|
|
|
|
|
|
|
||
2 Microglobulin (2m)
HLA-A2.1 Monochain Transgenic H-2Db 2m
Double Knockout Mice
By
From the * Institut Pasteur, Département SIDA-Rétrovirus, Unité d'Immunité Cellulaire Antivirale,
75724 Paris Cedex 15, France; and Gene Targeting Laboratory, Centre for Genome Research,
University of Edinburgh, Edinburgh EH9 3JQ, United Kingdom
Summary
Materials and Methods
Results
Discussion
Footnotes
Acknowledgements
References
Summary 
Three different HLA-A2.1 monochains were engineered in which either the human or mouse
2-microglobulin (2m) is covalently linked to the NH2 terminus of the heavy chain by a 15-
amino acid long peptide: HHH, entirely human, HHD, with the mouse H-2Db 
3, transmembrane, and cytoplasmic domains, and MHD, homologous to HHD but linked to the mouse 2mb.
The cell surface expression and immunological capacities of the three monochains were compared with transfected cells, and the selected HHD construct was introduced by transgenesis in
H-2Db
/ 2m/ double knockout mice. Expression of this monochain restores a sizable peripheral CD8+ T cell repertoire essentially educated on the transgenic human molecule. Consequently, infected HHD, H-2Db/ 2m/ mice generate only HLA-A2.1-restricted CD8+
CTL responses against influenza A and vaccinia viruses. Interestingly, the CTL response to influenza A virus is mostly, if not exclusively, directed to the 58-66 matrix peptide which is the
HLA-A2.1-restricted immunodominant epitope in humans. Such mice might constitute a versatile animal model for the study of HLA-A2.1-restricted CTL responses of vaccine interest.
Transgenic mice expressing unmodified HLA class I
molecules have been derived in many laboratories to
provide a suitable animal model for the study of HLA class
I-restricted CTL responses (1). Despite a few reported successes (2), these attempts have been relatively disappointing; when virus infected or stimulated by other HLA class I
alleles, these mice preferentially (most of the time exclusively) develop H-2-restricted CD8+ CTL responses (7).
Substitution of the HLA We report in vitro transfection experiments that resulted
in the selection of a human Materials and Methods Plasmids.
The 2.2-kb EcoRI-BglII fragment encompassing
the promoter and the three first exons from the HLA-A2.1 gene
(10) was subcloned in a modified BglII+ pBluescript (Stratagene,
La Jolla, CA) and site mutagenized to introduce a PstI site at the
33 by the homologous H-2 domain significantly improves the recognition and usage of some
(A2.1, B27), however not all (i.e., B7.1, our unpublished observation), HLA class I molecules (11, 12). Similarly, we and others have established that recognition and usage of
transgenic HLA class I molecules by mouse CD8+ T lymphocytes can be promoted when H-2-restricted responses
are controlled. More importantly, under such circumstances, a diversified V and V TCR mouse repertoire is
mobilized, suggesting a sufficient flexibility for an efficient
usage of human class I molecules (13, 14). However, the
experimental artifices (cross-tolerance, serial stimulations in
vitro with appropriate antigen presenting cells) selected to
favor the HLA-restricted CTL responses in transgenic mice
are not of convenient usage. Therefore, we have derived
mice expressing only HLA class I molecules to force the
mouse CD8+ T cell repertoire, both at the thymic and peripheral levels, to make use of the transgenic HLA class I
molecules. These mice are H-2Db and mouse 2 microglobulin (2m)1 double knockouts and express 2m-HLAA2.1 monochains.
2m-HLA-A2.1 (12)-H-2Db
(3 transmembrane cytoplasmic) (HHD) monochain construct to derive transgenic animals. These HHD transgenic,
H-2Db/ 2m/ double knockout mice are almost devoid of H-2 class I molecules. Phenotypic and functional
analyses of their peripheral CD8+ T cell repertoire indicate
that HHD monochains support thymic positive selection of
CD8+ CTL and activate virus-specific HLA-A2.1-restricted
CTL in the periphery.
end of the first exon and a BamHI site at the 5 end of the second exon (HLA-A2.1 PB plasmid). BamHI and MscI restriction
sites were introduced at the 5 and 3 ends of human 2m and
murine 2mb cDNA, respectively, corresponding to the mature
form (without leader sequence) of the proteins. A three-partner
ligation was performed between the 5 PstI (T4 polymerase blunt
ended), 3 BamHI-digested HLA-A2.1 PB plasmid, the 5 BamHI
(Klenow blunt ended), 3 MscI-digested human or murine 2m
cDNA, and a pair of complementary synthetic oligonucleotides
(Genset, Paris, France) coding for a (Gly4Ser)3 linker with 5 blunt
and 3 BamHI cohesive end. Final constructs were verified by
double-stranded DNA sequencing (Sequenase version 2.0; United
States Biochemical, Cleveland, OH). In the final recombinant plasmids, super-exon I codes for the HLA-A2.1 leader sequence, the
human or mouse 2m, a 15 amino acid linker, and the 1 domain of
HLA-A2.1. A 5.1-kb BglII-BamHI or a 2.3-kb BamHI fragment
containing the fourth to eighth exons and the 3 untranslated region of the HLA-A2.1 or H-2Db genes, respectively, was subsequently introduced in the BglII site of this construct. This provided
the entirely human HHH, human 2m-HLA-A2.1 (12) H-2Db
(3 to COOH terminus) HHD, and mouse 2mb-HLA-A2.1
(12) H-2Db (3 to COOH terminus) MHD coding plasmids.
fragment of the H-2Db gene in the BglII site of the HLA-A2.1
gene (in wild-type configuration) providing a chimeric (HLA-A2.1
12, H-2Db 3, transmembrane and cytoplasmic) heavy chain.
Cells and Transfectants.
RMA (transporter associated with antigen presentation [TAP] positive), RMA-S (TAP negative), EL4
(2m positive), and EL4 S3 Rob (2m negative) C57Bl/6 (H-2b)
lymphoma cells were maintained in RPMI, 10% FCS. Cells (5 × 107) in 500 µl of PBS were electroporated with 50 µg of plasmid
constructs and 1 µg of pMCS (15) linearized DNA at 250 V and
either 1,500 (RMA, RMA-S) or 1,050 (EL4, EL4 S3 Rob) µF
using an Easyject gene pulser (Eurogentec, Seraing, Belgium). After 24 h, cells were transferred in selective medium containing 1 mg/ml G418 (GIBCO BRL, Paislay, U.K.) and cloned by limiting dilution. Neomycin-resistant clones expressing the monochains
were identified by indirect immunofluorescence using unlabeled
B9.12.1 (anti-HLA class I, F(ab)2) and goat anti-mouse Ig (F(ab)2)
FITC-conjugated antibodies and analyzed by flow cytofluorometry with a FACScan® (Becton Dickinson, San Jose, CA).
Immunoprecipitations. Cells (5 × 106) were washed in methionine- and cystein-free RPMI medium (ICN Biomedicals, Inc., Costa Mesa, CA) supplemented with 10% dialyzed FCS and incubated for 45 min at 37°C in 1 ml of the same medium before labeling for 15 min with 1 mCi of [35S] methionine-cystein mix (Pro-mix; Amersham, Buckinghamshire, U.K.). Pelleted cells were lysed in PBS containing 1% BSA and 1% NP-40 (BDH Chemicals, Ltd., Poole, U.K.). Lysates were precleared (2 h, 4°C with protein A-Sepharose beads) and then incubated overnight at 4°C with 10 µg of purified anti-HLA-A2.1 (BB7.2) mAb. After addition of protein A-Sepharose beads and further incubation for 2 h at 4°C, beads were washed four times with 60 mM Tris HCl, pH 7.4, 150 mM NaCl, 0.5% deoxycholic acid, 5 mM EDTA, 1% NP-40, 0.1% SDS. Proteins were eluted, denatured, and separated by SDS-PAGE on 12% gels. Dryed gels were exposed on a Phosphorimager screen (Molecular Dynamics, Sunnyvale, CA) and analyzed using Imagequant program (Molecular Dynamics).
Generation of CTL and Cytolytic Assays.
HLA-A3 transgenic
C57Bl/6 mice were injected intraperitoneally with 3 × 107 HLAA2.1 × human 2m transgenic C57Bl/6 mouse splenocytes. 2 wk later, splenocytes (5 × 107) from immunized mice were restimulated in vitro with 3 × 107 irradiated (2,000 rads) HLA-A2.1 × human 2m transgenic splenocytes for 5 d. Human recombinant
IL-2 (Santa Cruz Biotechnology, Santa Cruz, CA) was added on
day 3 of culture.
6 M of influenza A matrix 58-66 synthetic peptide GILGFVFTL.
HHD+ H-2Db/ 2m/ mice were intraperitoneally infected
with either 1,000 hemagglutinin (HA) units (influenza A/PR/8/
34, provided by Dr. J.-C. Manuguerra, Laboratoire de Genetiq
Moleculair des Virus Respiratoir Institut Pasteur, Paris, France) or
107 PFU (vaccinia) viruses. 2-4 wk later, 2.5 × 107 (influenza A) or
6 × 107 (vaccinia) splenocytes were restimulated in vitro with 2.5 × 107 (influenza A) or 3 × 107 (vaccinia) irradiated (3,000 rads) syngeneic red blood cell-depleted splenocytes infected for 1 h with influenza A (10 HA unit for 106 cells) or vaccinia (10 PFU/cell) viruses.
Responder mice were individually tested in a standard cytolytic assay 5 d later. In brief, 106 cells, uninfected or infected
(1,000 HA units of influenza A or 5 × 107 PFU of vaccinia viruses)
for 1.5 h in medium without FCS and further incubated for 2 h
in medium containing 5% FCS, were subsequently labeled with
100 µCi of sodium [51Cr]chromate for 1.5 h at 37°C and then
washed three times. Cytolytic activity was determined in 4 h
51Cr-release assays using V-bottom 96-well plates containing 5 × 103
uninfected, influenza A matrix 58-66 peptide-pulsed (106 M) or virus-infected target cells/well in the presence of effector cells from
bulk cultures. Effector/target ratios were as shown in Figs. 3 and 8.
Results are the mean of triplicates calculated as 100 × [(experimental 
spontaneous release) / (total spontaneous release)], with
maximal release being determined by lysis of target cells by 1 M HCl.
2m-transfected RMA target cells, without peptide
(circles) or loaded (triangles) with 106 M synthetic peptide (amino acid 58-66 from the influenza A matrix protein). (B) HLA-A2.1 allospecific CTL
from HLA-A3 transgenic mice isolated as described in Materials and Methods
were similarly tested against the same target cells. Background lysis of
nontransfected target cells was <3% at all E/T ratios (data not shown).
/, 2m/ HHD transgenic mice. 2-4 wk after immunization,
CTL were restimulated in vitro for 5 d and 51Cr-release assays were performed. Targets were 2m-deficient (EL4 S3), wild type (EL4), HHD,
or HLA-A2.1 × human 2m-transfected EL4 S3 and HLA-A2A2Db × human 2m-transfected RMA cells either uninfected (A and B, closed circles), vaccinia (A, closed triangles), influenza A (B, closed triangles) infected,
or influenza A matrix (58-66) peptide pulsed (B, open triangles). Spontaneous release was <15% for all target cells.
Generation of H-2Db/ Knockout Mice.
A 10-kb HindIII fragment containing the whole H-2Db gene and a 1.9-kb PstI fragment encompassing the 3 part of the third exon, the fourth intron,
and the 5 part of the fourth exon were cloned in pBluescript
(Stratagene) vector. The H-2Db targeting construct was generated by inserting a 4-kb XbaI 5 fragment from the H-2Db gene
and a 1.3-kb KpnI 3 fragment from the PstI subclone in the corresponding restriction sites of the pGNA vector polylinker (16).
CGR-8 embryonic stem cells were cultured as described (17) in
the absence of feeder cells in medium supplemented with murine
differentiation inhibiting factor and/or leukemia inhibiting factor.
To isolate homologous recombinants, 108 cells were electroporated
in 900 µl of PBS with 150 µg of SpeI-linearized plasmid DNA at
800 V and 3 µF, using a Bio Rad Labs. (Hercules, CA) gene
pulser and selected after 24 h in the presence of G418 (175 µg/ml).
28 pools of 12 G418-resistant clones were screened by PCR, using
a pGNA-specific 5 (CAGCAGAAACATACAAGCTGTC) and a
H-2Db exon 5-specific 3 (AACGATCACCATGTAAGAGTCAGT) pair of oligonucleotides, resulting in the amplification of
the expected 1.6-kb fragment for 18 pools. The homologous recombination event, detected by hybridization of a 5.6-kb HindIII
fragment with a 3 noncoding BamHI-HindIII probe, was confirmed in six colonies by Southern blot analysis. Two out of five
clones injected into C57BL/6 blastocysts gave rise to germline
transmission of the mutation. Germline chimeras were mated
with C57Bl/6 females and pups were typed by Southern blot
analysis of tail DNA. Heterozygous offspring were backcrossed to
C57BL/6 animals and then intercrossed at the N2 generation to
give rise to two independent H-2Db/ homozygous strains. Inactivation of the H-2Db gene was confirmed by Southern blot analysis on tail DNA and immunofluorescence assay.
Generation of HHD Transgenic Mice.
A 4-kb SalI-NotI fragment containing the HHD construct was injected into C57Bl/6 × SJL oocytes. Transgenic mice identified by Southern blot analysis
of tail DNA and immunofluorescence assay were crossed with
H-2Db/ 2m/ double knockout mice.
FACS® Analysis of the Peripheral T Cell Repertoire of HHD+ H-2Db/
2m/ Knockout Mice.
Expression of the HHD monochain
and lack of H-2Db and H-2Kb were documented by indirect immunofluorescence analyses using B9.12.1 (anti-HLA class I),
B22.249.R.19 (anti-H-2Db), and 20.8.4S unlabeled mAb, detected with F(ab)2 FITC-conjugated goat anti-mouse IgG. Percentages of single CD4+ and CD8+ T lymphocytes were determined by double staining using phycoerythrin-labeled anti-mouse
CD4 (CALTAG Labs., South San Francisco, CA) and biotinylated anti-mouse CD8 (CALTAG Labs.) detected with streptavidin-
Perc-P (CALTAG Labs.). Expression of the different V TCR were
similarly analyzed using phycoerythrin-labeled anti-CD8 mAb (PharMingen, San Diego, CA) and purified, FITC-labeled V2 (B.20.6),
V3 (KJ.25), V4 (KT.10.4), V5.1,.2 (MR.9.4), V6 (44.22),
V7 (TR 130), V8.1,.2,.3 (F.23.1), V9 (MR. 10.2), V10
(B.21.5), V11 (RR.3.15), V13 (MR.12.4), and V17 (KJ.23.1)-
specific mAb. Splenocytes from three individual Db/, 2m/,
HHD+, or HHD mice were red blood cell depleted and enriched in T lymphocytes by wheat germ agglutinin (Sigma
Chemical Co., St Louis, MO) precipitation of B lymphocytes and
NK cells as described (18). Staining of 106 cells was performed in
100 µl of PBS with 0.02% sodium azide for 30 min on ice. Purified mAb or F(ab)2 were used at 10 µg/ml and F(ab)2 FITCconjugated goat anti-mouse IgG was used 1:100 diluted. A total
of 25,000 1% paraformaldehyde-fixed cells per sample was subjected to one- or two-color analysis on FACScan®.
Results
Recombinant genes encoding HLA-A2.1 monochains were engineered, as illustrated
in Fig. 1, by introducing between the first and second exon
of the genomic HLA-A2.1 gene a 2m cDNA (deprived of
from the nucleotides corresponding to the leader sequence) and a pair of synthetic oligonucleotides encoding a 15 residue (Gly4Ser)3 peptide linker, as already described (19, 20). The first intron of the HLA-A2.1 gene was therefore deleted resulting in a chimeric exon 1 that codes for the
leader sequence of HLA-A2.1, the 2m domain, the peptide linker, and the HLA-A2.1 1 domain. Three different
HLA-A2.1 monochains were engineered: HHH, fully human; HHD, containing the mouse H-2Db 3, transmembrane, and cytoplasmic domains; and MHD, homologous to HHD, with the mouse instead of the human 2m. All
constructs, verified by sequencing, encode monochains in
which the amino acid sequence of the leader, mature 2m,
and 1 domains are totally conserved.
Expression in RMA Cells.
By indirect immunofluorescence analysis of RMA lymphoma transfected cells (Fig. 2 A),
cell surface expression of HHH, HHD, and MHD monochains was compared to the cell surface expression of their
heterodimeric counterparts. Despite selection of transfectants expressing similar amounts of monochain transcripts
(as judged by semiquantitative PCR, data not shown) cell
surface expression reaches the level of control cells only for
HHH and HHD monochains. Surtransfection of MHDexpressing cells with the human 2m gene corrects the defect of cell surface expression of this monochain (data not
shown), suggesting, in spite of their covalent linkage, poor
interaction between the mouse 2m and the HLA-A2.1 1
and 2 domains (21, 22). Tested with a panel of nine
HLA-A2.1-specific mAb (data not shown), the three monochains exhibited normal serological reactivities, indicating that
the peptide linker does not markedly alter the overall threedimensional structure of the HLA-A2.1 molecule.
12, H-2Db 3, transmembrane, cytoplasmic, A2Db) class
I heavy chains associated with either human (RMA/A2/h2m, RMA/A2Db/h2m) or mouse
(RMA/A2Db) 2m. HLA class
I-specific B9.12.1 unlabeled mAb
was detected with F(ab)2 FITCconjugated goat anti-mouse IgG.
Negative control was RMA untransfected cells. Results are expressed in fluorescence intensity
(x-axis, log scale) and relative cell
number (y-axis). (B) Untransfected and transfected RMA cells
were [35S]methionine labeled as
described in Materials and Methods, and immunoprecipitations
were carried out with HLA-A2Aw69-specific BB7.2 mAb.
HLA-A2.1 monochains were exclusively detected as 60-kD proteins by immunoprecipitation using HLA-A2.1-specific BB7.2 mAb and PAGE analysis, suggesting that the fused molecules are not proteolytically separated after synthesis (Fig. 2 B).
Finally, recognition by mouse CTL of the monochains
was evaluated (Fig. 3). An influenza A matrix-specific, HLAA2.1-restricted CTL clone (HAM 42; 14) was first tested on
target cells pulsed with synthetic 58-66 influenza matrix peptides. This CTL clone killed HHH-, HHD-, and MHDRMA monochain transfectants and RMA cells expressing
heterodimeric HLA-A2.1 × human 2m molecules with
approximately the same efficiency (Fig. 3 A). Expression by
the MHD and HHD monochains of a mouse H-2Db 3
domain that should facilitate their interaction with mouse CD8 molecules did not result in more efficient lysis, under
our experimental conditions, by HAM 42 clone. CD8independent recognition of target cells has been observed
for some CTL clones, possibly related to the expression by
these clones of TCR of high affinity (23). Therefore, to
more precisely evaluate the impact of the mouse 3 domain on the recognition by mouse CTL of the HLA-A2.1 monochains, the same target cells were tested with polyclonally activated, HLA-A2.1-specific CTL, raised by immunization of C57BL/6 HLA-A3 transgenic mice with
splenocytes of C57BL/6 HLA-A2.1 × human 2m double
transgenic mice. Such polyclonally activated CTL specifically lyse HLA-A2.1-positive human cell line (JY), HLAA2.1 transfected P815(H-2d), and RMA(H-2b) murine cell
lines (data not shown), as well as the three monochain transfectants. However, MHD and, more strikingly, HHD
monochain transfectants were more efficiently recognized
(Fig. 3 B). Thus, as already documented for heterodimeric
HLA-A2.1 molecules (12), recognition by mouse CTL of
the HLA-A2.1 monochains is facilitated by the introduction of a mouse 3 domain.
Altogether, these in vitro studies of transfected cells show that the three HLA-A2.1 monochains are cell-surface expressed, serologically not altered, bind exogenous peptides, and are recognized by CTL. This suggests that they have a three-dimensional structure similar to wild-type heterodimeric molecules. They further argue for the selection of HHD molecules that are efficiently cell-surface expressed and that interact with the mouse CD8 molecules.
Peptide-dependency of Cell Surface Expression. Monochain
constructs were introduced in TAP-deficient RMA-S cells
to test whether cell surface expression of HLA-A2.1 monochains would be promoted at 25°C and stabilized at 37°C
by the fixation of exogenous peptides (24). The results of
these experiments are illustrated in Fig. 4. Cultivating
transfected RMA-S cells at 25°C resulted in enhanced cellsurface expression of HHH, HHD, and, to a lesser extent,
MHD monochains, which were stabilized at 37°C by the
fixation of the 58-66 influenza matrix peptide. Thus, HLAA2.1 monochains exhibited the same peptide dependency for stabilization as their heterodimeric counterparts. Moreover, at the surface of RMA-S transfectants, a relatively high
basal expression of HLA-A2.1 monochains was observed at
37°C in the absence of exogenous peptides, suggesting, as established for wild-type heterodimeric HLA-A2 (25, 26), that
HLA-A2.1 monochains in TAP-deficient cells bind a significant amount of hydrophobic leader peptides in the endoplasmic reticulum.
2 mAb detected with F(ab)2 FITCconjugated goat anti-mouse IgG. Results are expressed in fluorescence
intensity (x-axis, log scale) and relative cell number (y-axis). (Left) Cell
surface expression of monochains after overnight culture at 37 or 25°C.
(Right) Stabilization of cell surface expression of HLA-A2.1 monochains
after overnight culture at 25°C, addition of 105 M, 106 M, or no synthetic peptide (amino acid 58-66 from influenza A virus matrix protein;
closed histograms) and subsequent incubation for 4 h at 37°C.
Monochain Expression in
2m-deficient Cells.
2m-deficient
EL4 S3 Rob cells (27) were stably transfected with the
monochain constructs to precisely evaluate the possibility that heavy chain-linked 2m could promote the reexpression of endogenous H-2 class I mouse heavy chains. To be
in a situation analogous to that of 2m knockout mice, selected clones of transfectants were cultured in medium supplemented with FCS deprived of bovine 2m by extensive
immunoadsorption on a bovine 2m-specific, CAB.297 mAb
column (28).
As illustrated in Fig. 5, we found limited, however repeatedly observed, reexpression of H-2Db, a conclusion
based on the fact that the B22.249.R.19 mAb reacts with
the 12 H-2Db domains. Since H-2Db molecules are furthermore susceptible to reach cell surfaces in the absence of
endogenous 2m (29), we concluded that the production
of HLA-A2.1 monochain transgenic mice should be associated with the destruction of both mouse 2m and H-2Db
genes, by homologous recombination. Altogether, these in
vitro studies using transfected cells show the integrity and
the functional capacities of HLA-A2.1 monochains and led
us to select the HHD construct for the production of the
HLA-A2.1 monochain transgenics mice.
2m-deficient cells. Untransfected, HLA-A2.1 × human 2m-, HHD-, or HHH-transfected
2m EL4 S3 Rob cells, cultured in medium containing 3% FCS and
fully depleted in bovine 2m by immunoadsorption on a bovine 2mspecific (CAB.297) mAb column, were stained with B22.249.R.19 (H2Db12-specific), 20.8.4S (H-2Kb12-specific), or B9.12.1 (HLA
class I-specific) unlabeled mAb, detected with F(ab)2 FITC-conjugated
goat anti-mouse IgG (goat anti-mouse FITC). Negative controls were
with no first mAb. Results are expressed in fluorescence intensity (x-axis,
log scale) and relative cell number (y-axis).
Expression of HHD Monochains in H-2Db
/ Mouse
2m/ Double Knockout Mice.
A targeting construct in
which exons 1, 2, and 3 of the H-2Db gene were replaced
by a plasmid conferring resistance to G418, was electroporated in CGR-8 embryonic stem cells (30), and homologous recombinants were identified at the clonal level by PCR and
Southern blot analyses (Fig. 6). After blastocyst injection
and reimplantation, chimeric mice were obtained, which
gave germline transmission of the targeted gene. H-2Db/
homozygous animals were then produced. These animals
show no profound quantitative and qualitative modifications of their CD8+ T cell repertoire (data not shown, Perarnau et al., manuscript in preparation). These H-2D/
mice were crossed with 2m/ knockout mice (31) to
derive H-2Db/ 2m/ double mutants. Since initial attempts to use these mice for transgenesis failed, C57BL/6 × SJL were used as recipients. Transgenic animals identified
by Southern blotting and serological analyses were crossed
with H-2Db/ 2m/ knockout mice to derive HHD
(heterozygous) H-2Db/ 2m/ experimental animals.
noncoding BamHI-HindIII probe used for Southern blot analysis and
the length of the wild-type HindIII fragment are shown. (B) Restriction
map of the SpeI-linearized targeting vector, which contains a 4-kb HindIII-XbaI 5 and a 1-kb KpnI-SpeI 3 fragment of the H-2Db gene. (C)
Predicted structure of the targeted H-2Db gene, in which the first three
exons are replaced by the whole plasmid sequence; the 1.6-kb PCRamplified diagnostic fragment and the length of the diagnostic 5.6-kb
HindIII fragment generated after recombination are shown. H, HindIII;
B, BamHI; X, XbaI; K, KpnI; Sp, SpeI.
Weak (compared to endogenous H-2 class I molecules in
normal mice), but significant, expression of the transgenic
HHD molecules on unactivated peripheral T lymphocytes
was documented by indirect immunofluorescence and FACS®
analysis. Under similar conditions, no H-2Kb and H-2Db
molecules could be detected (Fig. 7 A). This expression of
HHD monochains partially restores the peripheral pool of
CD8+ T lymphocytes (5.5% of the T lymphocytes instead
of 20-30% in normal mice). More importantly, testing the
10 available anti-V mAb, it appeared, as illustrated in Fig.
7 B for V8, that these CD8+ T lymphocytes exhibited a
diversified TCR repertoire. By comparison with H-2Db/
2m/ double knockout mice, which are almost completely deprived of peripheral CD8+ T lymphocytes, these
results suggest that HHD monochains promote CD8+ T
cell positive education in the thymus.
/, 2m/, HHD
transgenic mice. Flow cytometric analyses were performed on spleen T
lymphocytes from H-2Db/, 2m/, HHD+ (left), or HHD (right)
mice. (A) Expression of H-2Kb, H-2Db, and HHD molecules detected
with 20.8.4.S, B22.249.R.19, or B9.12.1 mAb, respectively and F(ab)2
FITC-conjugated goat anti-mouse IgG, negative controls with no first
mAb. Results are expressed in fluorescence intensity (x-axis, log scale) and
relative cell number (y-axis). (B, top) Partial restoration of the peripheral pool of CD8+ T lymphocytes. Double staining was performed with phycoerythrin-labeled anti-CD4 (x-axis, log scale) and biotinylated anti-CD8
detected with streptavidin-Perc-P (y-axis, log scale). (Bottom) Peripheral CD8+ TCR repertoire. As illustrated for V8.1.2.3, double staining was
performed with FITC-labeled anti-V2 (B.20.6), -V3 (KJ.25), -V4
(KT.10.4), -V5.1,.2 (MR.9.4), -V6 (44.22), -V7 (TR 130), -V8.1,.2,.3
(F.23.1), -V9 (MR.10.2), -V10 (B.21.5), -V11 (RR.3.15), -V13
(MR.12.4), and -V17 (KJ.23.1)-specific mAb (x-axis, log scale) and phycoerythrin-labeled anti-CD8 mAb (y-axis, log scale).
CTL Responses of HHD H-2Db
/ 2m/ Mice.
HHD
(heterozygous) H-2Db/ 2m/ animals were intraperitoneally infected with either vaccinia or influenza A viruses. 2-4 wk later, splenocytes were restimulated in vitro
with virus-infected syngeneic irradiated splenocytes and
tested 5 d later in a classical 51Cr-release assay.
All animals tested (four out of four for each virus) have developed virus-specific, HHD-restricted CTL responses allowing the in vitro killing of virally infected HHD-transfected cells (Fig. 8). No significant lysis was observed testing the effector cells on vaccinia- or influenza A-infected EL4 cells, indicating that the CTL generated were HLAA2.1 restricted. Two additional points are worth mentioning. First, these CTL recognized uninfected HHD-transfected cells loaded with the 58-66 influenza A matrix peptide with the same efficiency as infected cells (Fig. 8 B). Second, the CTL responses appeared strongly CD8 dependent, HHD-transfected cells (as well as their heterodimeric counterparts) being much more efficiently recognized than transfectants expressing a fully human molecule.
Discussion
Comparative analyses of the cell surface expression and
CTL recognition of HHH, HHD, and MHD monochains
led to the selection of the HHD construct for the development of HLA-A2.1 transgenic mice. Cell-surface expression of MHD monochains has constantly been found to be
5-10 times lower by FACS® analysis. We know, from pulsechase and endoglycosidase H digestion experiments, that
MHD monochains egress slowly from the endoplasmic reticulum. HHH and HHD monochains, by contrast, leave
this cellular compartment as rapidly as HLA-A2.1 × human 2m heterodimers (data not shown). Better interaction with mouse CD8 molecules has been the key element
for the selection of the HHD construct. A similar observation has already been made analyzing the CTL responses of
transgenic mice expressing, as heterodimers, chimeric HLAA2.1 12 × H-2Kb 3 transmembrane and cytoplasmic
domain heavy chains (12). Further improvement of this interaction might be expected, particularly for some other
HLA class I alleles (i.e., HLA-B7), by site-directed mutagenesis of the 2 residues implicated in the CD8 binding
site (32). Alternatively, one might consider the possibility
of introducing the human CD8 and chains by transgenesis.
Profound reduction in cell surface expression of H-2
class I molecules has been documented serologically after
destruction of mouse 2m gene by homologous recombination (31, 33). However, studying both 2m tumor cells
and 2m knockout mice, residual expression of H-2Db
molecules has been described, indicating that a fraction of
functionally conformed H-2Db heavy chains reaches the
cell surface in the absence of 2m (34). Since it was observed ex vivo that HHD monochains promote, to a certain extent, H-2Db molecule cell surface export, it was of
interest to have HHD molecules expressed in H-2Db/
and 2m/ double knockout mice. Nevertheless, such mice
cannot be considered as completely devoid of cell surface-
expressed classical H-2 class I molecules. In fetal thymic organ cultures from 2m/ mice, H-2Kb-restricted CTL
can be positively selected in the presence of exogenously
added 2m and peptides (35). Additionally, H-2Kb-specific
CTL have been generated against 2m cells, and H-2Kb
molecules can be detected at the surface of Con A-stimulated 2m/ splenocytes, implying residual expression of
2m-free, H-2Kb heavy chains (36). This residual expression might account for the small percentage (0.4%) of
CD8+ T lymphocytes observed in H-2Db 2m double
knockout mice (Fig. 7 B). Even if it is generally assumed
that 2m-free H-2Kb heavy chains are expressed in lower
amounts than 2m-free H-2Db heavy chains, it may be of
interest to derive H-2Kb, H-2Db, 2m triple knockout
mice.
Despite the residual expression of 2m-free H-2Kb
heavy chains and the relatively low expression level (for
which we do not have definitive explanation) of HHD
monochains by HHD (heterozygous) transgenic H-2Db 2m
double knockout mice, the results reported indicate efficient usage of the HLA-A2.1 monochain both at the educational and effector levels by the mouse CD8+ T lymphocytes. Expression of the monochain restores a sizable and
diversified CD8+ T cell repertoire, supporting the notion
that no significant species bias prevents interactions between mouse TCR and HLA class I molecules (8, 13). More
complete restoration is anticipated once animals homozygous for the transgene will be isolated. It might be of importance to reach expression levels similar to those observed at the surface of human cells to study CTL responses against peptides that interact or are recognized with relatively low affinity. In the absence of both H-2Db and
mouse 2m, it must be assumed that most peripheral
CD8+ T lymphocytes have been educated in the thymus
on HHD monochains. This should facilitate the study of
HLA class I-restricted responses compared to classical transgenic mice. One might hope that the information gained
with these animals will be of human relevance. Two recently reported studies have indicated significant overlap between HLA-A2.1 transgenic mice and human CTL responses assaying a large panel of hepatitis C- and hepatitis
B virus-derived T cell epitopes (39, 40). The development in
HHD animals of potent CTL responses against the immunodominant (in HLA-A2.1 individuals) matrix peptide, documented in this report, also support such possibility. We are
planning to use these animals for a comparative study of the
vaccine potential of the HLA-A2.1-restricted T cell epitopes already characterized in various human diseases and a comparison of the different vaccine strategies.
Footnotes
Address correspondence to Béatrice Pérarnau, Institut Pasteur, Département SIDA-Rétrovirus, Unité d'Immunité Cellulaire Antivirale, 28 rue du Dr Roux, 75724 Paris Cedex 15, France. The present address of S. Pascolo is IMBB, Forth-Hellas P.O. Box 1527, Vassilika Vouton, Heraklion 711 10, Crete, Greece.
Received for publication 19 February 1997.
During her postdoctoral stay at the Centre for Genome Research (Edinburgh, U.K.), B. Pérarnau was a recipient of a fellowship from the Human Frontier Science Program Organisation. The Centre for Genome Research is supported by the Biotechnology and Biological Sciences Research Council of the United Kingdom. This work was funded by the Institut Pasteur and by grants from the Association pour la Recherche contre le Cancer, the Ligue contre le Cancer, and the Pasteur-Weizmann committees.2m, -2 microglobulin; HA, hemagglutinin;
TAP, transporter associated with antigen presentation.
The authors are grateful to Drs. T. Meo and C. Babinet for helpful discussion, Drs. E. Mottet, J.-P. Abastado, V. Engelhard, J.-C. Manuguerra, and G. Hämmerling for providing 2m cDNA, cells, and viruses, L. Anderson and A. Jeske for H-2Db/ mouse husbandry, P. Marchand for producing HHD transgenic animals, and Drs. M. Cochet, S. Dethlefs, and S. Wain-Hobson for careful reading of the manuscript.
References
| 1. | Arnold, B., and G.J. Hämmerling. 1991. MHC class-I transgenic mice. Annu. Rev. Immunol. 9: 297-322 [Medline]. |
| 2. |
Dill, O.,
F. Kievits,
S. Koch,
P. Ivanyi, and
G.J. Hämmerling.
1988.
Immunological function of HLA-C antigens in
HLA-Cw3 transgenic mice.
Proc. Natl. Acad. Sci. USA.
85:
5664-5668
|
| 3. | Kievits, F., P. Ivanyi, P. Krimpenfort, A. Berns, and H.L. Ploegh. 1987. HLA-restricted recognition of viral antigens in HLA transgenic mice. Nature (Lond.). 329: 447-449 [Medline]. |
| 4. |
Kievits, F.,
J. Wijffels,
W. Lokhorst, and
P. Ivanyi.
1989.
Recognition of xeno-(HLA, SLA) major histocompatibility
complex antigens by mouse cytotoxic T cells is not H-2 restricted: a study with transgenic mice.
Proc. Natl. Acad. Sci.
USA.
86:
617-620
|
| 5. | Kievits, F., W. Lokhorst, and P. Ivanyi. 1990. Abnormal anti-viral immune response in mice is corrected in HLAB27.2-transgenic mice. Eur. J. Immunol. 20: 1189-1192 [Medline]. |
| 6. | Kievits, F., W.J. Boerenkamp, W. Lokhorst, and P. Ivanyi. 1990. Specificity and frequency of primary anti-HLA cytotoxic T lymphocytes in normal and HLA-B27.2, HLAB27.5, and HLA-Cw3-transgenic mice. J. Immunol. 144: 4513-4519 [Abstract]. |
| 7. |
Barra, C.,
B. Pérarnau,
P. Gerlinger,
M. Lemeur,
A. Gillet,
P. Gibier, and
F. Lemonnier.
1989.
Analysis of the anti-HLACw3 CTL response of HLA-B7 × human 2m double transgenic mice.
J. Immunol.
143:
3117-3124
[Abstract].
|
| 8. | Engelhard, V.H., E. Lacy, and J.P. Ridge. 1991. Influenza A-specific, HLA-A2.1 restricted cytotoxic T lymphocytes from HLA-A2.1 transgenic mice recognize fragments of the M1 protein. J. Immunol. 146: 1226-1232 [Abstract]. |
| 9. | Epstein, H., R. Hardy, J.S. May, M.H. Johnson, and N. Holmes. 1989. Expression and function of HLA-A2.1 in transgenic mice. Eur. J. Immunol. 19: 1575-1583 [Medline]. |
| 10. | Le, A.-X.T., E.J. Bernhard, M.J. Holterman, S. Strub, E. Lacy, and V. Engelhard. 1989. Cytotoxic T cell responses in HLA-A2.1 transgenic mice: recognition of HLA alloantigens and utilization of HLA-A2.1 as a restriction element. J. Immunol. 142: 1366-1371 [Abstract]. |
| 11. |
Kalinke, U.,
B. Arnold, and
G. Hämmerling.
1990.
Strong
xenogeneic HLA response in transgenic mice after introducing an 3 domain into HLA-B27.
Nature (Lond.).
348:
642-644
[Medline].
|
| 12. |
Vitiello, A.,
D. Marchesini,
J. Furze,
L.A. Sherman, and
R.W. Chesnut.
1991.
Analysis of the HLA-restricted influenza-specific cytotoxic T lymphocyte response in transgenic
mice carrying a chimeric human-mouse class I major histocompatibility complex.
J. Exp. Med.
173:
1007-1015
|
| 13. | Barra, C., H. Gournier, Z. Garcia, P. N. Marche, E. JouvinMarche, P. Briand, P. Filippi, and F.A. Lemonnier. 1993. Abrogation of H-2 restricted responses and efficient recognition of HLA-A3 molecules in DBA/2 HLA/A24 responder mice. J. Immunol. 150: 3681-3689 [Abstract]. |
| 14. | Man, S., J.P. Ridge, and V. Engelhard. 1994. Diversity and dominance among TCR recognizing HLA-A2.1+ influenza matrix peptide in human class I transgenic mice. J. Immunol. 153: 4458-4467 [Abstract]. |
| 15. |
Grosveld, F.G.,
T. Lund,
E.J. Murray,
A.L. Mellor,
H.H.W. Dahl, and
R.A. Flavell.
1982.
The construction of cosmid libraries which can be used to transform eukaryotic cells.
Nucleic Acids Res.
10:
6715-6732
|
| 16. |
Le Mouellic, H.,
Y. Lallemand, and
P. Brulet.
1990.
Targeted replacement of the homeobox gene Hox-3.1 by the
Escherichia coli lacZ in mouse chimeric embryos.
Proc. Natl.
Acad. Sci. USA.
87:
4712-4716
|
| 17. | Smith, A.G.. 1991. Culture and differenciation of embryonic stem cells. J. Tissue Cult. Methods. 13: 89-94 . |
| 18. | Saron, M., P. Truffa-Bachi, and J.-C. Guillon. 1989. Rapid enrichment of mouse natural killer cells by use of wheat germ agglutinin. J. Immunol. Methods. 59: 151-158 . |
| 19. |
Lee, L.,
L. McHugh,
R. Ribaudo,
S. Kozlowski,
D. Margulies, and
M. Mage.
1994.
Functional cell surface expression
by a recombinant single-chain class I major histocompatibility
complex molecule with a cis-active 2-microglobulin domain.
Eur. J. Immunol.
24:
2633-2639
[Medline].
|
| 20. |
Toshitani, K.,
V. Braud,
M.J. Browning,
N. Murray,
A.J. McMichael, and
W.F. Bodmer.
1996.
Expression of a singlechain HLA class I molecule in a human cell line: presentation
of exogenous peptide and processed antigen to cytotoxic T
lymphocytes.
Proc. Natl. Acad. Sci. USA.
93:
236-240
|
| 21. |
Krimpenfort, P.,
G. Rudenko,
F. Hochstenbach,
D. Guessow,
A. Berns, and
H. Ploegh.
1987.
Crosses of two independently derived transgenic mice demonstrate functional complementation of the genes encoding heavy (HLA-B27) and light
(2-microglobulin) chains of HLA class I antigens.
EMBO
(Eur. Mol. Biol. Organ.) J.
6:
1673-1676
[Medline].
|
| 22. |
Pérarnau, B.,
A. Gillet,
R. Hakem,
M. Barad, and
F.A. Lemonnier.
1988.
Human 2-microglobulin specifically enhances
cell surface expression of HLA class I molecules in transfected
murine cells.
J. Immunol.
141:
1383-1389
[Abstract].
|
| 23. | MacDonald, H.R., A.L. Glasebrook, C. Bron, A. Kelso, and J.-C. Cerottini. 1982. Clonal heterogeneity in the functional requirement for Lyt-2/3 molecules on cytolytic T lymphocytes (CTL): possible implications for the affinity of CTL antigen receptors. Immunol. Rev. 68: 89-115 [Medline]. |
| 24. | Ljunggren, H.G., N.J. Stam, C. Ohlén, J.J. Neefjes, P. Hoglund, M.T. Heemels, J. Bastin, T.N.M. Schumacher, A. Townsend, and K. Kärre. 1990. Empty MHC class I molecules come out in the cold. Nature (Lond.). 346: 476-480 [Medline]. |
| 25. |
Hunt, D.F.,
R.A. Henderson,
J. Shabanowitz,
K. Sakaguchi,
H. Michel,
N. Sevilir,
A.L. Cox,
E. Appella, and
V.H. Engelhard.
1992.
Characterization of peptides bound to the class
I MHC molecule HLA-A2.1 by mass spectrometry.
Science
(Wash. DC).
255:
1261-1263
|
| 26. | Wei, M.L., and P. Cresswell. 1992. HLA-A2 molecules in an antigen-processing mutant cell contain signal sequence-derived peptides. Nature (Lond.). 356: 443-446 [Medline]. |
| 27. | Sturmhofel, K., and G. Hämmerling. 1990. Reconstitution of H-2 class I expression by gene transfection decrease susceptibility to natural killer cells of an EL4 class I variant. Eur. J. Immunol. 20: 171-177 [Medline]. |
| 28. |
Rocca, A.,
A. Opolski,
A. Samaan,
B. Frangoulis,
L. Degos, and
M. Pla.
1992.
Localization of the conformational alteration of MHC molecules induced by the association of
mouse class I heavy chain with a xenogeneic 2-microglobulin.
Mol. Immunol.
29:
481-487
[Medline].
|
| 29. |
Allen, H.,
J. Fraser,
D. Flyer,
S. Calvin, and
R. Flavell.
1986.
2-microglobulin is not required for cell surface expression
of the murine class I histocompatibility antigen H-2Db or of a
truncated H-2Db.
Proc. Natl. Acad. Sci. USA.
83:
7447-7451
|
| 30. |
Mountford, P.,
B. Zevnik,
A. Düwel,
J. Nichols,
M. Li,
C. Dani,
M. Robertson,
I. Chambers, and
A. Smith.
1994.
Dicistronic targeting constructs: reporters and modifiers of
mammalian gene expression.
Proc. Natl. Acad. Sci. USA.
91:
4303-4307
|
| 31. |
Koller, B.H.,
P. Marrack,
J.W. Kappler, and
O. Smithies.
1990.
Normal development of mice deficient in 2-m, MHC
class I proteins, and CD8+ T cells.
Science (Wash. DC).
248:
1227-1230
|
| 32. |
Sun, J.,
D.J. Leahy, and
P.B. Kavathas.
1995.
Interaction between CD8 and major histocompatibility complex (MHC)
class I mediated by multiple contact surfaces that include the
2 and 3 domains of MHC class I.
J. Exp. Med.
182:
1275-1280
|
| 33. |
Zijlstra, M.,
M. Bix,
N. Simister,
J. Loring,
D. Raulet, and
R. Jaenisch.
1990.
2-microglobulin deficient mice lack
CD48+ cytolytic T cells.
Nature (Lond.).
344:
742-746
[Medline].
|
| 34. |
Bix, M., and
D. Raulet.
1992.
Functionally conformed free
class I heavy chains exist on the surface of 2-microglobulin
negative cells.
J. Exp. Med.
176:
829-834
|
| 35. | Hogquist, K.A., S.C. Jameson, W.R. Heath, J.L. Howard, M.J. Bevan, and F.R. Carbone. 1994. T cell receptor antagonist peptides induce positive selection. Cell. 76: 17-27 [Medline]. |
| 36. |
Glas, R.,
L. Franksson,
C. Öhlén,
P. Höglund,
B. Koller,
H. Ljunggren, and
K. Kärre.
1992.
Major histocompatibility complex class I-specific and -restricted killing of 2-microglobulin-deficient cells by CD8+ cytotoxic T lymphocytes.
Proc.
Natl. Acad. Sci. USA.
89:
11381-11385
|
| 37. |
Glas, R.,
C. Öhlén,
P. Höglund, and
K. Kärre.
1994.
The
CD8+ T cell repertoire in 2-microglobulin-deficient mice
is biased towards reactivity against self-major histocompatibility class I.
J. Exp. Med.
179:
661-672
|
| 38. |
Machold, R.P.,
S. Andrée,
L. Van Kaer,
H.-G. Ljunggren, and
H.L. Ploegh.
1995.
Peptide influences the folding and
intracellular transport of free major histocompatibility complex class I heavy chains.
J. Exp. Med.
181:
1111-1122
|
| 39. | Shirai, M., T. Arichi, M. Nishioka, T. Nomura, K. Ikeda, K. Kawanishi, V.H. Engelhard, S.M. Feinstone, and J.A. Berzofsky. 1995. CTL responses of HLA-A2.1-transgenic mice specific for hepatitis C viral peptides predict epitopes for CTL of humans carrying HLA-A2.1. J. Immunol. 154: 2733-2742 [Abstract]. |
| 40. | Wentworth, P., A. Vitiello, J. Sidney, E. Keogh, R. Chesnut, H. Grey, and A. Sette. 1996. Differences and similarities in the A2.1-restricted cytotoxic T cell repertoire in humans and human leukocyte antigen-transgenic mice. Eur. J. Immunol. 26: 97-101 [Medline]. |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
