The Journal of Experimental Medicine
Torrey Pines Biolabs
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 196K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cella, M.
Right arrow Articles by Colonna, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cella, M.
Right arrow Articles by Colonna, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
© The Rockefeller University Press, 0022-1007/1997/5/1743/ $5.00
The Journal of Experimental Medicine, Volume 185, Number 10, May 19, 1997 1743-1751


Articles

A Novel Inhibitory Receptor (ILT3) Expressed on Monocytes, Macrophages, and Dendritic Cells Involved in Antigen Processing

Marina Cella*, Christian Döhring*, Jacqueline Samaridis*, Mark Dessing*, Manfred Brockhaus{ddagger}, Antonio Lanzavecchia*, and Marco Colonna*

From the * Basel Institute for Immunology, CH-4005 Basel, Switzerland; and {ddagger} Hoffmann-La Roche AG, CH-4002 Basel, Switzerland


   Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Immunoglobulin-like transcript (ILT) 3 is a novel cell surface molecule of the immunoglobulin superfamily, which is selectively expressed by myeloid antigen presenting cells (APCs) such as monocytes, macrophages, and dendritic cells. The cytoplasmic region of ILT3 contains putative immunoreceptor tyrosine-based inhibitory motifs that suggest an inhibitory function of ILT3. Indeed, co-ligation of ILT3 to stimulatory receptors expressed by APCs results in a dramatic blunting of the increased [Ca2+]i and tyrosine phosphorylation triggered by these receptors. Signal extinction involves SH2-containing protein tyrosine phosphatase 1, which is recruited by ILT3 upon cross-linking. ILT3 can also function in antigen capture and presentation. It is efficiently internalized upon cross-linking, and delivers its ligand to an intracellular compartment where it is processed and presented to T cells. Thus, ILT3 is a novel inhibitory receptor that can negatively regulate activation of APCs and can be used by APCs for antigen uptake.


Address correspondence to Marco Colonna, Basel Institute for Immunology, 487 Grenzacherstrasse, CH4005 Basel, Switzerland.

Engagement of B cell antigen receptor, TCR, and several Fc receptor (FcR) complexes by cognate ligands results in tyrosine phosphorylation of cytoplasmic immunoreceptor tyrosine-based activation motifs (ITAMs)1 (16). Phosphorylated ITAMs recruit and activate protein tyrosine kinases, which trigger a cascade of intracellular phosphorylation events leading to cellular activation. Immune cell responses are negatively regulated when stimulatory receptors are co-ligated to inhibitory receptors. These include the low affinity FcR for IgG, Fc{gamma}RIIB, and CD22 in B cells (710), the Ly-49 molecules, the killer cell inhibitory receptors (KIRs), the NKG2A/CD94 heterodimer in NK cells (1113), and glycoprotein (gp)49B1 in mast cells and NK cells (1416). All of these receptors are characterized by the presence of cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs; 17). Upon receptor engagement, cytoplasmic ITIMs are tyrosine phosphorylated, and subsequently bind the SH2 domain(s) of SHP-1 protein tyrosine phosphatase (1823) and/or SHIP inositol phosphatase (24), which mediate downregulation of cell activation.

Recently, we have described two new members of the immunoglobulin superfamily (Ig-SF), called immunoglobulin-like transcript 1 (ILT1) and ILT2 (25). These are homologous to bovine Fc{gamma}2 receptor (Fc{gamma}2R; 26), murine cell surface antigen gp49 (27, 14), human KIRs (2830), human Fc{alpha} receptor (Fc{alpha}R; 31) and map to human chromosome 19, as do the Fc{alpha}R and the KIRs. ILT1 and ILT2 are characterized by similar extracellular regions consisting of four Ig-SF domains. Their transmembrane and cytoplasmic domains, however, differ substantially. ILT1 has a charged residue of arginine within the transmembrane region, followed by a short cytoplasmic tail with no ITAMs or ITIMs. Similar characteristics are found in human Fc{alpha}RI and bovine Fc{gamma}2R, which trigger cell responses via associated signaltransducing, ITAM-containing subunits. Conversely, ILT2 has a long cytoplasmic tail, which contains putative ITIMs similar to those known to bind SHP-1 in KIRs. ILT1 and ILT2 also display different tissue distributions. Although ILT1 is predominantly expressed by myeloid cells, ILT2 is expressed by B cell lines. Thus, ILT1 and ILT2 may mediate activation of myeloid cell responses and inhibition of B cell activation, respectively.

Here we characterize a third member of the ILT family, called ILT3, which, similarly to ILT2, displays a long cytoplasmic tail containing putative ITIMs. By using an antiILT3 mAb, we have found that ILT3 is selectively expressed on myeloid APCs. Functional studies show that ILT3 behaves as an inhibitory receptor when cross-linked to a stimulatory receptor. A cytoplasmic component of the ILT3-mediated negative signaling pathway is the SH2containing phosphatase SHP-1, which becomes associated with ILT3 upon cross-linking. Furthermore, ILT3 is internalized and ILT3 ligands are efficiently presented to specific T cells, suggesting that ILT3 may be involved in antigen uptake and presentation.


   Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cells.
THP1 is a human myeloid cell line. C1R and 721.221 are MHC class I–deficient, EBV-transformed human B cell lines. Jurkat is a human T cell line. All of these cells were grown in RPMI, 10% FCS. Monocytes were prepared from PBMCs by adhesion to plastic. In brief, PBMCs were isolated from whole blood by Ficoll-Hypaque density gradient, washed with RPMI, resuspended at 5 x 106/ml in RPMI, 10% FCS and cultured in six-well plates for 1 h at 37°C. Nonadherent cells were removed by washing twice with RPMI. Adherent cells were cultured overnight in RPMI, 10% FCS supplemented with 50 ng/ml GM-CSF and 1,000 U/ml IL-4. Dendritic cells (DCs) were obtained from monocytes as previously described (32). Macrophages were obtained by culturing monocytes for 10 d in six-well plates at a concentration of 106 cells/ml in RPMI, 20% human serum supplemented with 1 ng/ml macrophage CSF (M-CSF) (33, 34).

cDNA Synthesis, Oligonucleotide Primers, PCR, and Cloning.
The 3' end of ILT3 was cloned by rapid amplification of cDNA 3' end (35). In brief, RNA was prepared from 721.221 and C1R cells as described (36) and single-strand cDNA was synthesized by reverse transcription of 1 µg of total RNA using Moloney murine leukemia virus reverse transcriptase and a (dT)17 adaptor in a reaction volume of 20 µl. cDNA was amplified by two nested PCRs. The 5' oligonucleotides were CCCCCAGCGACCCCCTGGA (nucleotide 926–944 of ILT2) and ACGGTGGCCTCAGGAGAGA (nucleotide 1003–1021 of ILT2) (25). In both PCRs, the 3' primer corresponded to the adaptor primer. PCRs (50 µl volume) contained 1 µl of total cDNA sample, PCR primers (0.5 µM each), 2'-deoxynucleoside 5'-triphosphates (125 µM each), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.01% gelatin, and 0.25 units of Taq polymerase. PCR was carried out for 35 cycles, each consisting of 1-min steps at 94, 55, and 72°C. Amplified products were gel purified in 1.2% agarose gel, cloned into pCRII (Invitrogen, San Diego, CA), and sequenced. The 5' end of ILT3 was cloned by two consecutive cycles of 5' rapid amplification of cDNA ends (35).

Production of ILT3 Human IgG1 Fusion Protein.
To produce ILT3 as a soluble fusion protein, we constructed a chimeric gene consisting of ILT3 extracellular domains and human IgG1 constant regions. The cDNA fragment encoding the ILT3 extracellular region was amplified by PCR from cloned plasmid DNA. The 5' primer (GATCGAATTCATGATCCCCACCTTCACGGCT) contained an EcoRI restriction site (italic) and the ILT3 start codon. The 3' primer (CTGATCAAGCTTATACTTACCCTCCCAGTGCCTTCTCAGACC) provided a HindIII restriction site (italic), a splice donor sequence, and seven ILT3 codons preceding the transmembrane domain. The ~800-bp PCR product was cut with EcoRI and HindIII, and ligated into an expression vector containing the exons for hinge, CH2 and CH3 region of human IgG1, the guanosine phosphotransferase gene conferring resistance to mycophenolic acid, and the {kappa} promoter for the expression in mouse myeloma (37). Transfections, selection of secreting transfectants, and purification of fusion protein from culture supernatants were performed as described (38).

Production of anti-ILT3 mAbs.
10-wk-old, female BALB/c mice (Iffa-Credo, L'Arbresle, France) received an initial injection of 100 µg of ILT3 human IgG1 fusion protein (ILT3-HuIgG1), mixed 1:1 (vol/vol) with Alu-Gel-S (Serva Biochemicals, Paramus, NJ), behind the neck. 4 wk later, they were given a booster immunization with the same immunogen, followed after 2 wk by a final injection of 100 µg of purified ILT3-HuIgG1. 3 d later, mice were killed and draining lymph node cells were isolated and fused with the myeloma fusion partner, Ag8.653, using polyethylene glycol 4000. Hybridoma supernatants were screened in two steps. First, an ELISA was performed using ILT3-HuIgG1 in the coating step and human-adsorbed alkaline phosphatase–labeled goat anti–mouse IgG as secondary antibody. Supernatants from clones that were positive in ELISA were then tested by FACS® analysis for staining C1R cells by flow cytometry.

Transfections.
ILT1, ILT2, and ILT3 cDNAs were subcloned into pCDNA3 (Invitrogen) and transfected into COS7 cells by lipofectin (GIBCO BRL, Gaithersburg, MD). Cell surface expression of ILTs was assessed 48 h after transfection by FACS® analysis. A stable transfectant of ILT3 in Jurkat T cells was obtained as previously described (28).

Antibodies and FACS® Staining.
Before staining, all the cells were preincubated with PBS, 20% human serum for 30 min on ice, to block Fc receptors. In two- and three-color staining experiments, cells were stained with the following primary mAbs: OKT3 (anti-CD3, IgG2a; American Type Culture Collection, Rockville, MD), CD16 (IgG2a; Milan Analytica AG, La Roche, Switzerland), 3C10 (anti-CD14, IgG2b; American Type Culture Collection), 1F5.4 (anti-CD20, IgG2a; American Type Culture Collection), M-T102 (anti-CD1a, IgG2b; PharMingen, San Diego, CA), L243 (anti-HLA-DR, IgG2a; American Type Culture Collection), and HB15a (anti-CD83, IgG2b; provided by Dr. T. Tedder, Duke University, Durham, NC). As secondary antibodies, we used human-adsorbed FITC- or PE-conjugated goat anti–mouse IgG1, IgG2a, and IgG2b (Southern Biotechnology Assoc., Inc., Birmingham, AL). In three-color stainings, biotin-labeled goat anti–mouse IgG2a was followed by streptavidin-allophycocyanin (SBA). Stained cells were analyzed by flow cytometry on a FACStar® Plus (Becton Dickinson, Mountain View, CA) using the LYSYS II software.

Immunoprecipitations.
Cells were surface labeled with 1 mCi of Na125I using the sulfosuccinimidyl-3-(4-hydroxyphenyl)propionate method (39). For metabolic labeling with [32P]orthophosphate, cells were incubated in phosphate-free DMEM (Sigma Chemical Co., St. Louis, MO) containing 10% Tris-buffered saline–dialyzed FCS for 1 h. [32P]orthophosphate (Amersham Corp., Arlington Heights, IL) was then added at 0.5 mCi/ml and incubation was continued for 5 h. After surface or metabolic labeling, cells were lysed in 1% Triton X-100, 100 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM EDTA, 1 mM PMSF, 10 µg/ml aprotinin, and 10 µg/ml leupeptin. After overnight preclearing with protein G–sepharose, lysates were incubated with culture supernatants of either ZM3.8 (anti-ILT3, IgG1) or control IgG1 mAbs (5.133, anti-NKAT4 [40] and 1B7.11, anti-2,4,6 TNP, American Type Culture Collection) at +4°C for 4 h, and immune complexes were precipitated by addition of protein G–Sepharose for 1 h at +4°C. Precipitates were washed 3 times with lysis buffer, followed by a final wash with 10 mM Tris-HCl, pH 7.4, and resuspended in nonreducing or reducing sample buffer. SDS-PAGE analysis was performed according to a standard procedure. After the run, gels were dried and exposed to autoradiography film (Amersham Corp.) for 2–5 d.

Measurement of Cytosolic Calcium in Macrophages and Monocytes.
Monocytes and macrophages were loaded with Indo-1 AM (Sigma Chemical Co.) as described (41). In stimulation experiments, anti-CD11b mAb (44aabc; American Type Culture Collection) and anti-CD16 mAb (B73.1; American Type Culture Collection) were added to monocytes and macrophages, respectively, followed by a F(ab')2 goat anti–mouse IgG (Milan Analytica) as cross-linker. Cells were then analyzed on a flow cytofluorimeter (FACS® Vantage or Coulter Elite Enhanced Sort Performance [Coulter Corp., Hialeah, FL]) to detect Ca2+ fluxes. Stimulation of monocytes with the anti-HLA-DR mAb 3.8B1 (Cella, M., and A. Lanzavecchia unpublished data) was performed without a cross-linker. In inhibition experiments, cells were preincubated for 10 min at room temperature either with ZM3.8 mAb, or with the anti–MHC class I W6/32 mAb. After washing with PBS, either anti-CD11b, anti-HLA-DR, or anti-CD16 mAbs were added followed by the cross-linking antibody, and cells were analyzed by flow cytometry to detect Ca2+ fluxes. Only live (based on forward scatter criteria) and Indo-1–loaded cells (based on 405 nM versus 525 nM emission spectra) were included in the analysis.

Immunoblotting.
For antiphosphotyrosine blots, monocytes (2 x 106) were incubated for 2 min at 37°C with medium, ZM3.8 mAb, 3.8B1 mAb, or with both mAbs in the absence or in the presence of a secondary cross-linker. Cells were washed in icecold PBS and lysed as previously described (20). Cell lysates were boiled, separated on SDS-PAGE, transferred to nitrocellulose, and probed with horseradish peroxidase (HRP)-coupled 4G10 (500 ng/ml; Upstate Biotechnology Inc., Lake Placid, NY). Immunoblotted proteins were visualized by chemiluminescence using the enhanced chemiluminescence detection reagents (Amersham Corp.). For anti-SHP blots, 107 monocytes were plated on six-well tissue culture plates previously coated with purified ZM3.8 or 5.133 mAbs at 50 µg/ml, centrifuged for 2 min, shifted to 37°C for 2 min, collected in cold PBS, 0.5 mM EDTA, and washed twice. Identical number of cells stimulated with ZM3.8 or 5.133 mAbs were lysed and immunoprecipitated with ZM3.8 and protein G as described above. Precipitated samples were boiled for 5 min, separated by SDS-PAGE, and transferred to nitrocellulose (Hybond-C extra; Amersham Corp.). Membranes were blocked with PBS, 3% nonfat, dry milk and probed anti-SHP-1 rabbit antiserum (Santa Cruz Biotechnology, Santa Cruz, CA) followed by HRP-labeled goat anti–rabbit Ig (SBA). Immunoblotted proteins were visualized by chemiluminescence. Membranes were stripped of antibody by incubating for 30 min at 50°C in 100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM TrisHCL, pH 6.7, according to the protocol supplied by Amersham Corp. Stripped blots were reprobed after blocking with antiSHP-2 rabbit antiserum (Santa Cruz Biotechnology).

Internalization Assay.
Monocytes were cultured for 24–48 h in culture medium containing GM-CSF and IL-4, as described above. One aliquot of monocytes was fixed for 1 min at room temperature in RPMI, 0.05% glutaraldehyde. Another aliquot was used without fixation. Both samples were stained with ZM3.8 mAb for 40 min on ice, washed twice with ice-cold PBS, 1% FCS, and subsequently stained with biotin-labeled F(ab')2 goat anti–mouse IgG for 1 h on ice. After washing with ice-cold PBS, 1% FCS, cells were incubated at 37 °C in prewarmed RPMI, 10% FCS for various times to allow internalization. Cells were then cooled on ice, washed once with PBS, 0.1% NaN3, stained with PE-conjugated streptavidin for 30 min on ice, washed, and analyzed by FACS®. As a measure of internalization in nonfixed cells, we used the percental decrease of the median fluorescence intensity (MFI) as compared to control samples kept at 4°C. The percentage decrease of MFI observed in fixed cells was taken as a measure of the off-rate of the antibody at 37°C.

Antigen Presentation Assay.
4 x 104 irradiated monocytes (3,000 rad) were co-cultured with 8 x 104 cells of the B13 T cell clone (42) in 96-well flat-bottom microplates in the presence of serial dilutions of IgG1 mAbs. mAbs used in the assay were the following: ZM3.8 (anti-ILT3, IgG1) or 5.133 (anti-NKAT4 KIR, IgG1), 1B7.11 (anti-2,4,6 TNP, IgG1; American Type Culture Collection), and 32.2 (anti-Fc{gamma}RI, IgG1; American Type Culture Collection). After 48 h, the cultures were pulsed with [3H]thymidine (1 µCi/well, specific activity 5 Ci/mmol), and the radioactivity incorporated was measured after additional 16 h. The data were plotted against the concentration of mAbs determined by ELISA using a purified mouse IgG1 (anti-CD68, Dako Corp., Carpinteria, CA) as a standard.


   Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
ILT3 Is a Member of the ILT Multigene Family Located on Human Chromosome 19.
During the process of cloning the 3' end of ILT2 cDNA from EBV-B cell lines (25), we obtained an additional cDNA sequence that differed from ILT2 by several amino acid residues. Amplification of the 5' end of this fragment yielded a new cDNA, called ILT3, which contains a single open reading frame encoding a transmembrane protein of 447 amino acids with a predicted molecular mass of ~47 kD (Fig. 1). The amino acid sequence begins with a hydrophobic signal peptide of 23 amino acids followed by an extracellular region composed of two C2 type Ig-SF domains (43). Each domain shows two characteristic cysteines that are 49 and 50 residues apart, flanked by conserved residues (Val-x-Leu/Ile-x-Cys and His/Tyr-x-Gly-x-Tyr-x-Cys-Tyr/Phe, respectively, where x is any amino acid). The putative transmembrane domain of ILT3 consists of 21 amino acids, followed by a long cytoplasmic region of 167 amino acids, which is characterized by the presence of one Tyr-x-x-Val motif followed by two Tyr-x-x-Leu motifs spaced by 26 amino acid residues. These Tyr-x-x-Leu pairs and their spacing are reminiscent of the Tyr-x-x-Leu motifs identified in KIRs as binding sites for protein tyrosine phosphatase SHP-1 (1923).


Figure 1
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1 Amino acid sequence of human ILT3, aligned with ILT1 and ILT2. Since ILT1 and ILT2 consist of four Ig-SF domains, only the two domains with higher homology to ILT3 were included in the alignment. The alignment was generated by the Clustal method. Gaps (dashes) were introduced to maximize homologies. Amino acids identical to the consensus are indicated by dots. Conserved cysteines involved in disulfide bonds in the extracellular domains are identified by asterisks. Cytoplasmic tyrosine-based motifs potentially involved in signal transduction and/or endocytosis are boxed. ILT3 has no N-linked glycosylation sites (N-X-S/T). Amino acid residues are numbered on the right side, beginning with the first residue of each of the predicted domains. ss, signal sequence; Ig1–4, Ig-SF extracellular domains; cp, connecting peptide; tm, transmembrane domain; cy, cytoplasmic domain. ILT3 cDNA sequence is available from EMBL/GenBank/DDBJ under accession number U82979.

 
Comparison of the predicted amino acid sequence of ILT3 with Ig-SF protein sequences, revealed that ILT3 is closely related to ILTs (64% similarity with ILT2), bovine Fc{gamma}2R (45%), murine cell surface antigen gp49 isoforms (39–43%), and, to a lesser extent, to KIRs (23–32%) and human Fc{alpha}R (28%). Genomic DNA analysis of human– hamster hybrid cell lines, each with a different partial complement of human chromosomes, showed hybridizing bands only in samples containing human chromosome 19 (data not shown). Thus, ILT3 belongs to the ILT family which maps to human chromosome 19, as do the Fc{alpha}R and the KIR genes. Expression of ILT3 by RNA blot analysis revealed a major transcript of ~1.6 kb (data not shown). Interestingly, this transcript was weakly expressed in the B cell lines C1R or 721.221, from which ILT3 was initially cloned, whereas it was predominantly expressed in monocytes purified from PBMCs and in the myeloid cell line THP1. No transcripts were detected in the T cell line Jurkat.

ILT3 Is Expressed on Monocytes, Macrophages, and Dendritic Cells.
To characterize the ILT3-encoded cell surface molecule, we produced anti-ILT3 mAbs using a soluble ILT3HuIgG1 fusion protein as an immunogen. The ZM3.8 mAb specifically recognized ILT3 on transiently transfected COS cells (data not shown). In PBMCs, ZM3.8 mAb stained only CD14+ monocytes, whereas no staining was observed in CD3+ T cells, CD16+ NK cells, or CD20+ B cells (Fig. 2 A). Interestingly, in monocyte-enriched populations derived from peripheral blood, ZM3.8 also stained CD83+ cells (Fig. 2 A), as well as CD14-/HLA-DRhigh cells (Fig. 2 B). Both of these cell populations correspond to circulating primary DCs (4446). In addition, ILT3 was expressed by both DCs and macrophages derived from monocytes cultured with GM-CSF plus IL-4 or M-CSF, respectively (Fig. 2, C and D; 32–34).


Figure 2
Figure 2
View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2 Expression of ILT3 in monocytes, primary DCs, monocyte-derived DCs, and macrophages. (A) mAb ZM3.8 stains CD14+ monocytes in PBMC and CD83+ DCs in a monocyte-enriched population (right). On the contrary, CD3+ T cells, CD16+ NK cells, or CD20+ B cells are not stained (left). PBMCs and monocyte-enriched populations were subjected to two-color staining. Lymphocytes (left) and monocytes (right) were gated using forward and side scatter (FSC and SSC) parameters. (B) ILT3 is expressed on CD14+ monocytes and on a subset of CD14-/HLA-DRhigh cells, which corresponds to circulating primary DCs (46). Monocytes were enriched from peripheral blood and subjected to three-color staining using anti-CD14 (FITC), ZM3.8 (PE), and anti-HLA-DR (APC). (C) Monocyte-derived DCs express both CD1a and ILT3. (D) Macrophages express low levels of both CD16 and ILT3. DCs and macrophages were derived from monocytes under appropriate culture conditions and subjected to two-color staining. Negative controls were located in the lower left quadrants.

 
We also tested ILT3 expression in several cell lines. Among four myelo-monocytic cell lines (U937, Monomac6, THP1, and HL-60), only THP1 reacted with ZM3.8. All tested EBV-B cell lines (n = 10) were negative, with the exception of C1R. No cell surface expression was detected either on purified fresh B cells or on B cells activated by CD40L in the presence of IL-4, IL-2, and IL-10 (data not shown). Finally, ZM3.8 did not stain neutrophils (data not shown). Thus, ILT3 is selectively expressed on myeloid APCs.

To define the biochemical characteristics of ILT3, we carried out immunoprecipitations from ILT3-transfected Jurkat T cells and monocytes (Fig. 3). A prominent band of ~55 kD in ILT3-transfected T cells was detected under nonreducing and reducing conditions, while a ~58–60 kD band was detected in monocytes (Fig. 3 A) and in THP1 (data not shown). N- and O-deglycosylation of immunoprecipitates did not produce any change in the size of the bands. After labeling cells with [32P]orthophosphate, ILT3 was immunoprecipitated as a constitutively phosphorylated molecule (Fig. 3 B). The discrepancy in apparent molecular mass of ILT3 between ILT3-transfected T cells and monocytes may be due to a different degree of phosphorylation in distinct cell types.


Figure 3
Figure 3
View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3 (A) SDS-PAGE analysis of ILT3 immunoprecipitated from 125I-labeled, ILT3-transfected Jurkat T cells and monocytes. ILT3 appears as a ~55-kD band in ILT3-transfected cells and as a ~58–60-kD band in monocytes. (B) When ILT3 is precipitated from 32P-labeled cells, it is detectable as a constitutively phosphorylated molecule.

 
Intracellular Ca2+ Mobilization Responses Triggered by CD11b, MHC Class II, and CD16 in APCs Are Negatively Regulated by Co-ligation with ILT3.
The presence of putative ITIMs suggested an inhibitory role of ILT3 on APC activation. To test this hypothesis, we triggered monocytes and macrophages with mAbs that have been shown to induce Ca2+ mobilization, such as anti-CD11b (47, 48), antiHLA-DR (4951), and anti-Fc{gamma}RIII (CD16; 52) mAbs, and tested whether recruitment of ILT3 to the triggering receptors inhibits Ca2+ mobilization. As shown in Fig. 4 A, ligation of surface CD11b with a specific mAb followed by a secondary cross-linking antibody elicited a rapid and transient rise in intracellular calcium concentration ([Ca2+]i). On the contrary, preincubation of monocytes with ZM3.8 mAb, followed by addition of anti-CD11b and co-crosslinking of CD11b and ILT3 by a secondary antibody, resulted in complete inhibition of the [Ca2+]i increase (Fig. 4 D). In control experiments, the [Ca2+]i increase induced by CD11b was not affected by co-ligation of CD11b with MHC class I. Also, cross-linking of ILT3 alone did not evoke Ca2+ mobilization, indicating that ILT3 is not a stimulatory receptor (data not shown).


Figure 4
View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4 Intracellular Ca2+ mobilization induced in monocytes and macrophages via CD11b (A), HLA-DR (B), and Fc{gamma}RIII (C) are inhibited upon cross-linking with ILT3 (D–F). G shows that in the absence of a cross-linking antibody, ILT3 does not inhibit Ca2+ flux triggered by the 3.8B1 anti-HLA-DR mAb.

 
It has been reported that some anti–MHC class II mAbs can trigger functional responses in B lymphocytes (4951). We have recently developed an anti-HLA-DR mAb, called 3.8B1, which triggers a rapid rise in [Ca2+]i, even in the absence of a secondary cross-linking antibody (Fig. 4 B). Co-ligation of ILT3 and HLA-DR resulted in significant inhibition of [Ca2+]i increase (Fig. 4 E). Interestingly, HLA-DR–mediated stimulation of monocytes was not affected by preincubation of monocytes with anti-ILT3 antibody in the absence of the secondary cross-linking antibody, indicating that recruitment of ILT3 to the stimulatory receptor is necessary to block the [Ca2+]i increase (Fig. 4 G).

The low affinity receptor for IgG, Fc{gamma}RIII, is expressed on NK cells and macrophages and has been shown to trigger Ca2+ mobilization in NK cells (52, 53). Similarly, we showed that cross-linking of Fc{gamma}RIII in macrophages evokes a strong increase of [Ca2+]i (Fig. 4 C). Despite the low expression of ILT3 on macrophages (see Fig. 2 D), co-ligation of ILT3 and Fc{gamma}RIII inhibited the [Ca2+]i increase, especially at early time points (Fig. 4 F). Together, these results demonstrate that co-ligation of ILT3 with a triggering receptor results in signal extinction.

SHP-1 Is Recruited to ILT3 upon Cross-linking.
To test whether inhibition of Ca2+ mobilization responses was paralleled by inhibition of tyrosine phosphorylation, we performed antiphosphotyrosine immunoblotting on whole cell lysates of monocytes stimulated via HLA-DR in the absence or in the presence of co-ligation with ILT3. As shown in Fig. 5 A, monocytes triggered via HLA-DR displayed a substantial increase of tyrosine phosphorylation (lane 3), as compared to monocytes incubated with medium alone (lane 1) or with anti-ILT3 mAb (lane 2). Co-ligation of ILT3 with HLA-DR resulted in a dramatic reduction of the intensity and number of tyrosine phosphorylated species (lane 5). In the absence of secondary cross-linking antibody, ILT3 did not block HLA-DR–triggered tyrosine phosphorylation increase (lane 4).


Figure 5
Figure 5
View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5 (A) Protein tyrosine phosphorylation stimulated by treatment of monocytes with the anti-HLA-DR mAb 3.8B1 is inhibited by co-ligation of HLADR with ILT3. Monocytes were incubated with medium alone (lane 1), with ZM3.8 mAb (antiILT3; lane 2), with 3.8B1 mAb (anti-HLA-DR; lane 3) or with both mAbs in the absence (lane 4) or in the presence (lane 5) of a secondary cross-linking antibody. Cell lysates were separated on SDS-PAGE, transferred to nitrocellulose, and probed with HRP-coupled antiphosphotyrosine mAb 4G10. (B) Association of SHP-1 with ILT3 is increased upon ILT3 cross-linking. Monocytes were stimulated with ZM3.8 (lane 2) or with a control IgG (5.133 mAb) (lane 1) coated on plastic plates. Cells were kept at 37°C for 2 min, harvested, and lysed. ILT3 was immunoprecipitated with ZM3.8. Proteins were separated on SDSPAGE, transferred to nitrocellulose, and probed with anti-SHP-1, followed by HRP-conjugated goat anti–rabbit Ig. The migration of SHP-1 is marked by the arrow.

 
Since in NK cells, KIRs downregulate calcium mobilization and tyrosine phosphorylation by recruiting SHP-1 and SHP-2 (1923), we tested whether these phosphatases could be also involved in the negative signaling pathway mediated by ILT3. ILT3 was cross-linked on monocytes by ZM3.8 mAb attached to the plastic surface of tissue culture plates and subsequently immunoprecipitated from cell lysates. In control experiments, ILT3 was immunoprecipitated from unstimulated cells. Immunoblotting of immunoprecipitates with anti-SHP-1 antibodies demonstrated association of SHP-1 with ILT3 that significantly increases upon ILT3 cross-linking (Fig. 5 B). On the contrary, no association with SHP-2 was detected (data not shown). These results implicate SHP-1 as a cytosolic component of the signal extinction mediated by ILT3.

Cross-linking of ILT3 on Monocytes Results in Receptor Internalization and Delivery into an Antigen-processing Compartment.
Since ILT3 is selectively expressed on APCs and displays putative tyrosine-x-x-valine/leucine internalization motifs in the cytoplasmic tail (5456), we analyzed the ability of ILT3 to endocytose and deliver its ligand to an antigen-processing and loading compartment. As shown in Fig. 6, ZM3.8 mAb bound at 0°C to monocytes was not internalized when the cells were shifted to 37°C. We therefore examined whether internalization occurs in the presence of a secondary cross-linker. ZM3.8 mAb was bound on ice to monocytes and cross-linked by a biotinylated F(ab')2 secondary antibody. Cells were subsequently warmed to 37°C to allow internalization. After various time points, cells were returned to ice and the amount of ZM3.8 mAb remaining on the cell surface was determined by flow cytometry using PE-conjugated streptavidin. Freshly isolated monocytes efficiently internalized bound ZM3.8 mAb, as demonstrated by a 60–80% reduction after 30 min at 37°C and by a complete disappearance after 60–90 min (Fig. 6). In control experiments, no significant decrease of surface-bound ZM3.8 was observed using fixed monocytes, ruling out a detachment of the primary or secondary antibodies from the cell surface at 37°C (Fig. 6). In addition, when 125I-labeled streptavidin was added as a third step reagent before incubation at 37°C, no significant decrease of cell-bound radioactivity was observed over time, thus excluding shedding of ILT3 from the cell surface (data not shown).


Figure 6
View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6 ZM3.8 mAb is internalized upon cross-linking. ZM3.8 bound to monocytes on ice did not disappear from the cell surface when the cells were shifted at 37°C, in the absence of a cross-linking antibody ({blacktriangleup}). After cross-linking with a F(ab')2 biotin-labeled secondary antibody, ZM3.8 was rapidly internalized, becoming undetectable by FACS® analysis in 30–60 min ({square}). In fixed cells, only a minimal decrease of the median fluorescence intensity was detected over time ({blacksquare}). Cell surface– bound ZM3.8 was revealed by PE-conjugated goat anti–mouse IgG1 ({blacktriangleup}) or by PE-conjugated streptavidin ({square}, {blacksquare}). The MFI was determined by FACS® analysis. The percentage decrease of MFI as compared to a control sample kept at 4°C was used as a measure of internalization.

 
To further investigate a possible role of ILT3 in antigen capture, we evaluated the ability of monocytes to present ZM3.8 mAb to a CD4+ class II–restricted T cell clone specific for a mouse IgG1 peptide epitope (42). The presentation of the ZM3.8 mAb was compared to that of IgG1 mAbs that bind to other receptors (anti-Fc{gamma}RI mAb) or do not bind to surface molecules and are taken up in the fluid phase [anti-TNP and anti-NKAT4 KIR mAbs]. As shown in Fig. 7, monocytes presented ZM3.8 mAb to T cells 50– 100-fold more efficiently than the anti-Fc{gamma}RI mAb, and 400–500-fold more efficiently than anti-TNP and antiNKAT4 KIR mAbs. Together, these experiments indicate that ILT3 can efficiently deliver its ligand to an intracellular compartment where class II loading can occur.


Figure 7
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7 Presentation of ZM3.8 mAb to a T cell clone specific for mouse IgG1 by irradiated monocytes. ZM3.8 mAb ({blacksquare}) is presented 50– 100-fold more efficiently than anti-Fc{gamma}RI ({square}) and 400–500-fold more efficiently than anti-TNP (•) and anti-NKAT4 KIR ({circ}) mAbs, which do not stain monocytes.

 

   Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Previous work has extensively shown that inhibitory receptors regulate cell activation in B, NK, mast cells, and subsets of T cells when co-ligated with ITAM-containing stimulatory receptor complexes. Our data extend this concept to professional APCs, showing that ILT3 negatively regulates APC functional responses triggered via stimulatory receptors, such as CD11b, CD16, and even MHC class II. In addition to its inhibitory function, ILT3 is involved in antigen uptake. It is noteworthy that ILT3 is expressed on DCs. These are a unique type of leukocytes whose primary function is to efficiently capture antigens, process them, and present them to naive T cells (57). Although the uptake and processing of antigen is a major function of DCs, only a few mechanisms and receptors specialized for antigen capture have been identified on DCs (5860). Our data indicate that ILT3 is a unique receptor expressed in DCs, able to target the ligand into processing and peptide-loading compartments. Thus, ILT3 displays a dual function of inhibitory receptor and antigen-capturing molecule. A similar dual function has been previously shown for the low affinity receptor for IgG, Fc{gamma}RIIB (7, 8).

The ligand of ILT3 is still unknown. ILT3 is closely related to bovine Fc{gamma}2R and, to a lesser extent, to human Fc{alpha}R, suggesting that ILT3 may be an Fc receptor. However, we did not detect any significant binding of human monomeric and heat-aggregated IgM, IgG, IgA, and IgE to ILT3-transfected Jurkat T cells (data not shown). ILT3 also shows homology to KIRs, which suggests that it may be a receptor for MHC class I molecules. We have investigated this possibility by analyzing binding of soluble ILT3HuIgG1 fusion protein to MHC class I transfectants in the class I–deficient mutant 721.221. No significant binding could be detected by FACS® analysis under the same experimental conditions in which KIR-HuIgG fusion proteins bind to MHC class I molecules (data not shown). We are investigating the possibility that ILT3 is a receptor for cell surface molecules related to MHC class I molecules, such as nonclassical class I molecules (CD1 [61], MR1 [62], MIC [63]), for MHC class II molecules, or for serum factors such as complement components.

ILT3 is a member of the ILT subfamily of Ig-SF molecules, which is located on chromosome 19, most likely in close linkage with KIRs. Another member of this family, ILT2, is characterized by similar cytoplasmic tyrosine-based motifs such as ILT3, and is expressed in B cell lines, suggesting that this may be a putative inhibitory resceptor in B cells. We have also cloned additional cDNAs which encode novel molecules homologous to ILT2 and ILT3 (ILT4 and ILT5, GenBank accession numbers AF000574 and AF000575). Thus, the number of Ig-SF inhibitory receptors with different tissue distribution and specificity is likely to increase.


   Acknowledgments
 
We thank S. Bahram, K. Campbell, and R. Torres for critical reading of the manuscript.

Submitted: 30 January 1997


The Basel Institute for Immunology was founded and is supported by F. Hoffmann-La Roche Ltd., Basel, Switzerland.

1Abbreviations used in this paper: BCR, B cell antigen receptor; DC, dendritic cells; gp, glycoprotein; HRP, horseradish peroxidase; Ig-SF, Ig superfamily; ILT, Ig-like transcript; ILT3-HuIgG1, ILT3 human IgG1 fusion protein; ITAM, immunoreceptor tyrosine-based activation motif; ITIM, immunoreceptor tyrosine-based inhibitory motif; KIR, killer cell inhibitory receptor; M-CSF, macrophage CSF; MFI, median fluorescence intensity.


   References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

1 Cambier JC, Pleiman CM & Clark MR. Signal transduction by the B cell antigen receptor and its coreceptors, Annu Rev Immunol, 1994, 12, 457–486.[Medline]

2 Weiss A & Littman DR. Signal transduction by lymphocyte antigen receptors, Cell, 1994, 76, 263–274.[Medline]

3 Letourneur F & Klausner RD. T-cell and basophil activation through the cytoplasmic tail of T-cell-receptor {zeta} family proteins, Proc Natl Acad Sci USA, 1991, 88, 8905–8909.[Abstract/Free Full Text]

4 Letourneur O, Kennedy IC, Brini AT, Ortaldo JR, O'Shea JJ & Kinet JP. Characterization of the family of dimers associated with Fc receptors (Fc{varepsilon} RI and Fc{gamma} RIII), J Immunol, 1991, 147, 2652–2656.[Abstract/Free Full Text]

5 Bonnerot C, Amigorena S, Choquet D, Pavlovich R, Choukroun V & Fridman WH. Role of associated {gamma}-chain in tyrosine kinase activation via murine Fc{gamma}RIII, EMBO (Eur Mol Biol Organ) J, 1992, 11, 2747–2757.[Medline]

6 Daeron M, Malbec O, Bonnerot C, Latour S, Segal DM & Fridman WH. Tyrosine-containing activation motifdependent phagocytosis in mast cells, J Immunol, 1994, 152, 783–792.[Abstract]

7 Amigorena S, Bonnerot C, Drake JR, Choquet D, Hunziker W, Guillet JG, Webster P, Sautes C, Mellman I & Fridman WH. Cytoplasmic domain heterogeneity and functions of IgG Fc receptors in B lymphocytes, Science (Wash DC), 1992, 256, 1808–1812.[Abstract/Free Full Text]

8 Muta T, Kurosaki T, Misulovin Z, Sanchez M, Nussenzweig MC & Ravetch JV. A 13-amino-acid motif in the cytoplasmic domain of Fc{gamma}RIIB modulates B-cell receptor signalling, Nature (Lond), 1994, 368, 70–73.[Medline]

9 Daeron M, Latour S, Malbec O, Espinosa E, Pina P, Pasmans S & Fridman WH. The same tyrosine-based inhibition motif, in the intracytoplasmic domain of Fc{gamma}RIIB, regulates negatively BCR-, TCR-, and FcR-dependent cell activation, Immunity, 1995, 3, 635–646.[Medline]

10 Doody GM, Justement LB, Delibrias CC, Matthews RJ, Lin J, Thomas ML & Fearon DT. A role in B cell activation for CD22 and the protein tyrosine phosphatase SHP, Science (Wash DC), 1995, 269, 242–244.[Abstract/Free Full Text]

11 Yokoyama WM & Seaman WE. The Ly-49 and NKR-P1 gene families encoding lectin-like receptors on natural killer cells: the NK gene complex, Annu Rev Immunol, 1993, 11, 613–635.[Medline]

12 Lanier LL & Phillips JH. Inhibitory MHC class I receptor on NK cells and T cells, Immunol Today, 1996, 17, 86–91.[Medline]

13 Lazetic S, Chang C, Houchins JP, Lanier LL & Phillips JH. Human natural killer cell receptors involved in MHC class I recognition are disulfide linked heterodimers of CD94 and NKG2 subunits, J Immunol, 1996, 157, 4741–4745.[Abstract]

14 Katz HR, Vivier E, Castells MC, McCormick MJ, Chambers JM & Austen FK. Mouse mast cell gp49B1 contains two immunoreceptor tyrosine-based inhibition motifs and suppresses mast cell activation when coligated with the high-affinity Fc receptor for IgE, Proc Natl Acad Sci USA, 1996, 93, 10809–10814.[Abstract/Free Full Text]

15 Wang LL, Mehta IK, LeBlanc PA & Yokoyama WM. Mouse natural killer cells express gp49B1, a structural homologue of human killer inhibitory receptors, J Immunol, 1997, 158, 13–17.[Abstract]

16 Rojo S, Burshtyn DN, Long EO & Wagtmann N. Type I transmembrane receptor with inhibitory function in mouse mast cells and NK cells, J Immunol, 1997, 158, 9–12.[Abstract]

17 Thomas ML. Of ITAMs and ITIMs: turning on and off the B cell antigen receptor, J Exp Med, 1995, 181, 1953–1956.[Free Full Text]

18 D'Ambrosio D, Hippen KL, Minskoff SA, Mellman I, Pani G, Siminovitch KA & Cambier JC. Recruitment and activation of PTP1C in negative regulation of antigen receptor signaling by Fc{gamma}RIIB1, Science (Wash DC), 1995, 268, 293–297.[Abstract/Free Full Text]

19 Burshtyn DN, Scharenberg AM, Wagtmann N, Rajagopalan S, Berrada K, Yi T, Kinet JP & Long EO. Recruitment of tyrosine phosphatase HCP by the killer cell inhibitor receptor, Immunity, 1996, 4, 77–85.[Medline]

20 Campbell KS, Dessing M, Lopez M, Botet, Cella M & Colonna M. Tyrosine phosphorylation of a human killer inhibitory receptor recruits protein tyrosine phosphatase 1C, J Exp Med, 1996, 184, 93–100.[Abstract/Free Full Text]

21 Olcese L, Lang P, Vely F, Cambiaggi A, Marguet D, Blery M, Hippen KL, Biassoni R, Moretta A, Moretta L, Cambier JC & Vivier E. Human and mouse killercell inhibitory receptors recruit PTP1C and PTP1D protein tyrosine phosphatases, J Immunol, 1996, 156, 4531–4534.[Abstract]

22 Fry AM, Lanier LL & Weiss A. Phosphotyrosines in the killer cell inhibitory receptor motif of NKB1 are required for negative signaling and for association with protein tyrosine phosphatase 1C, J Exp Med, 1996, 184, 295–300.[Abstract/Free Full Text]

23 Binstadt BA, Brumbaugh KM, Dick CJ, Scharenberg AM, Williams BL, Colonna M, Lanier LL, Kinet J-P, Abraham RT & Leibson PJ. Sequential involvement of Lck and SHP-1 with MHC-recognizing receptors on NK cells inhibits FcR-initiated tyrosine kinase activation, Immunity, 1996, 5, 629–638.[Medline]

24 Ono M, Bolland S, Tempst P & Ravetch JV. Role of the inositol phosphatase SHIP in negative regulation of the immune system by the receptor Fc{gamma}RIIB, Nature (Lond), 1996, 383, 263–266.[Medline]

25 Samaridis J & Colonna M. Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: structural evidence for new stimulatory and inhibitory pathways, Eur J Immunol, 1997, 27, 660–665.[Medline]

26 Zhang G, Young JR, Tregaskes CA, Sopp P & Howard CJ. Identification of a novel class of mammalian Fc{gamma} receptor, J Immunol, 1995, 155, 1534–1541.[Abstract]

27 Arm JP, Gurish MF, Reynolds DS, Scott HC, Gartner CS, Austen KF & Katz HR. Molecular cloning of gp49, a cell-surface antigen that is preferentially expressed by mouse mast cell progenitors and is a new member of the immunoglobulin superfamily, J Biol Chem, 1991, 266, 15966–15973.[Abstract/Free Full Text]

28 Colonna M & Samaridis J. Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells, Science (Wash DC), 1995, 268, 405–408.[Abstract/Free Full Text]

29 Wagtmann N, Biassoni R, Cantoni C, Verdiani S, Malnati MS, Vitale M, Bottino C, Moretta L, Moretta A & Long EO. Molecular clones of the p58 NK cell receptor reveal immunoglobulin-related molecules with diversity in both the extra- and intracellular domains, Immunity, 1995, 2, 439–449.[Medline]

30 D'Andrea A, Chang C, Franz-Bacon K, McClanahan T, Phillips JH & Lanier LL. Molecular cloning of NKB1. A natural killer cell receptor for HLA-B allotypes, J Immunol, 1995, 155, 2306–2310.[Abstract]

31 Maliszewski CR, March CJ, Schoenborn MA, Gimpel S & Shen L. Expression cloning of a human Fc receptor for IgA, J Exp Med, 1990, 172, 1665–1672.[Abstract/Free Full Text]

32 Sallusto F & Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha, J Exp Med, 1994, 179, 1109–1118.[Abstract/Free Full Text]

33 Bender A, Sapp M, Schuler G, Steinman RM & Bhardwaj N. Improved methods for the generation of dendritic cells from non proliferating progenitors in human blood, J Immunol Methods, 1996, 196, 121–135.[Medline]

34 Romani N, Reider D, Heuer M, Ebner S, Kampgen E, Eibl B, Niederwieser D & Schuler G. Generation of mature dendritic cells from human blood. An improved method with special regard to clinical applicability, J Immunol Methods, 1996, 196, 137–151.[Medline]

35 Frohman MA, Dush MK & Martin GR. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer, Proc Natl Acad Sci USA, 1988, 85, 8998–9002.[Abstract/Free Full Text]

36 Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 8.11.

37 Traunecker A, Oliveri F & Karjalainen K. Myeloma based expression system for production of large mammalian proteins, Trends Biotechnol, 1991, 9, 109–113.[Medline]

38 Dohring C & Colonna M. Human natural killer cell inhibitory receptors bind to HLA class I molecules, Eur J Immunol, 1996, 26, 365–369.[Medline]

39 Reid PA & Watts C. Cycling of cell-surface MHC glycoproteins through primaquine-sensitive intracellular compartments, Nature (Lond), 1990, 346, 655–657.[Medline]

40 Dohring C, Scheidegger D, Samaridis J, Cella M & Colonna M. A human killer inhibitory receptor specific for HLA-A, J Immunol, 1996, 156, 3098–3101.[Abstract]

41 Valitutti S, Dessing M & Lanzavecchia A. Role of cAMP in regulating cytotoxic T lymphocyte adhesion and motility, Eur J Immunol, 1993, 23, 790–795.[Medline]

42 Lanzavecchia A, Abrignani S, Scheidegger D, Obrist R, Dorken B & Moldenhauer G. Antibodies as antigens. The use of mouse monoclonal antibodies to focus human T cells against selected targets, J Exp Med, 1988, 167, 345–352.[Abstract/Free Full Text]

43 Williams AF & Barclay NA. The immunoglobulin superfamily-domains for cell surface recognition, Ann Rev Immunol, 1988, 6, 381–405.[Medline]

44 Zhou LJ & Tedder TF. Human blood dendritic cells selectively express CD83, a member of the immunoglobulin superfamily, J Immunol, 1995, 154, 3821–3835.[Abstract]

45 Zhou LJ & Tedder TF. CD14+ blood monocytes can differentiate into functionally mature CD83+ dendritic cells, Proc Natl Acad Sci USA, 1996, 93, 2588–2592.[Abstract/Free Full Text]

46 O'Doherty U, Steinman RM, Peng M, Cameron PU, Gezelter S, Kopeloff I, Swiggard WJ, Pope M & Bhardwaj N. Dendritic cells freshly isolated from human blood express CD4 and mature into typical immunostimulatory dendritic cells after culture in monocyte-conditioned medium, J Exp Med, 1993, 178, 1067–1076.[Abstract/Free Full Text]

47 Altieri DC, Stamnes SJ & Gahmberg CG. Regulated Ca2+ signalling through leukocyte CD11b/CD18 integrin, Biochem J, 1992, 288, 465–473.[Medline]

48 Crockett-Torabi E, Sulenbarger B, Smith CW & Fantone JC. Activation of human neutrophils through L-selectin and Mac-1 molecules, J Immunol, 1995, 154, 2291–2302.[Abstract]

49 Cambier JC, Morrison DC, Chien MM & Lehmann KR. Modeling of T cell contact-dependent B cell activation. IL-4 and antigen receptor ligation primes quiescent B cells to mobilize calcium in response to Ia crosslinking, J Immunol, 1991, 146, 2075–2082.[Abstract]

50 Cambier JC & Lehmann KR. Ia-mediated signal transduction leads to proliferation of primed B lymphocytes, J Exp Med, 1989, 170, 877–886.[Abstract/Free Full Text]

51 Charron D, Brick-Ghannam S, Ramirez R & Mooney N. HLA class-II-mediated B-lymphocyte activation: signal transduction and physiologic consequences, Res Immunol, 1991, 142, 467–474.[Medline]

52 Cassatella MA, Anegon I, Cuturi MC, Griskey P, Trinchieri G & Perussia B. Fc{gamma}R(CD16) interaction with ligand induces Ca2+ mobilization and phosphoinositide turnover in human natural killer cells. Role of Ca2+ in Fc{gamma}R (CD16)-induced transcription and expression of lymphokine genes, J Exp Med, 1989, 169, 549–567.[Abstract/Free Full Text]

53 Ravetch JV & Kinet JP. Fc receptors, Annu Rev Immunol, 1991, 9, 457–492.[Medline]

54 Trowbridge IS, Collawn JF & Hopkins CR. Signal-dependent membrane protein trafficking in the endocytic pathway, Annu Rev Cell Biol, 1993, 9, 129–161.

55 Letourneur F & Klausner RD. A novel di-leucine motif and a tyrosine-based motif independently mediate lysosomal targeting and endocytosis of CD3 chains, Cell, 1992, 69, 1143–1157.[Medline]

56 Sandoval IV & Bakke O. Targeting of membrane proteins to endosomes and lysosomes, Trends Cell Biol, 1994, 4, 292–297.[Medline]

57 Steinman RM. The dendritic cell system and its role in immunogenicity, Annu Rev Immunol, 1991, 9, 271–296.[Medline]

58 Jiang W, Swiggard WJ, Heufler C, Peng M, Mirza A, Steinman RM & Nussenzweig MC. The receptor DEC-205 expressed by dendritic cells and thymic epithelial cells is involved in antigen processing, Nature (Lond), 1995, 375, 151–155.[Medline]

59 Sallusto F, Cella M, Danieli C & Lanzavecchia A. Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products, J Exp Med, 1995, 182, 389–400.[Abstract/Free Full Text]

60 Bieber T, de la Salle H, Wollenberg A, Hakimi J, Chizzonite R, Ring J, Hanau D & de la Salle C. Human epidermal Langerhans cells express the high affinity receptor for immunoglobulin E (Fc{varepsilon}RI), J Exp Med, 1992, 175, 1285–1290.[Abstract/Free Full Text]

61 Porcelli SA. The CD1 family: a third lineage of antigen-presenting molecules, Adv Immunol, 1995, 59, 1–98.[Medline]

62 Hashimoto K, Hirai M & Kurosawa Y. A gene outside the human MHC related to classical HLA class I genes, Science (Wash DC), 1995, 269, 693–695.[Abstract/Free Full Text]

63 Bahram S, Bresnahan M, Geraghty DE & Spies T. A second lineage of mammalian major histocompatibility complex class I genes, Proc Natl Acad Sci USA, 1994, 91, 6259–6263.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 196K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cella, M.
Right arrow Articles by Colonna, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cella, M.
Right arrow Articles by Colonna, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS