|
||
-G
Loop of the
Human Granulocyte/Macrophage Colony-stimulating Factor
Receptor
Chain for Ligand Recognition
By
§





¶
From the * Clinical Research Institute of Montréal, Laboratory of Hemopoiesis and Leukemia, and
Laboratory of Biological Chemistry, Montréal, Quebec H2W 1R7, Canada; § Department of
Pharmacology,
Department of Biochemistry, and ¶ Department of Molecular Biology, University of
Montréal, Montréal, Quebec H3C 3J7, Canada; ** The Genetics Institute, Cambridge,
Massachusetts 02140; and 
Hanson Cancer Center, Adelaide 5000, Australia
The receptor for granulocyte/macrophage colony-stimulating factor (GM-CSF) is composed
of two chains,
and
c. Both chains belong to the superfamily of cytokine receptors characterized by a common structural feature, i.e., the presence of at least two fibronectin-like folds
in the extracellular domain, which was first identified in the growth hormone receptor. The
GM-CSF receptor (GMR)-
chain confers low affinity binding only (5-10 nM), whereas the
other chain,
c, does not bind GM-CSF by itself but confers high affinity binding when associated with GMR-
(25-100 pM). The present study was designed to define the assembly of the GMR complex at the molecular level through site-directed mutagenesis guided by homology modeling with the growth hormone receptor complex. In our three-dimensional model,
R280 of GMR-
, located in the F
-G
loop and close to the WSSWS motif, is in the vicinity
of the ligand Asp112, suggesting the possibility of electrostatic interaction between these two
residues. Through site directed mutagenesis, we provide several lines of evidence indicating the importance of electrostatic interaction in ligand-receptor recognition. First, mutagenesis of
GMR-
R280 strikingly ablated ligand binding in the absence of
common (
c); ligand binding was restored in the presence of
c with, nonetheless, a significant shift from high (26 pM)
toward low affinity (from 2 to 13 nM). The rank order of the dissociation constant for the different GMR-
R280 mutations where Lys > Gln > Met > Asp, suggesting the importance of
the charge at this position. Second, a mutant GM-CSF with charge reversal mutation at position Asp112 exhibited a 1,000-fold decrease in affinity in receptor binding, whereas charge ablation or conservative mutations were the least affected (10-20-fold). Third, removal of the
charge at position R280 of GMR-
introduced a 10-fold decrease in the association rate constant and only a 2-fold change in the dissociation rate constant, suggesting that R280 is implicated in ligand recognition, possibly through interaction with Asp112 of GM-CSF. For all
R280 mutants, the half-efficient concentrations of GM-CSF required for membrane (receptor
binding) to nuclear events (c-fos promoter activation) and cell proliferation (thymidine incorporation) were in the same range, indicating that the threshold for biologic activity is governed
mainly by the affinity of ligand-receptor interaction. Furthermore, mutation of other residues
in the immediate vicinity of R280 was less drastic. Sequence alignment and modeling of interleukin (IL)-3R and IL-5R identified an arginine residue at the tip of a
turn in a highly divergent context at the F
-G
loop, close to a conserved structural element, the WSXWS motif, suggesting the possibility of a ligand association mechanism similar to the one described herein
for GMR.
Human GM-CSF is a cytokine that promotes the proliferation, survival, and functional activation of cells
in the granulocytic and monocytic lineage (1). Gene
cloning indicates that the receptor for GM-CSF is composed of two chains, Both chains of the GM-CSF receptor are members of the
superfamily of cytokine receptors, characterized by conserved structural features in the extracellular domain, i.e.,
four conserved cysteine residues, and a typical WSXWS motif in the juxtamembrane region. According to the model
predicted by Bazan (14), cytokine receptors are made up of
two domains, each containing seven antiparallel GMR- Homology Modeling of the GM-CSF Hormone Receptor Complex.
All calculations were performed using the software package SYBYL (Tripos Assoc., St. Louis, MO) on a SiliconGraphics
Indigo2-Extreme workstation. The Kollman united atom force
field was used for energy calculations, and a dielectric constant of
10 was used to approximate a protein receptor environment. The
x-ray crystal structure of human growth hormone (hGH) bound
to its receptor (15) was obtained from the Brookhaven protein
database. Before manipulations, the entire complex was subjected
to 1,000 steps of conjugate gradient minimization. GMR-
(5) and
(6). The human GM-CSF
receptor (GMR)-
subunit is 378 amino acid (aa)1 in length
(5), most of which constitutes the extracellular domain.
GMR-
confers low affinity binding and has been shown to be species specific for its ligand (5, 7), whereas
, which
is required for signal transduction, comprises 881 aa with a
432 aa cytoplasmic tail (6). Both
and
cytoplasmic domains lack intrinsic enzymatic activities. Interestingly, the
chain, referred to as
common or
c, is shared with the
receptors for IL-3 and -5, two cytokines that exhibit significant overlap in biological activity with GM-CSF (for review see reference 8). Our previous data suggest that the
transition from low affinity to high affinity binding results
from the association of
c to the GM-CSF-GMR-
complex, resulting in a more stable ternary complex (9). Data
from many groups also suggest that only the high-affinity receptor mediates the biologic response of the cells to GMCSF (3, 5, 7). Expression of the two chains of the GMCSF receptor in NIH 3T3 cells results in GM-CSF-induced
signal transduction (10), morphological transformation (11,
12), and cell proliferation (13).
strands similar to the fibronectin fold. These strands are coded A-G for
the NH2-terminal domain and A
-G
for the COOH-terminal domain. Together, these two domains form a common
cytokine receptor motif (CRM). This predicted structure
was confirmed through crystallization of the growth hormone (GH)-GHR complex (15) and of the tenth type III
segment of human fibronectin (16). The tenth segment of fibronectin has, in fact, been shown to bind integrin through the RGD site located at the F-G loop. Furthermore, scanning mutagenesis of IL-6R-
also identified several residues in the same region, E278/F279, and surrounding residues (A275, G282/E283) as essential for IL-6 binding (17).
These data indicate a clustering of residues that are important in ligand-receptor recognition at the F
-G
loop of
the CRM.
plays a critical role in receptor complex formation because it confers the specificity of association with the
ligand and it is involved in signal transduction as shown by
our team (12) and others (18). Therefore the aim of this
work was to identify the molecular determinants of the
complex formation on GMR-
, through site directed mutagenesis guided by homology modeling based on the GH-
GHR complex. Functionally important residues have to be
in the vicinity of residues on the ligand that are crucial for
receptor binding and to be located in a divergent context
compared to IL-3R-
and -5R-
. We have thus identified the critical role of R280 located at the F
-G
loop of
GMR-
in ligand binding.
has one
CRM as GHR, whereas
c has a duplicated extracellular domain
with two such CRM. Using the sequence alignment of Goodall
et al. (19) the extracellular domain of molecule 1 (GHRI) and
GHRII chains of the GH-GHR2 complex were transformed one
amino acid at a time into the GM-CSF receptor
chain and the
membrane proximal CRM motif of
c, respectively. The backbone dihedryl angles were held fixed to preserve the receptor's
secondary structure, whereas the amino acid side chains were positioned using the scan subroutine in SYBYL. This routine rotates
each side chain dihedryl angle until a sterically acceptable conformation was obtained. The x-ray crystal structure of GM-CSF has
been reported (20). The hGH ligand was excised from the hormone receptor complex and the GM-CSF ligand was positioned
into the receptor visually in approximately the same orientation
and position as was hGH. When the new ligand-receptor complex displayed reasonable steric complementarity, the entire complex was minimized as above, allowing all atoms to relax. A molecular dynamics simulation of 20 ps was performed to determine the stability of the GM-CSF receptor complex, and it was determined that the complex retained its secondary structure. Point
mutations of the new GM-CSF receptor and hormone were performed using the same methodology, and the stability of each
new complex was determined using energy calculations as well as
short (5-10 ps) molecular dynamics simulations.
helices of erythropoietin are
longer and Epo is classified as a long chain helical-bundle subclass,
to which belongs growth hormone (23).
Site-directed Mutagenesis of Human GM-CSF and of GMR-
.
The human GM-CSF cDNA was mutated at the indicated positions (Table 1), expressed in Escherichia coli and purified as described (24). The GMR-
cDNA was cloned in the expression
vector pME18S (10). The cDNA for
c (KH97) was cloned in
the same vector, but without the neomycin selectable gene. Both
were provided by Dr. Toshio Kitamura (DNAX, Palo Alto, CA).
GMR-
cDNA bearing point mutations at position R280 were
generated by PCR site-directed mutagenesis. The forward oligos
used to generate the various point mutations were tcagagctgcagacgtcgaaatctt (GMR-
R280E), tcagagctgcagacgtcaagatctt (GMR
R280K), tcagagctgcagacgtcatgatctt (GMR-
R280M), and tcagagctgcagacgtccagatctt (GMR-
R280Q). In all reactions, the
reverse oligo used was gctttatttgtgaaatttgtgatg. The pME18 vector
containing the full GMR-
cDNA was used as a template for
PCR reactions and the annealing temperature was 58°C. Purified
PCR fragments of mutated GMR-
were digested by PstI and
inserted into the same site of the complete GMR-
cDNA
cloned into the pGEM7 vector (Promega Corp., Madison, WI).
Excised EcoRI fragments of pGEM7 vector containing a mutant
version of GMR-
were inserted into the same site of the
pME18S expression vector containing the full GMR-
cDNA.
Resulting clones were sequenced to confirm presence of the
point mutation and that no other mutations were present in the
PCR amplified region.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
D278AV279A), tgaagatcagagctgcacagcagcgcatct (GMR-
D278QV279Q), tgaagatcagagctgcagccgtccgcatct (GMR-
D278A), tgaagatcagagctgcaaacgtccgcatct (GMR-
D278N), atcagagctgcagacgtccgcgccgccaattgg (GMR-
I281AL282A), and atcagagctgcagacgtccgccagcagaattgg (GMR-
I281QL282Q).
Transient Expression of GMR-
and
c at the surface of NIH
3T3.
The GMR-
and
c cDNA were co-transfected by the
calcium phosphate method (12, 13) in exponentially growing
NIH 3T3 cells at a 1:1 ratio. In brief, 1 d before transfection,
200,000 cells were seeded in 60-mm tissue culture dishes. On the
day of transfection, 400 µl of DNA-Ca3(PO4)2 precipitate containing 12 µg of DNA was added to the culture and incubated for
16 h. Cells were then washed with PBS and split into replicate
24-well plates at a concentration of 75,000 cells/well. Each day
after plating, the cells were used for either binding, cross-linking,
or proliferation assays. Kinetics studies indicate the GM-CSF
binding and GM-CSF-dependent cell proliferation was optimal
on day 2 after transfection (data not shown). This time point was
selected for all subsequent experiments.
were isolated as described previously (24).
Iodinated GM-CSF Binding Assays.
Purified recombinant GMCSF was iodinated with the Bolton-Hunter reagent (DuPont-
New England Nuclear, Wilmington, DE). The specific activity of
the radioligand was determined by radioimmunoassay (7) and
confirmed independently by ELISA (25). NIH 3T3 cells were
co-transfected with wild-type or mutant GMR-
and
c chain by the Ca-PO4 method as described. After an overnight incubation, transfected cells were seeded to half confluency in 24-well
culture dishes. 2 d after transfection, ligand-binding assay was
performed at 4°C for 3 h in IMDM (without bicarbonate) supplemented with 1% BSA. Nonspecific binding was determined in
the presence of 100-fold excess unlabeled GM-CSF. After binding, cells were washed twice with ice-cold PBS and collected by
the addition of 200 µl of trypsin. Concentrations of radioligands
used for all saturation curves were in the range of 20 pM-20 nM
as indicated. Complete competition curves were performed with
500 pM of wild-type radioligand and varying concentrations of
wild-type or mutant GM-CSF that were in the range of 0-40 nM.
Binding constants were estimated through computer modeling with
the program ALLFIT, based on a nonlinear curve fitting routine
as described previously (7, 9, 26).
Kinetics of GM-CSF Binding.
The association rate constants (Kon)
were estimated by analysis of the kinetics of association at three
different concentrations of radioligand for a time range of 5-120
min using the following equations. First, the kinetics of association for increasing concentrations of radioligand were subjected
to linear transformation using the equation ln (Be/[Be
Bt]) = Kob × t, where Be is the observed binding at equilibrium and Bt
the binding observed at a given time t. Linear regression of the
slopes of these lines (Kob) as a function of ligand concentrations
provided an estimate of the association rate constant Kon. For dissociation experiments, 125I-GM-CSF binding was performed at
equilibrium at a concentration of 2 nM of radioligand. Cells were
then incubated with a 100-fold excess of cold GM-CSF in
IMDM 1% BSA for time periods ranging from 5 to 110 min. Supernatants were removed before counting of bound GM-CSF.
The dissociation rate constant (Koff) was estimated using the following equation: ln (Bt/Bo) =
Koff × t where Bo is the specific
binding at equilibrium before dissociation, and Bt is the specific
binding remaining after a period of t minutes.
Immunodetection of GMR-
, Cell Proliferation, and c-fos Promoter
Assay.
Surface expression of wild-type and mutant GMR-
were quantitated by whole cell immunoperoxidase assay using the
monoclonal mouse anti-human GMR-
(Upstate Biotechnology
Inc., Lake Placid, NY) as described previously (12). Cell proliferation was assessed by tritiated thymidine (DuPont-New England
Nuclear) incorporation at a final concentration of 3 µCi/ml in
serum-free medium (13) 48 h after transfection. The wild-type
c-fos promoter luciferase reporter construct (3 µg) (17) was cotransfected with the various GMR-
(3 µg) and wild-type
c (3 µg) in NIH 3T3 by the calcium-phosphate method. Transiently
transfected cells were then incubated for 24 h in serum-free medium
in the presence or absence of GM-CSF, lysed, and luciferase activity
was determined in nuclear extract as described (13) after adjustment
for growth hormone activity driven by the Rous sarcoma virus
LTR (2 µg), which was co-transfected as an internal control.
The initial event in GH
binding to its receptor is the association of site 1 on GH
with GHRI to form a 1:1 complex (binding affinity, dissociation constant [Kd] = 0.3 nM), followed by the association of site 2 with GHR molecule 2 (GHRII) to form a
ternary complex GH-GHR2 (27, 28). The first binding
step involving GHRI results in the burial of a 1,230-Å surface, whereas only 900 Å is buried on binding of GHRII,
consistent with a higher affinity of interaction of GHRI
with site 1. The modeling for GMR-
is therefore based
on GHRI interaction with site 1 and for
c on GHRII interaction with site 2. Our model identifies a contact surface
between
c and the ligand that includes H367 on
c (29, 30) and residue E21 (31) on the ligand as previously documented (Fig. 1). Finally, domains of the ligand that appear
to be involved in intermolecular contacts correspond to
those identified previously through the use of human
mouse chimeras (32), and of truncated GM-CSF (33) i.e.,
helix A, the AB loop, and helix D.
(left) and membrane proximal
CRM of
c (right) are shown
complexed with GM-CSF, each receptor chain being organized
in two fibronectin-like domains with seven
strands. This representation of the GM-GMR
complex is based on the structure
of the GH-GHR2 complex and
was generated as described in the
Materials and Methods.
helices
are shown in blue and
strands
in red. Two basic surface residues (white) that are potentially
involved in electrostatic interaction with surface residues (magenta) on the ligand are highlighted. The location of the
conserved WSXWS motif is
shown in green. R275 located
on the F
strand, potentially involved in
-cation interaction with the two Trp residues of the
WSSWS box (similarly observed in the crystal structure of EpoR
complexed with a peptide
ligand, 40), is shown in blue.
Importance of the Negative Charge at Position 112 of GMCSF Defined by Site-directed Mutagenesis.
Modeling identified several hydrophilic and charged surface residues of
helix D of GM-CSF as potential contact points with GMR-
: E108, N109, K111, and D112. Sequence analysis
indicates that these are aligned with residues that are shown
to be at the interface of growth hormone with GHRI (28).
Mutations at two of these residues on GM-CSF, E108 and
D112, were previously shown to decrease ligand-receptor
binding (24). We therefore generated further mutations at
all four positions identified by modeling. Quantitative analysis of GM-CSF binding to CHO cells stably expressing GMR-
alone was determined through complete competition curves for each mutant using wild-type radioligand as
a marker (Table 1). Our data indicate that charge removal
(Lys
Ala; Lys
Gln) or charge reversal (Lys
Glu) at residue K111 did not significantly affect GM-GMR-
recognition. Similarly, mutations at positions E108 and N109 resulted only in a 2-9-fold shift in affinity as compared to
wild-type ligand. Finally, the most drastic effect was seen
with the D112 mutants; there was a 12-800-fold shift in
Kd depending on the mutation, and the rank order was
D112N < D112A < D112K. Thus, the least affected was
the Asp to Asn mutation, which represents a shift in isoelectric point from 3 to 5.4. In addition, the Kd of Asp to
Ala substitution was only slightly higher than that of the
Asn mutant. In contrast, it is revealing that the charge reversal mutants (Asp
Lys and Asp
Arg) resulted in a drastic shift in Kd to the right. This rank order indicates that
the interaction between D112 and the receptor is mainly
electrostatic.
and D112 of the Ligand.
Because of the importance of the charge at position 112 of
the ligand, the residues surrounding D112 were further
evaluated in the ligand-receptor binding pocket of the
three-dimensional GM-GMR model shown in Fig. 1. The
acidic residue D112 is oriented towards GMR-
and is positioned at a distance of 3-4.7 Å from the basic residue
R280. The estimated distance remains within the possibility of intermolecular interaction at this position. For example, E21 on GM-CSF is located within 4.19 Å of H367 on
c. We therefore proceeded to site-directed mutagenesis of
R280 of GMR-
.
R280 Mutants.
Several mutations were introduced at this position on the basis
of charge conservation (R280K), charge removal (R280Q),
and hydrophilic to hydrophobic conversion (K280M) or
charge reversal (R280E). NIH 3T3 cells were transiently
transfected with these various GMR-
mutants alone and
submitted to GM-CSF binding assays. All of the mutants
showed a complete loss of specific binding compared to the
wild-type GMR-
chain at 2 nM of iodinated GM-CSF (Fig. 2 A), a concentration shown to be in the range of the
Kd of the low affinity GM-CSF binding site. Even at high
concentrations of GM-CSF (i.e., 8-20 nM) we did not detect any specific binding for three mutants tested, R280K,
R280M, and R280E (data not shown). All GMR-
R280
mutants were detected by the anti-GMR-
antibody in an
immunoperoxidase assay (Fig. 2 B). This indicates that the mutations did not induce important structural changes or
modification of the expression level of GMR-
. Furthermore, mutation of another surface Arg into Gln, R258Q,
did not affect ligand binding in the absence (data not
shown) or in the presence of
c (see Table 3). These data
underscore the crucial role of R280 in GM-CSF binding
by GMR-
.
. NIH
3T3 cells were transiently transfected with wild-type or mutant forms of the GMR-
chain (R280K, R280Q, R280M, R280E) as described in
Materials and Methods. (A) Triplicate cultures of transfected or nontransfected (N.T.) cells were incubated with 2 nM of 125I-GM-CSF. Nonspecific binding was determined by incubation with 2 nM 125I-GM-CSF and
100-fold excess of nonradiolabeled ligand. The residual amount of
125I-GM-CSF binding (<50 cpm) was reproducibly observed in nontransfected NIH 3T3 cells due to incomplete competition of nonspecific
binding. (B) Triplicate cultures of transfected or nontransfected (N.T.) cells were tested for GMR-
surface expression using an immunoperoxidase assay as described in Materials and Methods. There is a low level of
endogenous peroxidase activity (<0.04) in untransfected cells because the
surface expression of GMR-
was determined on intact cells.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
or R280M mutant co-transfected with wildtype
c. Linear transformation of the dissociation curves are shown in
upper panel and of the association curves in lower panel. The slopes of
theses lines provide an estimate of the dissociation rate constants (Koff) and
the association rate constants (Kon), respectively, shown in Table 3. B0,
GM-CSF-specific binding at time 0; Bt, GM-CSF specifically bound at
time t; Kob, the slope of ln (Beq/[Beq
Bt]) as a linear function of t; Beq,
GM-CSF-specific binding at equilibrium; WT, wild type.
Physical Interaction of Mutated GMR-
with
c Restores
Ligand Binding with Intermediate to Low Affinity.
GM-CSF
binding assays were performed with mutated GMR-
and
c. Surprisingly, specific binding was detected in all cases, but was drastically reduced as compared to the wild-type
receptor (Fig. 3 and Table 2). Cotransfection of wild-type
GMR-
and
c results in both high and low affinity GMCSF binding (6). In contrast, all GMR-
R280 mutants
exhibit a single GM-CSF binding site of intermediate to low
affinity with Kds in the following order: R280K < R280Q < R280M < R280E. The extensive loss of binding of
GMR-
R280E in presence of
c indicates a charge effect
at this position. As
c alone does not bind the ligand (data not shown), one can conclude that a mutated GMR-
can associate with wild-type
c to form a lower affinity complex.
co-transfected with wild-type or mutant
c. NIH 3T3 cells were transiently cotransfected with either wild-type or mutant GMR-
R280M and wildtype
c or
cH367A. 125I-GM-CSF saturation assays were performed as
described in Materials and Methods and Table 2. Data are typical of at
least two independent experiments. The curves passing through the data
were calculated with the program ALLFIT (9, 26). For wild-type
and
c, data were better described by a two-binding site model (high and low
affinity), whereas the data observed with
R280M mutant and wild-type
c were better described by a one binding site model (low affinity only).
There was no binding when
R280M were coexpressed with
H367A.
Kd values obtained for all GMR-
mutants are shown in Table 2.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
R280 mutants and
c. (Top) NIH 3T3 cells were
co-transfected with GMR-
R280 mutants and
c. Transfected cells were
then incubated for 40 h in serum-free medium supplemented with the indicated concentrations of GM-CSF. Cell proliferation was evaluated by [3H]thymidine incorporation as described in Materials and Methods. Data
are the mean of triplicate cultures. For each point, the standard error was
no more 15% of mean values. (Bottom) NIH 3T3 cells were transfected
with GMR-
mutants,
c, and c-fos promoter reporter construct. Transfected cells were then incubated for 24 h in serum-free medium supplemented with the indicated concentrations of GM-CSF. c-fos promoter
activity was evaluated by measuring luciferase activity in cell extracts as
described in Materials and Methods. Data are the mean of duplicate cultures.
Association between GMR-
and
c may create additional contact points between GMR-
and the ligand itself,
in addition to R280. To address this question, we cotransfected the mutant
R280M with either wild-type
c or
H367A that can no longer form a high affinity GM-CSF
complex. In contrast to wild-type
c, cells expressing
R280M and
H367A were unable to bind GM-CSF
(Fig. 3). Hence, preassociation with
c is unlikely to create
additional contact points between GMR-
and the ligand
apart from those that are affected by the mutations.
.
Previous observations (5, 34) suggest
that the difference in Kd between low (GMR-
alone) and
high (GMR-
-
c) affinity GM-CSF binding sites is mainly
due to differences in the dissociation rate constants, whereas
the association rate constants are in the same range. We
therefore compared the binding kinetics of mutant GMR
R280M with that of wild-type GMR-
. The association rate constant (on rate) was 10-fold lower for the mutant receptor, as compared to the wild-type receptor (Fig. 4 and
Table 3). In contrast, there was only a twofold difference in
the dissociation rate constants (off rate). These results suggest that the 20-30-fold decrease in binding affinity observed for the GMR-
R280M mutant compared to wildtype GMR is mainly due to a decrease in the association rate
constant. In comparison, mutation of another Arg residue, R258Q, did not significantly affect the kinetic constants
(Table 3). Thus, the charge at position R280 of GMR-
is
essential for ligand recognition and association, which is
different from the role assigned to
c, i.e., stabilization of
the complex through a decrease in the dissociation rate of
the ligand.
The contribution of other residues in the F
-G
loop surrounding R280 was next defined (Table 3). Neither Ile281
nor Leu282 were affected by alanine substitution, whereas
a change to a hydrophilic residue (Gln) slightly affected the
on rate. We also found that the negative charge at position
278 was almost as important as the positive charge at position 280 since mutation from Asp to Asn, which removed
the charge, reduced the on rate by 10-fold. The immunoreactivity of D278 mutants with the monoclonal antiGMR-
was reproducibly two- to three-fold higher than
that of wild-type GMR-
suggesting that the consequence
of the mutation was not confined to the Asp residue, but
may also have affected a local structure. Indeed the immunoreactivity of all other mutations was unaffected, and furthermore, their surface expression was not affected in binding assays (as assessed by the maximum binding capacity, data
not shown). Thus charge removal at position 278 may result
in a better unfolding of the epitope recognized by anti-
GMR-
. The three-dimensional model indicates that Asp278 is oriented towards Lys191 located in the linker region between the two fibronectin folds of GMR-
, suggesting a
role in stabilization of GMR-
structure through electrostatic interaction.
R280-
c Complex.
A proliferation assay was performed on transiently transfected NIH 3T3 cells incubated for 40 h in serum-free medium in the absence or in the presence of GM-CSF. In
cells expressing the wild-type receptor, GM-CSF induces a
dose-dependent increase in thymidine uptake with a plateau stimulation at 1 nM (Fig. 5). When the wild-type
GMR-
chain was substituted by R280K, R280M, or
R280Q mutants, higher concentrations of GM-CSF were
needed to obtain a response, but a maximal induction of
2.5-fold could still be observed. For the R280E mutant, only
a weak proliferative response could be detected at 10 nM
of GM-CSF. The half-efficient concentrations for stimulation of cell proliferation were in the same range as the Kd
of the receptor complex (Table 2). Similarly, stimulation of
c-fos promoter activity by GM-CSF followed the shift in
Kd as above (Fig. 5). The mutated receptor is, therefore, still competent for initiating a biological response at concentrations of GM-CSF that are in the range of the Kd as
shown previously (3, 7). These data underscore the importance of GMR-
and of appropriate receptor assembly in
signaling. Furthermore, the threshold for biologic activity is
most likely governed by the affinity of ligand-receptor interaction.
In the present study, we provide evidence for an essential
contribution of R280 in establishing a salt bridge with
GM-CSF when binding was performed in the absence of
c. Similarly, Asp112 on the ligand appears to play a crucial
role in receptor binding. The proximity of R280 on
GMR-
with Asp112 on the ligand strongly supports the
possibility of electrostatic interaction between these two
residues. In the presence of wild-type
c, our data indicate
that R280 contributes to high affinity GM-CSF binding since mutations at this position result in a significant shift towards low affinity binding. Together, our observations
indicate the crucial role of a single charged residue at the
F
-G
loop of GMR-
in GM-CSF binding R280 that interacts with an acidic residue on the ligand, most likely
Asp112.
and
Asp112 of GM-CSF.
Mutagenesis of a single residue can
potentially introduce structural perturbations that alter protein-protein interaction at positions not directly involved
in establishing contact points. In the case of GMR-
, given
the large size of Arg and its location at the tip of the loop,
we chose to substitute Arg with residues of larger chain size
than Ala, which is a common choice for substitution, for the
purpose of steric complementarity. In addition, all mutant proteins reacted equally with a neutralizing monoclonal antibody directed against wild-type GMR-
. This suggests that
mutations at position R280 of GMR-
are likely localized
to this residue without affecting the overall structure of the
protein.
The importance of the charge at positions R280 of
GMR-
and Asp112 of the ligand was inferred from the
rank order of a series of mutations that introduce a reduction in charge, a change in hydrophilic to hydrophobic residue, or simply charge reversal. Among GMR-
mutants
evaluated in the context of wild-type
c, R280M and
R280Q behaved similarly because of a decrease in charge at
this position, whereas the conservative mutation R280K
was the least affected, and the charge reversal R280E was
drastically shifted in affinity. Similarly, mutations at Asp112
of GM-CSF displayed the expected rank order with the
charge reversal being the most drastically affected, whereas
homologous mutations at positions not crucial for receptor
binding, i.e., N109 or K111, were almost silent. Nonetheless, we were not able to observe a complementation between GM-CSF-D112K and GMR-
-R280E mutants, possibly because mutations on the ligand were more exacerbated in phenotype due to their locating on the surface of
a structural element, i.e., an
helix. Together, our observations suggest a crucial role for the charge at these positions, not only for appropriate electrostatic interaction, but
also for the local context of the ligand-binding pocket.
Contributes to Ligand Recognition by a
Factor of 10.
The importance of electrostatic interactions
in hormone-receptor recognition was previously identified
for hGH. Indeed, mutations at Arg residues present on hGH
were shown to affect association by a factor of 20, although
each Arg individually may not have contributed by more
than a factor of 2-3 to the on rate (35). In contrast, we
identify here a single Arg at position 280 on GMR-
that
contributes to the on rate by a factor of 10, and to the off
rate by only a factor of 2, indicating its crucial role in ligand
recognition. Interestingly, the nature of ligand binding for
the GMR-
R280M-wild-type
c complex is intrinsically
different from that established for wild-type GMR-
alone,
despite the fact that the Kds for both receptors were in the
same nM range. The low affinity of GMR-
binding to
the ligand in the absence of
c may be attributed mainly to
a major difference in the off rate when compared to that of
the GMR-
-
c complex (5, 8, and our unpublished results), whereas the on rates were not significantly different, suggesting that recruitment of
c into the complex results
in stabilization. In contrast, mutations at position R280 of
GMR-
resulted in a drastic decrease in the on rate when
wild-type
c was present, indicating its crucial role in the
association step. Our observations further underscore the
importance of kinetic studies for molecular recognition processes.
Mutations of R280 differ from the mutations observed
with Asp278 with regards to their immunoreactivities with
a monoclonal antibody shown previously to prevent GMCSF binding. Thus, all R280 mutations and wild-type
GMR-
reacted with the antibody, whereas all D278 mutants displayed enhanced immunoreactivity, suggesting a
structural difference and the possibility of intrachain salt
bridging with a positively charged residue, Lys191, on the linker region of GMR-
. It is thus possible that the
turn
which presents R280 to the ligand is held in place by two
structural elements, a salt bridge conferred by Asp278 and
the
-charge interactions assigned to the WSXWS box
with a conserved Arg in the F
strand, as discussed underneath (Fig. 1 and reference 36).
and
c Preassociate in the Absence of Ligand.
The fact that GMR-
R280 mutants do not bind GM-CSF
when transfected alone but do so in the presence of
c, is
consistent with the view that GMR-
and
c associate in
the absence of GM-CSF (9, 37). This preassociation is
nonetheless of low affinity, and the presence of ligand results in stabilization of the
-
complex by 1,000-fold (9).
Although
c does not bind GM-CSF by itself, previous
data indicate that it can do so when associated with GMR-
.
The contact point was identified by scanning mutagenesis of GM-CSF (31) and sequence alignment of GHR with
c
(19). Consistent with this result, our data clearly indicate
that
c binds the ligand even when associated with an
chain that, by itself, no longer recognizes the ligand. In addition, our observations also suggest that the association of
GMR-
with
c is unlikely to generate additional GMCSF binding sites on GMR-
beyond those affected by the
R280 mutations.
-G
Loop of Cytokine Receptors in Ligand
Binding.
Evidence is provided here that mutagenesis of
members of the superfamily of cytokine receptors can be
directed to specific residues that are predicted to be at the
ligand-receptor interface through homology modeling with
the x-ray crystal structure of the hGH bound to its receptor. It was previously shown that the functional interface of
growth hormone with its receptor is much smaller than the
physical interface and that electrostatic interactions are crucial for the first step in ligand-receptor recognition (35). Our
data underscores the importance of a single charged residue
at the F
-G
loop of the fibronectin-like domain of the GM-CSF receptor, R280. For the GM-CSF receptor complex, data reported here for GMR-
and elsewhere for
c
and GM-CSF indicate that the functional interface may be
restricted to a limited number of residues, GMR-
R280,
c His367 (29, 30) and Tyr421 (38), and GM-CSF Asp112
and Glu21 (31). Furthermore, the on/off kinetics suggest
that the GMR-
R280-GM-CSFD112 interaction may determine the recognition step, whereas the association with
c would stabilize the complex possibly through interaction of H367 and Tyr421 with the ligand.
Primary sequence alignment of the three closest members of the cytokine receptors superfamily, IL-3R-
, -5R-
,
and GMR-
highlights the presence of one Arg at the F
-G
loop in an otherwise diverging context (Fig. 6). Interestingly, the IL-3 and -5 receptor complex models reveal that
a negatively charged residue (Glu or Asp) on the ligand is
in close contact with the Arg of the F
-G
loop, indicating
a potential electrostatic interaction. Thus, the contribution of the Arg residue to ligand recognition may also be extended to these receptors. Sequence divergence in this loop
among the GM-CSF, IL-3, and -5
chain receptors suggest that this region is likely to be important for the observed specificity of the corresponding receptor subunit.
-G
loop of the second fibronectin domain of the GM-CSF, IL-3, and -5
chain receptors: sequence alignment and three-dimensional models and homology modeling of the erythropoietin receptor complex with its ligand. The alignment is adapted from Bazan (14) and Goodall
et al. (19). Residues in bold are shown through site-directed mutagenesis to be important for proper ligand binding (humgmcsfr, GMR-
, shown herein;
humil6r, IL-6R-
(17); fn10, fibronectin type III tenth repeat (16); humepor, EpoR (41, 42). Conserved residues within the F
and G
strands are boxed,
as well as the conserved WSXWS sequence. Comparison of the F
-G
loop (yellow) facing helix D (red) of the ligand in the GMR-
, IL-3R-
, and IL-5R-
models, highlights a possible electrostatic interaction between a positively charged residue, Arg (green), and a negatively charged residue, Asp or Glu (blue).
In GMR-
, R280 is at the tip of the
turn pointing towards the ligand, whereas the aspartic acid (D278, green) is in the vicinity of a lysine (K191, magenta) located in the linker region between the two fibronectin domains. Note that in the IL-3 model, an aromatic residue on the F
-G
loop, Tyr261, is
close to another aromatic residue, Phe113 from helix D. In the lower right panel, the extracellular domains of the two Epo receptor chains are shown
complexed with the modelized Epo hormone. The Epo-EpoR2 complex is based on the structure of the GH-GHR2 complex, and was generated as described in the Materials and Methods. The
-charge interaction in EpoR consisting of one arginine (white) and two tryptophan (green) from the WSXWS
motif is illustrated. The two disulfide bridges formed between the four conserved cysteine are shown in blue.
Furthermore, the F-G loop has been shown to contain
binding determinants. Short peptides containing the sequence Arg-Gly-Asp (RGD) from the F-G loop of the
tenth fibronectin type III repeat specifically block interactions with integrins by binding integrins (39). The F
-G
loop of IL-6R-
contains residues that are critical for IL-6
binding: E278-F279 and G282-E283 (17). Similarly, recent data suggest the involvement of Y421 at the F
-G
loop of
c in high-affinity GM-CSF binding (38). Moreover, the
F
-G
loop of cytokine receptors has, at its COOH-terminal end, a highly conserved WS box that plays a crucial role
in maintaining the structure required for the presentation
of side chains involved in ligand binding (36).
The modeling of the Epo receptor and hormone was
performed using the same technique to compare our modeling approach with a cytokine receptor of known crystal
structure (Fig. 6). Our model for EpoR illustrates the
-cation
interaction between the two Trp of the WSXWS motif
and an Arg of the F' strand that was also observed in the
crystal structure (40). Furthermore, the two disulfide bridges
identified between the four conserved Cys in the crystal
structure are present in our model. Finally, our EpoR model
shows two phenylalanines, Phe93 (E-F loop) and Phe205
(F
-G
loop), that point towards the hormone consistent
with their locating within the hydrophobic core formed
between the peptide and the receptor in the crystal structure (40) as well as their importance in ligand binding (41, 42).
In summary, the presence of a highly conserved structural element in the F
-G
loop, the WS motif, imposes a
turn to a loop that is highly divergent in sequence, allowing the conserved Arg to be oriented towards the ligand
and further strengthens the possibility that this loop may be
involved in ligand interaction. The presence of the integrin-binding determinant RGD in the F-G loop of the fibronectin, which does not have a WS box, further underscores the crucial role of electrostatic interactions in ligand
binding for cytokine receptors with fibronectin-like domains.
Address correspondence to Dr. Trang Hoang, Clinical Research Institute of Montreal, 110 Pine Ave. West, Montréal, Québec H2W 1R7, Canada.
Received for publication 26 December 1996 and in revised form 27 March 1997.
C. Cadieux and D. Rajotte contributed equally to this work.
c,
common; aa, amino acid; CHO,
Chinese hamster ovary; CRM, cytokine receptor motif; GH, growth
hormone; GMR, GM-CSF receptor; hGH, human growth hormone; NIH, National Institutes of Health.
This work was supported by grants from the Medical Research Council of Canada, and studentships from the Cancer Research Society Inc. (D. Rajotte) and Biron Diagnostiques (C. Cadieux). T. Hoang is a Senior Scientist from the Fonds de la Recherche en Santé du Québec, Quebec, Canada.
The authors wish to thank Drs. Peter W. Schiller, Yvan Guidon, and Rafick-Pierre Sékaly for critical comments, and Minh Dang Nguyen for his help with GMR-
mutagenesis. The expert secretarial assistance of
Magali Domin is acknowledged.
| 1. |
Metcalf, D..
1993.
Hematopoietic regulators: redundancy or
subtlety?
Blood.
82:
3515-3523
|
| 2. |
Gasson, J.C..
1991.
Molecular physiology of granulocyte-
macrophage colony-stimulating factor.
Blood.
77:
1131-1145
|
| 3. |
Rajotte, D.,
P. Haddad,
A. Haman,
E.J. Cragoe, and
T. Hoang.
1992.
Role of protein kinase C and the Na+/H+ antiporter in suppression of apoptosis by granulocyte macrophage
colony stimulating factor and interleukin-3.
J. Biol. Chem.
267:
9980-9987
|
| 4. |
Caceres-Cortes, J.,
D. Rajotte,
J. Dumouchel,
P. Haddad, and
T. Hoang.
1994.
Product of the steel locus suppresses apoptosis in hemopoietic cells. Comparison with pathways activated by granulocyte macrophage colony-stimulating factor.
J. Biol. Chem.
269:
12084-12091
|
| 5. | Gearing, D.P., J.A. King, N.M. Gough, and N.A. Nicola. 1989. Expression cloning of a receptor for human granulocyte- macrophage colony-stimulating factor. EMBO (Eur. Mol. Biol. Organ.) J. 8: 3667-3766 [Medline]. |
| 6. |
Hayashida, K.,
T. Kitamura,
D.M. Gorman,
K. Arai,
T. Yokota, and
A. Miyajima.
1990.
Molecular cloning of a second subunit of the receptor for human granulocyte-macrophage colony-stimulating factor (GM-CSF): reconstitution
of a high affinity GM-CSF receptor.
Proc. Natl. Acad. Sci.
USA.
87:
9655-9659
|
| 7. |
Onetto-Pothier, N.,
N. Aumont,
A. Haman,
C. Bigras,
G.G. Wong,
S.C. Clark,
A. De Léan, and
T. Hoang.
1990.
Characterization of granulocyte-macrophage colony-stimulating
factor receptor on the blast cells of acute myeloblastic leukemia.
Blood.
75:
59-66
|
| 8. | Nicola, N.A., and D. Metcalf. 1991. Subunit promiscuity among hemopoietic growth factor receptors. Cell. 67: 1-4 [Medline]. |
| 9. |
Hoang, T.,
A. De Lean,
A. Haman,
V. Beauchemin,
T. Kitamura, and
S.C. Clark.
1993.
The structure and dynamics of
the granulocyte macrophage colony-stimulating factor receptor defined by the ternary complex model.
J. Biol. Chem.
268:
11881-11887
|
| 10. | Eder, M., J.D. Griffin, and T.J. Ernst. 1993. The human granulocyte-macrophage colony-stimulating factor receptor is capable of initiating signal transduction in NIH 3T3 cells. EMBO (Eur. Mol. Biol. Organ.) J. 12: 1647-1656 [Medline]. |
| 11. |
Sasaki, K.,
S. Chiba,
Y. Hanazono,
H. Mano,
Y . Yazaki, and
H. Hirai.
1993.
Coordinate expression of the and chains of human granulocyte-macrophage colony-stimulating
factor receptor confers ligand-induced morphological transformation in mouse fibroblasts.
J. Biol. Chem.
268:
13697-13702
|
| 12. |
Lia, F.,
D. Rajotte,
S.C. Clark, and
T. Hoang.
1996.
A dominant negative GM-CSF receptor chain reveals the multimeric structure of the receptor complex.
J. Biol. Chem.
271:
28287-28293
|
| 13. |
Rajotte, D.,
H.B. Sadowski,
A. Haman,
K. Gopalbhai,
S. Meloche,
L. Liu,
G. Krystal, and
T. Hoang.
1996.
Contribution of both STAT and SRF/TCF to c-fos promoter activation by GM-CSF.
Blood.
88:
2906-2916
|
| 14. |
Bazan, J.F..
1990.
Structural design and molecular evolution
of a cytokine receptor superfamily.
Proc. Natl. Acad. Sci.
USA.
87:
6934-6938
|
| 15. |
de Vos, A.M.,
M. Ultsch, and
A.A. Kossiakoff.
1992.
Human
growth hormone and extracellular domain of its receptor:
crystal structure of the complex.
Science (Wash. DC).
255:
306-312
|
| 16. | Leahy, D.J., I. Aukhil, and H.P. Erickson. 1996. 2.0 Å crystal structure of a four-domain segment of human fibronectin encompassing the RGD loop and synergy region. Cell. 84: 155-164 [Medline]. |
| 17. | Yawata, H., K. Yasukawa, S. Natsuka, M. Murakami, K. Yamasaki, M. Hibi, T. Taga, and T. Kishimoto. 1993. Structure-function analysis of human IL-6 receptor: dissociation of amino acid residues required for IL-6 binding and for IL-6 signal transduction through gp130. EMBO (Eur. Mol. Biol. Organ.) J. 12: 1705-1712 [Medline]. |
| 18. |
Quelle, F.W.,
N. Sato,
B.A. Witthuhn,
R.C. Inhorn,
M. Eder,
A. Miyajima,
J.D. Griffin, and
J.N. Ihle.
1994.
JAK2
associates with the c chain of the receptor for granulocyte-
macrophage colony-stimulating factor, and its activation requires the membrane-proximal region.
Mol. Cell. Biol.
14:
4335-4341
|
| 19. | Goodall, G.J., C.J. Bagley, M.A. Vadas, and A.F. Lopez. 1993. A model for the interaction of the GM-CSF, IL-3 and IL-5 receptors with their ligands. Growth Factors. 8: 87-97 [Medline]. |
| 20. |
Diederichs, K.,
T. Boone, and
P.A. Karplus.
1991.
Novel
fold and putative receptor binding site of granulocyte-macrophage colony-stimulating factor.
Science (Wash. DC).
254:
1779-1782
|
| 21. | Rozwarski, D.A., A.M. Gronenborn, G.M. Clore, J.F. Bazan, A. Bohm, A. Wlodawer, M. Hatada, and P.A. Karplus. 1994. Structural comparisons among the short-chain helical cytokines. Structure (Lond.). 2: 159-173 [Medline]. |
| 22. | Feng, Y., B.K. Klein, and C.A. McWherter. 1996. Threedimensional solution structure and backbone dynamics of a variant of human interleukin-3. J. Mol. Biol. 259: 524-541 [Medline]. |
| 23. | Bazan, J.F.. 1990. Hemopoietic receptors and helical cytokines. Immunol. Today. 11: 350-354 [Medline]. |
| 24. |
Hercus, T.R.,
B. Cambareri,
M. Dottore,
J. Woodcock,
C.J. Bagley,
M.A. Vadas,
M.F. Shannon, and
A.F. Lopez.
1994.
Identification of residues in the first and fourth helices of human
granulocyte-macrophage colony-stimulating factor involved
in biologic activity and in binding to the - and -chains of
its receptor.
Blood.
83:
3500-3508
|
| 25. |
Rodriguez-Cimadevilla, J.C.,
V. Beauchemin,
L. Villeneuve,
L. Letendre,
A. Shaw, and
T. Hoang.
1990.
Coordinate secretion of interleukin-1 and granulocyte-macrophage colony stimulating factor by the blast cells of acute myeloblastic
leukemia: role of interleukin-1 as an endogenous inducer.
Blood.
76:
1481-1489
|
| 26. |
DeLéan, A.P.J.,
P.J. Munson, and
D. Rodbard.
1978.
Simultaneous analysis of families of sigmoidal curves: application to
bioassay, radioligand assay, and physiological dose-response
curves.
Am. J. Physiol.
235:
E97-E102
|
| 27. |
Wells, J.A..
1996.
Binding in the growth hormone receptor
complex.
Proc. Natl. Acad. Sci. USA.
93:
1-6
|
| 28. |
Clackson, T., and
J.A. Wells.
1995.
A hot spot of binding energy in a hormone-receptor interface.
Science (Wash. DC).
267:
383-386
|
| 29. |
Woodcock, J.M.,
B. Zacharakis,
G. Plaetinck,
C.J. Bagley,
S. Qiyu,
T.R. Hercus,
J. Tavernier, and
A.F. Lopez.
1994.
Three residues in the common chain of the human GMCSF, IL-3 and IL-5 receptors are essential for GM-CSF and
IL-5 but not IL-3 high affinity binding and interact with
Glu21 of GM-CSF.
EMBO (Eur. Mol. Biol. Organ.) J.
13:
5176-5185
[Medline].
|
| 30. |
Lock, P.,
D. Metcalf, and
N.A. Nicola.
1994.
Histidine-367
of the human common chain of the receptor is critical for
high-affinity binding of human granulocyte-macrophage colony-stimulating factor.
Proc. Natl. Acad. Sci. USA.
91:
252-256
|
| 31. | Lopez, A.F., M.F. Shannon, T. Hercus, N.A. Nicola, B. Cambareri, M. Dottore, M.J. Layton, L. Eglinton, and M.A. Vadas. 1992. Residue 21 of human granulocyte-macrophage colony-stimulating factor is critical for biological activity and for high but not low affinity binding. EMBO (Eur. Mol. Biol. Organ.) J. 11: 909-916 [Medline]. |
| 32. |
Kaushansky, K.,
S.G. Shoemaker,
S. Alfaro, and
C. Brown.
1989.
Hematopoietic activity of granulocyte-macrophage
colony-stimulating factor is dependent upon two distinct regions of the molecule: functional analysis based upon the activities of interspecies hybrid growth factors.
Proc. Natl. Acad.
Sci. USA.
86:
1213-1217
|
| 33. | Clark-Lewis, I., A.F. Lopez, L.B. To, M.A. Vadas, J.W. Schrader, L.E. Hood, and S.B. Kent. 1988. Structure-function studies of human granulocyte-macrophage colony-stimulating factor. Identification of residues required for activity. J. Immunol. 141: 881-889 [Abstract]. |
| 34. |
Park, L.S.,
D. Friend,
S. Gillis, and
D.L. Urdal.
1986.
Characterization of the cell surface receptor for granulocyte-macrophage colony-stimulating factor.
J. Biol. Chem.
261:
4177-4183
|
| 35. | Cunningham, B.C., and J.A. Wells. 1993. Comparison of a structural and a functional epitope. J. Mol. Biol. 234: 554-563 [Medline]. |
| 36. |
Baumgartner, J.W.,
C.A. Wells,
C.M. Chen, and
M.J. Waters.
1994.
The role of the WSXWS equivalent motif in growth
hormone receptor function.
J. Biol. Chem.
269:
29094-29101
|
| 37. |
Ronco, L.V.,
S.L. Silverman,
S.G. Wong,
D.J. Slamon,
L.S. Park, and
J.C. Gasson.
1994.
Identification of conserved
amino acids in the human granulocyte-macrophage colonystimulating factor receptor subunit critical for function. Evidence for formation of a heterodimeric receptor complex
prior to ligand binding.
J. Biol. Chem.
269:
277-283
|
| 38. |
Woodcock, J.M.,
C.L. Bagley,
B. Zacharakis, and
A.F. Lopez.
1996.
A single tyrosine residue in the membrane proximal domain of the GM-CSF, IL-3 and IL-5 receptor common chain is necessary and sufficient for high affinity
binding and signalling by all three ligands.
J. Biol. Chem.
271:
25999-26006
|
| 39. | Ruoslahti, E.. 1996. Integrin signaling and matrix assembly. Tumor Biol. 17: 117-124 . |
| 40. | Livnah, O., E.A. Stura, D.L. Johnson, S.A. Middleton, L.S. Mulcahy, N.C. Wrighton, W.J. Dower, L.K. Jolliffe, and I.A. Wilson. 1996. Functional mimicry of a protein hormone by a peptide agonist: the EPO receptor complex at 2.8 Å. Science (Wash. DC). 273: 464-471 [Abstract]. |
| 41. |
Middleton, S.A.,
D.L. Johnson,
R. Jin,
F.J. Mahon,
A. Collins,
J. Tullai,
R.H. Gruninger,
L.K. Jolliffe, and
L.S. Mulcahy.
1996.
Identification of a critical ligand binding determinant of the human erythropoietin receptor: evidence for
common ligand binding motifs in the cytokine receptor family.
J. Biol. Chem.
271:
14045-14054
|
| 42. | Middleton, S.A., D.L. Johnson, F.X. Farrell, F.J. McMahon, R.H. Gruninger, J. Tullai, F.P. Barbone, O. Livnah, L.S. Mulcahy, I.A. Wilson, and L.K. Jolliffe. 1996. Critical erythropoietin (Epo) binding determinants on the Epo receptor also interact with an Epo mimetic peptide. Blood. 88 (Suppl.) 1:661a. (Abstr.) |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|