inhibition of autoimmune diabetes. J. Autoimmun. 6: 291-300 [Medline] . |
| 6. | Oldstone, M.B.A., M. Nerenberg, P. Southern, J. Price, and H. Lewicki. 1991. Virus infection triggers insulin-dependent diabetes mellitus in a transgenic model: role of the anti-self (virus) immune response. Cell. 65: 319-331 [Medline] . |
| 7. | Allison, J., L. Malcolm, N. Chosich, and J.F.A.P. Miller. 1992. Inflammation but not autoimmunity occurs in transgenic mice expressing constitutive levels of interleukin-2 in islet beta-cells. Eur. J. Immunol. 22: 1115-1121 [Medline] . |
| 8. | Ohashi, P., S. Oehen, P. Aichele, H. Pircher, B. Odermatt, P. Herrera, Y. Higuchi, K. Buerki, H. Hengartner, and R.M. Zinkernagel. 1993. Induction of diabetes is influenced by the infectious virus and local expression of MHC class I and tumor necrosis factor alpha. J. Immunol. 150: 5185-5194 [Abstract] . |
| 9. | Campbell, I., T. Kay, L. Oxbrow, and L.C. Harrison. 1991. Essential role for interferon-gamma and interleukin-6 in autoimmune insulin dependent diabetes in NOD/Wehi mice. J. Clin. Invest. 87: 739-742 . |
| 10. | Campbell, I., and L.C. Harrison. 1990. Molecular pathology of type I diabetes. Mol. Biol. Med. 7: 299-309 [Medline] . |
| 11. |
Sarvetnick, N.,
J. Shizuru,
D. Liggitt,
L. Martin,
B. McIntyre,
A. Gregory,
T. Parslow, and
T. Stewart.
1990.
Loss of
pancreatic islet tolerance induced by -cell expression of interferon- .
Nature (Lond.).
346:
844-847
[Medline]
.
|
| 12. |
Lee, M.S.,
M.G. von Herrath,
H. Reiser,
M.B.A. Oldstone, and
N. Sarvetnick.
1995.
Sensitization to self (virus) antigen by in situ
expression of murine interferon- .
J. Clin. Invest.
95:
486-92
.
|
| 13. | Lee, M-S., L. Wogensen, J. Shirzuru, M.B.A. Oldstone, and N. Sarvetnick. 1994. Pancreatic islet production of murine interleukin-10 does not inhibit immune-mediated tissue destruction. J. Clin. Invest. 93: 1332-1338 . |
| 14. | Nagata, M., K. Yokono, M. Hayakawa, Y. Kawase, N. Hatamori, W. Ogawa, K. Yonezawa, K. Shii, and S. Baba. 1989. Destruction of pancreatic islet cells by cytotoxic T lymphocytes in nonobese diabetic mice. J. Immunol. 143: 1155-1162 [Abstract] . |
| 15. | Fitch, F.W., M. McKisic, D. Lancki, and T. Gajewski. 1993. Differential regulation of murine T-lymphocyte subsets. Annu. Rev. Immunol. 11: 29-48 [Medline] . |
| 16. | O'Garra, A., and M. Kenneth. 1994. Role of cytokines in determining T-lymphocyte function. Curr. Opin. Immunol. 6: 458-466 [Medline] . |
| 17. | Modlin, R., and T.B. Nutman. 1993. Type 2 cytokines and negative immune regulation in human infections. Curr. Opin. Immunol. 5: 511-517 [Medline] . |
| 18. |
Bogen, S.,
I. Fogelmann, and
A. Abbas.
1993.
Analysis of IL-2,
IL-4, and IFN- producing cells in situ during immune responses to protein antigens.
J. Immunol.
150:
4197-4205
[Abstract]
.
|
| 19. |
Flynn, J.L.,
J. Chan,
K. Riebold,
D. Dalton,
T. Stewart, and
B. Bloom.
1993.
An essential role for interferon- in resistance to mycobacterium tuberculosis infection.
J. Exp. Med.
178:
2249-2254
|
| 20. |
Graham, M.B.,
D. Dalton,
D. Giltinan,
V. Braciale,
T. Stewart, and
T. Braciale.
1993.
Response to influenza infection in
mice with a targeted disruption of the interferon gene.
J.
Exp. Med.
178:
1725-1732
|
| 21. |
Tishon, T.,
H. Lewicki,
G. Rall,
M.G. von Herrath, and
M.B.A. Oldstone.
1995.
An essential role for type I interferon- in terminating persistent viral infection.
Virology.
212:
244-250
[Medline]
.
|
| 22. | Sarvetnick, N., D. Liggitt, S.L. Pitts, S.E. Hansen, and T.A. Stewart. 1988. Insulin-dependent diabetes mellitus induced in transgenic mice by ecotopic expression of class II MHC and interferon-gamma. Cell. 52: 773-782 [Medline] . |
| 23. |
Dalton, D.,
S. Pitts-Meek,
S. Keshav,
I. Figari,
A. Bradley, and
T. Stewart.
1993.
Multiple defects of immune cell function in mice with disrupted interferon- genes.
Science (Wash.
DC).
259:
1739-1743
|
| 24. |
Hultgren, B.,
X. Huang,
N. Dybdal, and
T. Stewart.
1996.
Genetic absence of -interferon delays but does not prevent
diabetes in NOD mice.
Diabetes.
45:
812-817
[Abstract]
.
|
| 25. | von Herrath, M.G., J. Dockter, H. Lewicki, and M.B.A. Oldstone. 1994. How virus induces a rapid and slow onset IDDM in a transgenic model. Immunity. 1: 231-242 [Medline] . |
| 26. |
von Herrath, M.G.,
S. Guerder,
H. Lewicki,
R. Flavell, and
M.B.A. Oldstone.
1995.
Coexpression of B7.1 and viral (self)
transgenes in pancreatic -cells can break peripheral ignorance and lead to spontaneous autoimmune diabetes.
Immunity.
3:
727-738
[Medline]
.
|
| 27. |
von Herrath, M.G.,
J. Dockter,
M. Nerenberg,
J. Gairin, and
M.B.A. Oldstone.
1994.
Selection and adaptability of CTL
responses in tg mice expressing a viral protein in the thymus.
J. Exp. Med.
180:
1901-1910
|
| 28. |
Wong, S.,
L. Wen,
I. Visintin,
R.A. Flavell, and
C. Janeway Jr..
1996.
CD8 cell clones from young nonobese diabetic (NOD)
islets can transfer rapid onset diabetes in NOD mice in the
absence of CD4 cells.
J. Exp. Med.
183:
67-76
|
| 29. |
Oldstone, M.B.A.,
P. Southern,
M. Rodriguez, and
P. Lampert.
1984.
Virus persists in -cells of islets of Langerhans and is associated with chemical manifestation of diabetes.
Science
(Wash. DC).
224:
1440-1443
|
| 30. | Wegmann, D., R. Gill, M. Glaser, N. Schloot, and D. Daniel. 1994. Analysis of the spontaneous T-cell response to insulin in NOD mice. J. Autoimmun. 7: 833-843 [Medline] . |
| 31. |
Hayakawa, M.,
K. Yokono,
M. Nagata,
N. Hatamori,
W. Ogawa,
A. Miki,
H. Mizoguit, and
S. Baba.
1991.
Morphological analysis of selective destruction of pancreatic -cell by
cytotoxic T lymphocytes in NOD mice.
Diabetes.
40:
1210-1217
[Abstract]
.
|
| 32. |
Kagi, D.,
F. Vignaux,
B. Ledermann,
K. Burki,
V. Depraetere,
S. Nagata,
H. Hengartner, and
P. Golstein.
1994.
Fas
and perforin pathways as major mechanisms of T cell-mediated cytotoxicity.
Science (Wash. DC).
265:
528-530
|
| 33. | Podack, E.R., H. Hengartner, and M.G. Lichtenheld. 1991. A central role of perforin in cytolysis? Annu. Rev. Immunol. 9: 129-157 [Medline] . |
| 34. |
Kagi, D.,
B. Odermatt,
P. Ohashi,
R.M. Zinkernagel, and
H. Hengartner.
1996.
Development of insulitis without diabetes
in transgenic mice lacking perforin dependent cytotoxicity.
J.
Exp. Med.
183:
2143-2149
|
| 35. | Lowin, B., M. Hahne, C. Mattmann, and J. Tschopp. 1994. Cytolytic T-cell cytotoxicity is mediated through perforin and Fas lytic pathways. Nature (Lond.). 370: 650-652 [Medline] . |
| 36. | Southern, P.J., M.K. Singh, Y. Riviere, D.R. Jacoby, M.J. Buchmeier, and M.B.A. Oldstone. 1987. Molecular characterization of the genome S RNA segment from lymphocytic choriomeningitis virus. Virology. 157: 145-155 [Medline] . |
| 37. |
Dutko, F.J., and
M.B.A. Oldstone.
1983.
Genomic and biological variation among commonly used lymphocytic choriomeningitis virus strains.
J. Gen. Virol.
64:
1689-1698
|
| 38. |
Gairin, J.E., and
M.B.A. Oldstone.
1993.
Virus and cytotoxic
T lymphocytes. 1. Crucial role of viral peptide secondary
structure in MHC class I interactions.
J. Virol.
67:
2903-2907
|
| 39. | Whitton, J.L., P.J. Southern, and M.B.A. Oldstone. 1988. Analysis of the CTL responses to glycoprotein and nucleoprotein components of LCMV. Virology. 162: 3211-3217 . |
| 40. |
Whitton, J.L.,
J.R. Gebhard,
H. Lewicki,
A. Tishon, and
M.B.A. Oldstone.
1988.
Molecular definition of a major cytotoxic T lymphocyte epitope in the glycoprotein of lymphocytic choriomeningitis virus.
J. Virol.
62:
687-695
|
| 41. | Whitton, J.L.. 1990. Lymphocytic choriomeningitis virus CTL. Semin. Virol. 1: 257-262 . |
| 42. | Lewicki, H., T. McKee, A. Tishon, M. Salvato, J.L. Whitton, and M.B.A. Oldstone. 1992. Novel H-2k restricted CTL clones recognize internal viral gene products and cause CNS disease. J. Neuroimmunol. 41: 15-20 [Medline] . |
| 43. |
von Herrath, M.G.,
J. Allison,
J.F.A.P. Miller, and
M.B.A. Oldstone.
1995.
Focal expression of interleukin-2 does not
break unresponsiveness to "self" (viral) antigen expressed in
cells but enhances development of autoimmune disease (diabetes) after initiation of an anti-self immune response.
J.
Clin. Invest.
95:
477-485
.
|
| 44. | Silver, L.M. 1995. Mouse Genetics. Oxford University Press, New York. 233-306. |
| 45. | Guidotti, L., T. Ishikawa, M. Hobbs, B. Matzke, R. Schreiber, and F.V. Chisari. 1996. Intracellular inactivation of HBV by CTL. Immunity. 4: 25-36 [Medline] . |
| 46. |
Guidotti, L.,
P. Borrow,
M. Hobbs,
B. Matzke,
I. Gresser,
M.B.A. Oldstone, and
F.V. Chisari.
1996.
Viral cross talk: intracellular inactivation of the HBV during an unrelated viral
infection of the liver.
Proc. Natl. Acad. Sci. USA.
93:
4589-4594
|
| 47. | Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethman, R. Kamijo, J. Vilcek, R.M. Zinkernagel, and M. Aguet.
1993. Immune responses in mice that lack the -IFN receptor. Science (Wash. DC). 1742-1748.
|
| 48. | Tough, D., P. Borrow, and J. Sprent. 1996. Induction of bystander T cell proliferation by viruses and type I interferon in vivo. Science (Wash. DC). 272: 1947-1950 [Abstract] . |
| 49. |
Walsh, C.M.,
M. Matloubian,
C.C. Liu,
R. Ueda,
M.T. Kurahag,
J.D. Young,
R. Ahmed, and
W.R. Clark.
1994.
Immune function in mice lacking the perfogene.
Proc. Natl.
Acad. Sci. USA.
91:
10854-10858
|
| 50. | Hanafusa, T., and S. Tarui. 1990. Immune pathogenesis of diabetes in the nonobese diabetic mouse: an overview. Curr. Top. Microbiol. Immunol. 156: 15-25 [Medline] . |
| 51. |
Krakowski, M., and
T. Owens.
1996.
Interferon- confers
resistance to experimental allergic encephalomyelitis.
Eur. J. Immunol.
26:
1641-1646
[Medline]
.
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|