|
||
By



From * Schering-Plough, Laboratory for Immunological Research, 69571 Dardilly Cedex, France; and
DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, California, 94304-1104
This paper describes an antibody (mAb 7D6) that specifically recognizes human follicular dendritic cells (FDCs). By expression cloning, a cDNA clone encoding for the long human CR2/
CD21 isoform (CD21L) that contains an additional exon (10a) was isolated. We demonstrated
that FDCs selectively express CD21L, while B cells selectively express the short CR2/CD21
lacking exon 10a (CD21S). By screening mouse Ltk
cells transfected with the CD21L cDNA,
we further showed that the other two anti-human FDC mAbs DRC-1 and KiM4 also recognize CD21L. Thus, CD21L represents the first characterized human FDC-specific molecule,
which may confer unique functions of FDCs in germinal center development.
Secondary lymphoid organs such as lymph nodes, spleen,
Peyer's patches, and tonsils represent the major sites
where immune responses to antigens occur. These lymphoid organs are divided into a T cell compartment (T cell
zone or extrafollicular area) and a B cell compartment (B
lymphoid follicle). While T cell zones contain interdigitating dendritic cells that play key roles in presenting antigen
to naive T cells (1), B cell follicles contain follicular dendritic cells (FDC) that have the capacity to retain native antigen-antibody immune complexes for long periods of time (2, 3). During T cell-dependent humoral (antibody) immune responses, antigen-specific B cells undergo rapid clonal expansion within the FDC networks of B cell follicles, leading to the formation of germinal centers (GC) (4). During
the course of clonal expansion, somatic hypermutation in
immunoglobulin variable region genes (5, 6), and isotype
switch in immunoglobulin constant region genes occur (7).
After antigen-driven affinity selection (8), high affinity germinal center B cells will differentiate into either plasma cells
or memory B cells (9). The functions of FDC in the
GC reaction were proposed because of their selective localization and their ability to retain immune complexes. Both in vivo and in vitro experiments have suggested that FDC
play important roles in GC B cell proliferation, survival,
and differentiation (12). However, little is known at the
molecular level of how FDCs contribute to GC development. Several monoclonal antibodies have been generated
against FDCs (16, 17); however, the nature and function of
the antigens recognized by these monoclonal antibodies are
unknown. Here, we describe an antibody (mAb 7D6) that
specifically recognizes human FDC. By expression cloning,
using mAb 7D6, a cDNA clone encoding for the long isoform of CD21L (CD21L) that contains an additional exon
(10a) was isolated. We show that FDC selectively express
CD21L, while B cells selectively express the short CD21
(CD21S) lacking exon 10a. By screening mouse L cells transfected with the CD21L cDNA, we further demonstrate that the other two anti-human FDC mAbs, DRC-1
and KiM4, also recognize CD21.
Isolation of FDC from Human Tonsils by Percoll Gradient.
Tonsils obtained from children undergoing tonsillectomy were cut into
small pieces and digested for 12 min at 37°C with an enzyme
cocktail in RPMI 1640 medium (GIBCO BRL, Gaithersburg, MD) containing collagenase IV (1 mg/ml; Sigma Chemical Co.,
St. Louis, MO) and deoxyribonuclease I (50 kU/ml; Sigma
Chemical Co.). The released cells were collected and a new stock
of enzyme solution was added to the remaining tissue fragments
for another 12 min. The cells, collected after two successive
rounds of enzymatic digestion, were pooled and centrifuged
through Ficoll-Hypaque (Eurobio, Paris, France) for 20 min at
400 g to remove red and dead cells. After two washes, cells were
layered on a 1.5% BSA (Pentex® Path-o-cyte 5; Miles Inc.,
Kankakee, IL) gradient and centrifuged at 10 g for 10 min at 4°C.
The FDC-lymphocyte clusters were recovered from the pellet.
This BSA gradient process was repeated two to three times. The
resulting cell population contains 15-30% FDC that form tight
clusters with lymphocytes (13).
Isolation of a Highly Purified Single FDC Suspension by FACS®
Sorting of CD14+CD21+ Large Tonsillar Cells.
Since human B
cells, T cells, fibroblasts, endothelial cells, and epithelial cells express no or low levels of CD14, and human T cells, fibroblasts,
endothelial cells, and epithelial cells express no or low levels of
CD21, CD14highCD21high FDC were isolated by FACS® sorting
of enriched FDC preparations by Percoll gradient. After cell sorting, the resulting population contained >98% pure single FDC
(Fig. 3). These highly purified FDCs may have been damaged inasmuch as they displayed cytoplasm losses and were unable to support B cell growth in vitro. However, these cells were used for PCR assays.
Purification of Tonsillar B Cells, Follicular Mantle B Cells, and GC
B Cells.
Briefly, tonsils were finely minced and the resulting cell
suspension was subjected to two rounds of T cell depletion using first rosetting with sheep red blood cells, and then depletion with anti-CD3 magnetic beads. The resulting purified cells contained >97% CD19+ B cells and <1% T cells and monocytes. To
isolate IgD+CD38 Generating FDC-specific mAb 7D6.
BALB/c mice were immunized with 5 × 106 enriched human tonsillar FDC intraperitoneally three times at 3-wk intervals. The final boost was carried
out 3 d before fusion. Using polyethylene glycol 1500 (Boehringer Mannheim GmbH, Mannheim, Germany), 50 × 106 splenic
cells were fused with NS1 myeloma cells. Hybridomas were cultured in complete medium supplemented with 20% vol/vol FCS, hypoxanthine and azaserine, oxaloacetic acid, pyruvate, and insulin (OPI; Sigma Chemical Co.). Hybridomas were selected by
immunohistological staining of the culture supernatants of the
FDC networks on tonsillar tissue sections. Ascites was produced
in BALB/c mice, and mAb 7D6 (IgG1) was purified by highpressure liquid chromatography with an anion-exchange column
(DEAE 5PW; Waters Chromatography Div., Milford, MA).
Immunoenzymatic Staining.
Frozen sections from human tonsils, spleen, and thymus were washed in PBS for 5 min. The sections were incubated with mouse IgG1 mAb 7D6, anti-CD21,
and anti-CD54, respectively, for 60 min. After washing for 5 min
in PBS, the sections were incubated with sheep anti-mouse IgG1
for 30 min in PBS containing 10% human serum, and then with
alkaline phosphatase coupled to mouse antibodies specific for alkaline phosphatase (APAAP complexes; Dako, Roskilde, Denmark). After a final washing, alkaline phosphatase was developed by Fast red substrate (Sigma Chemical Co.) which gives a red
color. Cytospin preparations of FDC clusters were fixed in acetone for 10 min at 4°C. The slides were washed in PBS and incubated for 1 h with the anti-FDC mAb 7D6. After washing, the
cytospin slides were incubated for 30 min with anti-mouse IgG1.
The binding of antibody was revealed using APAAP method and
developed by Fast red substrate.
cDNA Library Construction and Screening.
Poly(A)+ RNA was
purified from a B lymphoblastic cell line IM9 established from a
bone marrow sample of a myeloma patient. This cell line stained
weakly (variable;
Fig. 3.
Isolation of highly purified FDC by FACS® sorting. (A) Low
density tonsillar cells were stained by anti-CD21-PE and anti-CD14FITC (detailed in Materials and Methods). FDCs were sorted according to their CD21++CD14+ phenotype. B cells and monocytes could be recognized as CD21+CD14
and CD21
CD14+ cells, respectively. (B and
C) Giemsa staining of FACS® sorted FDC (×400 and ×1,000).
[View Larger Versions of these Images (22 + 143K GIF file)]
follicular mantle B cells and IgD
CD38+
germinal center B cells, total tonsillar B cells (107/ml) were incubated with anti-IgD-FITC and anti-CD38-PE in PBS containing 2% BSA (PBS-BSA) for 30 min. Cells were washed twice and suspended in PBS at 3 × 106/ml. The two B cell subpopulations were then purified by cell sorting. Two rounds of cell sorting were carried out to obtain >98% purity.
28% positive cells) with mAb 7D6. cDNA
library construction was as described (18) using the Superscript Reverse Transcriptase cDNA Synthesis Kit (GIBCO BRL). Doublestranded cDNA was size-fractionated using a Chromaspin-1000
column (Clontech, Palo Alto, CA) and ligated into the BstxI/
NotI-digested pJFE14 expression vector (19).
R, COS7 cells were stained with 10 µg/ml biotinylated mAb
7D6. Cells which bound mAb 7D6 were detected with streptavidin-phycoerythrin (Becton Dickinson, Milpitas, CA). Plasmid
DNA recovered from sorted cells was transformed into Escherichia
coli DH10B for expansion and then reintroduced into COS7
cells. A cDNA clone (p7D6) with a 4 kb insert was identified
which encoded the antigen recognized by mAb 7D6. The sequence of the cDNA insert was determined in part manually as
described (18), and in part on an automated sequencer (Applied
Biosystems, Foster City, CA) using Taq Dye Deoxy Terminator
cycle sequencing.
Expression of the 7D6 Antigen.
The 7D6 cDNA clone was expressed transiently in COS7 cells (18). Mouse Ltk
cells (L cells)
stably expressing the 7D6 antigen were generated by cotransfection with a neomycin-resistance plasmid by the calcium phosphate method (GIBCO BRL). Cells which survived in 1 mg/ml G418 were selected for 7D6 expression by FACS® and also were
positive for CD21 (CALTAG Labs., South San Francisco, CA).
PCR Assay to Detect the Expression of Short and Long CD21 Isoforms.
mRNA was extracted from 104 FDC purified by FACS®
sorting according to their high expression of CD21 and CD14
antigens. cDNA was obtained by reverse transcription (Superscript
Reverse Transcriptase Kit; GIBCO BRL). PCR assay was performed using a 5
primer UHCR2-1704 (GGAGAGAGCACCATCCGTTG), a 3
primer ULCR2-2363 (GGGCAGCGAGTCACAGGAGGAG) (see Fig. 2), and a taq polymerase
(Perkin-Elmer Corp., Norwalk, CT) in a thermal cycler. The
first cycle of denaturation was at 94°C for 3 min, and then 35 cycles including 1 min of denaturation at 94°C, 2 min for primer
annealing at 60°C, and 3 min of extension at 72°C. Complete extension was achieved for 10 min at 72°C. PCR products were
loaded on a 1% low melting point gel for purification (WIZARD
PCR DNA Purification System; Promega Biotec, Madison, WI).
These products were ligated and cloned in the PCRtmII vector
with TA cloning kit (Invitrogen, San Diego, CA). Plasmids were
extracted from individual bacterial colonies and both strands were
sequenced on an automated DNA sequencer (Applied Biosystems) using PCR II vector primers (21 M13, and M13RP).
primer starting at bp 1,704 within the CD21S cDNA sequence, covering part of the
coding region of SCR10 (5
GGAGAGAGCACCATCCGTTG); and (b)
a 3
primer starting at position 2363 within the coding region of SCR11
(3
GGGCAGCGAGTCACAGGAGGAG). Accordingly, the predicted
PCR products derived from CD21S and CD21L mRNA should be 659 and 736 bp, respectively.
mAb 7D6 was selected
because it specifically stains FDC networks on tonsillar and
splenic sections (Fig. 1, A and C). The reactivity on FDC
networks was further confirmed by staining of isolated
FDCs (Fig. 1, G and H). 7D6 antibody did not give any specific staining on sections from fetal thymus (Fig. 1 E) or fetal liver (not shown). There was no positive staining of
mAb 7D6 on total cell suspensions of bone marrow and
peripheral blood by FACS® analysis (not shown).
7D6 cDNA Encodes the CD21L.
After screening over 50 cell lines including Burkitt's lymphoma cells, B lymphoblastoid cells, T cells, myeloma cells, monocytic cells, and
erythroblastoid cells, we found that Raji (Burkitt's lymphoma cell), UD123, UD261, IM9 (lymphoblastoid B cells),
and K562 (erythroblastoid) expressed low, but significant,
levels of 7D6 antigen (7-28% of cells were positive). Accordingly, we isolated a 4-kb cDNA clone from the IM9
cDNA library by FACS® sorting. Transfection of COS7
and L cells with p7D6 cDNA resulted in expression of the
7D6 antigen (not shown). The sequence of the p7D6
cDNA insert matched the sequence of long CR2/CD21
isolated from the Raji cell line (21), with several polymorphisms as described (22), and two additional ones: position
1979 [AGT (Ser)
A AT (Asn)] and position 2075 [CGT
(Arg)
CAT (His)] (The sequence of the 7D6-reactive
isoform of CD21 is available upon request). Consistent
with this finding, all the anti-CR2/CD21 mAbs available
from the Fifth International Leukocyte Typing Workshop that had been shown to stain both B cells and FDCs,
stained p7D6 cDNA transfected Cos7 cells or L cells (not
shown). However, mAb 7D6 is specific for FDC, and does
not recognize CD21 expressed on other cells. Two CD21
isoforms have been described. A "long" form (CD21L) has
an extracellular domain with 16 short consensus repeats
(SCR) (Fig. 2), and is encoded by p7D6 and the clone described earlier (23). A short CD21 isoform was reported
with an extracellular domain containing only 15 SCRs,
the missing SCR (SCR10a) of 59 amino acids being encoded by 177 bp (Fig. 2) (23). Whether the mAb 7D6
epitope is encoded by SCR10a, or is a conformational determinant induced elsewhere in the molecule by the presence of SCR10a, is not known.
The pattern of mAb 7D6 staining
suggests that FDC specifically express CD21L, while B cells
specifically express CD21S. To directly test this hypothesis,
a PCR assay using a 5
primer starting from basepair 1704 and a 3
primer starting from basepair 2363 of the short
CR2/CD21 sequence, was carried out on RNA from 104
highly purified FDC (Fig. 3) in parallel with follicular mantle B cells (FM) and GC B cells isolated by FACS® sorting.
Fig. 4 shows that a single large PCR product was generated from FDC, and a single smaller PCR product was generated from both FM and from GC B cells of the same donor. Further, sequencing analysis of these two PCR products shows that the FDC-derived large PCR product is
836 bp containing the 177-bp insertion that encodes the
SCR10a. The B cell-derived PCR product is 659 bp, which
does not contain the 177-bp insert (Fig. 5).
FM, and IgD
CD38+ GC B cells.
The method for FDC isolation is detailed in Materials and Methods and
in Fig. 3. PCR primers used are indicated in the legend for Fig. 2. p7D6
cDNA was used as a positive control.
mAbs DRC-1 and KiM4 have been widely used as human FDC-specific antibodies, but the target antigen(s) have not been characterized (16, 17). Interestingly, both DRC-1 and KiM4 strongly and specifically stain COS7 cells as well as L cells transfected with CD21L cDNA (not shown). This indicates that 7D6, DRC-1, and KiM4 specifically recognize the CR2/CD21L that is selectively expressed by FDCs. The weak staining of DRC-1 and KiM4 on tonsillar B cells may be explained by the cross-reaction of these two antibodies to CD21S expressed on B cells.
In conclusion, the present study demonstrates that FDC express the SCR10a-containing CD21L, and this long form of CD21 appears to be a specific cell surface marker for FDC. In contrast, B cells express the short form of CD21. The low frequency of isolation of CD21L cDNAs from a tonsillar cDNA library reported earlier was probably due to the fact that FDC are considerably less abundant in tonsil than B cells (23). Thus, FDC and B cells exhibit a cell type-specific splicing mechanism for CD21 expression.
CR2/CD21 has been shown to play key roles in B cell
activation and humoral immune responses. Monoclonal
anti-CD21 and a recombinant CD21-Ig fusion protein
suppressed IgG responses to T cell-dependent antigens in
mice (24, 25). CD21-deficient mice exhibit deficiencies in
a B cell (B-1a) compartment, and in their ability to generate a T-dependent antibody response and GC reaction
(26). Remarkably, antigen (hen egg lysozyme; HEL) attached to C3d (HEL-C3d) was 1,000-10,000-fold more
immunogenic than HEL alone when these antigens were
administered to mice (27). Several possible mechanisms have been proposed for the biological functions of CR2/
CD21: (a) long-term retaining and presenting native antigens in the form of immune complexes on FDC, (b) binding the B cell activation antigen CD23/Fc
RII (28), and (c)
serving as a co-receptor for B cell activation within the
TAPA-1/CD19/CD21 complex (29).
The differential expression of CD21L and CD21S, respectively, on FDCs and B cells, may suggest their different functions. For example, understanding the functional significance of the additional SCR10a exon may provide a clue for explaining the mechanisms by which FDCs retain native antigen and costimulate GC B cells. The availability of anti-CD21L antibodies specific for FDCs will facilitate their purification after studies of their developmental pathway and their functional characterization.
Address correspondence to Dr Yong-Jun Liu, Schering-Plough, Laboratory for Immunological Research, 69571 Dardilly Cedex, France.
Received for publication 19 August 1996
The present address of J. Xu is Corixa Corporation, Seattle, WA 88104.We thank Dr. Wei-Feng Chen for contributions to the early phase of this project. We are grateful to S. Bonnet-Arnaud and M. Vatan for editorial assistance and to Dr. Chiller for support and discussions. Géraldine Grouard received a grant from Fondation Marcel Mérieux, Lyon, France.
| 1. | Steinman, R.M., and M.C. Nussenzweig. 1980. Dendritic cells: features and functions. Immunol. Rev. 53: 127-147 [Medline] . |
| 2. | Nossal, G.J.V., A. Abbot, J. Mitchell, and Z. Lummus. 1968. Antigens in immunity. XV. Ultrastructural features of antigen capture in primary and secondary lymphoid follicles. J. Exp. Med. 127: 277-290 [Abstract] . |
| 3. | Tew, J.G., M.H. Kosco, G.F. Burton, and A.K. Szakal. 1990. Follicular dendritic cells as accessory cells. Immunol. Rev. 117: 185-211 [Medline] . |
| 4. | Liu, Y.J., G.D. Johnson, J. Gordon, and I.C.M. MacLennan. 1992. Germinal centers in T-cell-dependent antibody responses. Immunol. Today. 13: 17-21 [Medline] . |
| 5. | Berek, C., A. Berger, and M. Apel. 1991. Maturation of the immune response in germinal centers. Cell. 67: 1121-1129 [Medline] . |
| 6. | Jacob, J., G. Kelsoe, K. Rajewsky, and U. Weiss. 1991. Intraclonal generation of antibody mutants in germinal centres. Nature (Lond.). 354: 389-392 [Medline] . |
| 7. | Liu, Y.J., F. Malisan, O. de Bouteiller, C. Guret, S. Lebecque, J. Banchereau, F.C. Mills, E.E. Max, and H. Martinez-Valdez. 1996. Within germinal centers isotype switching of immunoglobulin genes occurs after onset of somatic mutation. Immunity. 4: 241-250 [Medline] . |
| 8. | Liu, Y.J., D.E. Joshua, G.T. Williams, C.A. Smith, J. Gordon, and I.C.M. MacLennan. 1989. Mechanisms of antigendriven selection in germinal centers. Nature (Lond.). 342: 929-931 [Medline] . |
| 9. | Kosco, V.M.H., G.F. Burton, Z.F. Kapasi, A.K. Szakal, and J.G. Tew. 1989. Antibody-forming cell induction during an early phase of germinal centre development and its delay with ageing. Immunology. 68: 312-318 [Medline] . |
| 10. | Coico, R.F., G.W. Siskind, and G.J. Thorbecke. 1988. Role of IgD and T cells in the regulation of the humoral immune response. Immunol. Rev. 105: 45-67 [Medline] . |
| 11. |
Arpin, C.,
J. Dechanet,
C. van Kooten,
P. Merville,
G. Grouard,
F. Brière,
J. Banchereau, and
Y.-J. Liu.
1995.
Generation
of memory B cells and plasma cells in vitro.
Science (Wash.
DC).
268:
720-722
|
| 12. | Burton, G.F., D.H. Conrad, A.K. Szakal, and J.G. Tew. 1993. Follicular dendritic cells and B-cell costimulation. J. Immunol. 150: 31-38 [Abstract] . |
| 13. | Grouard, G., O. de Bouteiller, J. Banchereau, and Y.-J. Liu. 1995. Human follicular dendritic cells enhance cytokine dependent growth and differentiation of CD40 activated B cells. J. Immunol. 155: 3345-3352 [Abstract] . |
| 14. | Lindhout, E., M.L. Mevissen, J. Kwekkeboom, J.M. Tager, and C. de-Groot. 1993. Direct evidence that human follicular dendritic cells (FDC) rescue germinal center cells from death by apoptosis. Clin. Exp. Immunol. 91: 330-336 [Medline] . |
| 15. |
Kosco-Vilbois, V.M.H.,
D. Gray,
D. Scheidegger, and
M. Julius.
1993.
Follicular dendritic cells help resting B cells to
become effective antigen-presenting cells: induction of B7/
BB1 and upregulation of major histocompatibility complex
class II molecules.
J. Exp. Med.
178:
2055-2066
|
| 16. |
Naiem, M.,
J. Gerdes,
Z. Abdulaziz,
H. Stein, and
D.Y. Mason.
1983.
Production of a monoclonal antibody reactive
with human dendritic reticulum cells and its use in the immunohistological analysis of lymphoid tissue.
J. Clin. Pathol.
(Lond.).
36:
167-175
|
| 17. | Parwaresch, M.R., H.J. Radzun, A.C. Feller, K.P. Peters, and M.L. Hansmann. 1983. Peroxidase-positive mononuclear leukocytes as possible precursors of human dendritic reticulum cells. J. Immunol. 131: 2719-2725 [Abstract] . |
| 18. |
Ho, A.S-Y.,
Y. Liu,
T.A. Khan,
D-H. Hsu,
J.F. Bazan, and
W.K. Moore.
1993.
A receptor for interleukin-10 is related
to interferon receptors.
Proc. Natl. Acad. Sci. USA.
90:
11267-11271
|
| 19. |
Elliott, J.F.,
G.R. Albrecht,
A. Gilladoga,
S. Handunetti,
J. Neequaye,
G. Lallinger,
J.N. Minjas, and
R.J. Howard.
1990.
Genes for plasmodium falciparum surface antigens
cloned by expression in COS cells.
Proc. Natl. Acad. Sci.
USA.
87:
6363-6367
|
| 20. | MacNeil, I., J. Kennedy, D.I. Godfrey, N.A. Jenkins, M. Masciantonio, C. Mineo, D.J. Gilbert, N.G. Copeland, R.I. Boyd, and A. Zlotnik. 1993. Isolation of a cDNA encoding thymic shared antigen-1. A new member of the Ly6 family with a possible role in T cell development. J. Immunol. 151: 6913-6923 [Abstract] . |
| 21. |
Moore, M.D.,
N.R. Cooper,
B.F. Tack, and
G.R. Nemerow.
1987.
Molecular cloning of the cDNA encoding the
Epstein-Barr virus/C3d receptor (complement receptor type
2) of human B lymphocytes.
Proc. Natl. Acad. Sci. USA.
84:
9194-9198
|
| 22. |
Fujisaku, A.,
J.B. Harley,
M.B. Frank,
B.A. Gruner,
B. Frazier, and
V.M. Holers.
1989.
Genomic organization and
polymorphisms of the human C3d/Epstein-Barr virus receptor.
J. Biol. Chem.
264:
2118-2125
|
| 23. |
Weis, J.J.,
L.E. Toothaker,
J.A. Smith,
J.H. Weis, and
D.T. Fearon.
1988.
Structure of the human B lymphocyte receptor
for C3d and the Epstein-Barr virus and relatedness to other
members of the family of C3/C4 binding proteins [erratum
published 168:1953-1954].
J. Exp. Med.
167:
1047-1066
|
| 24. |
Heyman, B.,
E.J. Wiersma, and
T. Kinoshita.
1991.
In vivo
inhibition of the antibody response by a complement receptor-specific monoclonal antibody.
J. Exp. Med.
172:
665-668
|
| 25. |
Hebell, T.,
J.M. Ahearn, and
D.T. Fearon.
1991.
Suppression
of the immune response by a soluble complement receptor of
B lymphocytes.
Science (Wash. DC).
254:
102-105
|
| 26. | Ahearn, J.M., M.B. Fisher, D. Croix, S. Goerg, M.H. Ma, J.R. Xia, X.N. Zhou, R.G. Howard, T.J. Rothstein, and M.C. Carroll. 1996. Disruption of the Cr2 locus results in a reduction in B-1a cells and in an impaired B cell response to T-dependent antigen. Immunity. 4: 251-262 [Medline] . |
| 27. | Dempsey, P.W., M.E. Allison, S. Akkaraju, C.C. Goodnow, and D.T. Fearon. 1996. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science (Wash. DC). 271: 348-350 [Abstract] . |
| 28. | Aubry, J.P.S., S. Pochon, P. Graber, K.U. Jansen, and J.Y. Bonnefoy. 1992. CD21 is a ligand for CD23 and regulates IgE production. Nature (Lond.). 385: 505-507 . |
| 29. | Fearon, D.T., and R.H. Carter. 1995. The CD19/CR2/ TAPA-1 complex of B lymphocytes: linking natural to acquired immunity. Annu. Rev. Immunol. 13: 127-149 [Medline] . |
| 30. | Ahearn, J.M., and D.T. Fearon. 1989. Structure and function of the complement receptors, CR1 (CD35) and CR2 (CD21). Adv. Immunol. 46: 183-219 [Medline] . |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|