The Journal of Experimental Medicine
Torrey Pines Biolabs
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roberts, J. L.
Right arrow Articles by Krangel, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roberts, J. L.
Right arrow Articles by Krangel, M. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Exp. Med.
© The Rockefeller University Press
0022-1007/97/01/131/10 $2.00
Volume 185 January 1997 131-140

Developmental Regulation of  VDJ Recombination By the Core Fragment of the T Cell Receptor alpha  Enhancer

By Joseph L. Roberts, Pilar Lauzurica, and Michael S. Krangel

From the Department of Immunology, Duke University Medical Center, Durham, North Carolina 27710

Summary
Materials and Methods
Results
Discussion
Footnotes
Acknowledgements
References


Summary

The role of T cell receptor alpha  enhancer (Ealpha ) cis-acting elements in the developmental regulation of VDJ recombination at the TCR alpha /delta locus was examined in transgenic mice containing variants of a minilocus VDJ recombination substrate. We demonstrate that the 116-bp Talpha 1,2 core enhancer fragment of the 1.4-kb Ealpha is sufficient to activate the enhancer-dependent step of minilocus rearrangement, and that within Talpha 1,2, intact binding sites for TCF/LEF and Ets family transcription factors are essential. Although minilocus rearrangement under the control of the 1.4-kb Ealpha initiates at fetal day 16.5 and is strictly limited to alpha beta T cells, we find that rearrangement under the control of Talpha 1,2 initiates slightly earlier during ontogeny and occurs in both gamma delta and alpha beta T cells. We conclude that the core fragment of Ealpha can establish accessibility to the recombinase in developing thymocytes in vivo in a fashion that is dependent on the binding of TCF/LEF and Ets family transcription factors, but that these and other factors that bind to the Ealpha core cannot account for the precise developmental onset of accessibility that is provided by the intact Ealpha . Rather, our data suggests a critical role for factors that bind Ealpha outside of the core Talpha 1,2 region in establishing the precise developmental onset of TCR alpha  rearrangement in vivo.


Ordered recombination of TCR variable (V), diversity (D), and joining (  J ) gene segments is a process that is crucial for the generation of the diverse antigen recognition repertoires that characterize mature alpha beta and gamma delta T cells (1). The most immature thymic population has a CD4low CD8-CD3-CD25-HSA+ phenotype and has all TCR genes in unrearranged configuration (4). These cells subsequently lose expression of CD4 to become CD4-CD8- double negative (DN)1 cells, which can be further subdivided into four distinct populations on the basis of CD44 and CD25 expression. DN thymocytes mature from CD44hi CD25- to CD44hiCD25+ to CD44lowCD25+ to CD44low CD25- (5, 6). The CD44lowCD25+ DN subset expresses high levels of RAG-1 and RAG-2 and undergoes extensive VDJ recombination at the TCR-beta , -gamma , and -delta loci (7, 8). In-frame TCR-beta rearrangement directs the synthesis of a TCR-beta protein which, in conjunction with pTalpha , forms a pre-TCR (9, 10) that functions to inhibit RAG-1 and RAG-2 expression, to drive thymocyte proliferation, and to drive thymocyte maturation through the CD44lowCD25- DN and immature single positive (ISP) stages to the CD4+CD8+ double positive (DP) stage (7, 8, 11). TCR-alpha rearrangement is activated as thymocytes transit into the DP stage (5, 7, 14).

The relationship between TCR gene rearrangement events and thymocyte commitment to the alpha beta or gamma delta lineage has been an area of intense interest. As TCR-beta and TCR-gamma rearrangements are found in both alpha beta and gamma delta T cells, the initiation of rearrangement events at these loci is not associated with lineage commitment. TCR-delta gene segments lie within Valpha and Jalpha gene segments in the complex TCR-alpha /delta locus and are therefore deleted by Valpha to Jalpha rearrangement (15). Recent reports have identified rearranged TCR-delta genes in ISP precursors of alpha beta T cells before the onset of TCR-alpha rearrangement (14) and on Valpha -Jalpha excision products in alpha beta thymocytes and peripheral T cells (18), arguing that TCR-delta gene rearrangement is initiated in a common precursor of alpha beta and gamma delta T cells as well. Because excised TCR-delta gene VDJ recombination products are relatively depleted of in-frame rearrangements (18, 19), it appears likely that functional TCR-delta and TCR-gamma rearrangement can commit thymocytes towards the gamma delta pathway and away from the alpha beta pathway. However, because at least some gamma delta cells show evidence of selection on the basis of functional TCR-beta gene rearrangement (11), and late stage CD44lowCD25- DN thymocytes have been shown to include precursors of both alpha beta and gamma delta T cells (21), at least some thymocytes may remain uncommitted until very late in the DN population. The activation of TCR-alpha rearrangement as thymocytes transit into the DP stage, with concomitant deletion of TCR-delta , must irrevocably assign all remaining uncommitted thymocytes to the alpha beta pathway. TCR-alpha is therefore the only TCR gene whose rearrangement is activated in a lineage-specific fashion. The mechanisms that establish the developmental onset of TCR-alpha rearrangement are therefore of particular interest.

Numerous studies have demonstrated that transcriptional promoters and enhancers play an important role in the developmental regulation of VDJ recombination at TCR and Ig loci, probably by modulating accessibility of chromosomal recombination substrates to the recombinase machinery (for recent reviews, see references 22, 23). We have examined the role of transcriptional enhancers in the temporal and lineage-specific control of VDJ recombination at the TCR-alpha /delta locus by evaluating VDJ recombination in transgenic mice carrying variants of a human TCR-delta gene minilocus rearrangement substrate that included either the 1.4-kb TCR-delta enhancer (Edelta ) or the 1.4-kb TCR-alpha enhancer (Ealpha ) (24, 25). We found that the developmental regulation of minilocus rearrangement under the control of Edelta or Ealpha paralleled that found at the endogenous TCR-alpha /delta locus. Specifically, in Edelta -bearing transgenic lines, the enhancer-dependent VD to J step of minilocus rearrangement began on fetal day 14.5 and was equivalent in alpha beta and gamma delta T cells, much like endogenous Vdelta Ddelta Jdelta rearrangement. In Ealpha bearing transgenic lines, VD to J rearrangement was delayed until fetal day 16.5 and was limited to alpha beta cells, much like endogenous Valpha Jalpha rearrangement (25). These results imply that Edelta and Ealpha play important roles in the developmental regulation of Vdelta Ddelta Jdelta and Valpha Jalpha rearrangement, respectively, at the endogenous TCR-alpha /delta locus.

An important goal of ours has been to identify the cisacting elements of Ealpha that are critical in establishing the precise developmental regulation of Valpha Jalpha rearrangement at the TCR-alpha /delta locus. The core or minimal enhancer fragment of Ealpha has been defined as a 116-bp fragment (Talpha 1,2) that contains binding sites for several transcription factors, including ATF/CREB, TCF-1/LEF-1, CBF/PEBP2, and Ets proteins (26). This definition as a core or minimal enhancer is based on the ability of Talpha 1,2 to potently activate plasmid reporter gene expression in transient transfection experiments and the critical role played by each of the defined factor binding sites for significant enhancer activity. Further supporting the role of this enhancer fragment as a discrete functional unit is its ability to support the cooperative assembly of a stable nucleoprotein complex in vitro in the presence of the various transcription factors noted above (28). These transcription factors and their cognate binding sites in Talpha 1,2 are therefore attractive candidates for contributing to the developmental regulation of VDJ recombination by Ealpha in vivo. Two of these binding sites were selected for analysis in the present study. The first binds the related TCF-1 and LEF-1 members of the high mobility group (HMG) -1 box family of DNA binding proteins (29). These proteins bind to the minor groove of DNA and induce a sharp bend in the DNA helix that, in the case of LEF-1, has been shown to facilitate interactions between Ets-1 and ATF/CREB proteins bound at nonadjacent sites in Talpha 1,2 to generate a stable and active nucleoprotein complex (28, 32). Transient transfection experiments have shown that an intact TCF-1/LEF-1 binding site is essential for Talpha 1,2 enhancer activity, and that LEF-1 and TCF-1 can both transactivate reporter gene expression by binding to Talpha 1,2 (28, 29, 31). The second cis-acting element studied is the binding site for members of the Ets family of transcription factors. Transient transfection experiments have shown that an intact Ets binding site is also required for Talpha 1,2 enhancer activity, and that the Ets-1 protein can bind to Talpha 1,2 and transactivate a Talpha 1,2-driven reporter gene as well (28, 33).

In the present study, we examine VDJ recombination of the TCR delta  gene minilocus under the control of wild-type Talpha 1,2 sequences and compare it with VDJ recombination mediated by Talpha 1,2 fragments carrying mutations in either the TCF/LEF- or Ets binding sites. Our results indicate the Talpha 1,2 core enhancer can activate VDJ recombination in a fashion that is dependent on TCF/LEF and Ets family transcription factors, but that additional Ealpha sequences that lie outside of the enhancer core are required for precise developmental control.


Materials and Methods

Transgenic Mice. The Ets binding site mutation (Talpha 1,2mEts) was generated by PCR using the 700-bp BstXI fragment of the human Ealpha cloned into the BamHI site of pUC13 (Ealpha 0.7) as a template (26) (provided by J. Leiden, University of Chicago, Chicago, IL). PCR was performed using the mutagenic oligonucleotide Ets ( TATTTTAAACTCTTCTTTCCAGAACTTGTGGCTTCT ) and the -40 primer. The PCR product was digested with DraI and EcoRI to generate a 135-bp fragment that was ligated into SmaI and EcoRI cut pBluescript KS+. Dideoxynucleotide sequence analysis of the resultant plasmid confirmed that the insert carried a 3-bp change in the Talpha 1,2 Ets binding site. The 125-bp Talpha 1,2mEts was excised from this plasmid by digestion with BamHI (plus PvuI to further cleave the plasmid and prevent subsequent religation), and the ends were blunted by treatment with the Klenow fragment of Escherichia coli DNA polymerase I. The Talpha 1,2mEts fragment was then ligated into XbaI-digested, blunted, and phosphatase-treated pBluescript carrying the previously described enhancerless minilocus (24).

Talpha 1,2 with a 2-bp mutation in the TCF/LEF binding site (Talpha 1,2mTCF) was generated by PCR overlap extension (34) using Ealpha 0.7 template DNA, mutagenic oligonucleotides TCF-1A (GGGAGAGCTTCTATGGGTGCCCTAC) and TCF-1B (GTAGGGCACCCATAGAAGCTCTCCC), along with the -40 and reverse primers. The final PCR product was digested with DraI and EcoRI, cloned into SmaI and EcoRI cut pBluescript KS+, and sequenced. The 125-bp Talpha 1,2mTCF fragment was then excised from the plasmid with BamHI, blunt ended with Klenow, and ligated into XbaI-digested, blunted, and phosphatase-treated pBluescript carrying the enhancerless minilocus.

The Talpha 1,2 fragment of Ealpha had been previously excised from the Ealpha 0.7 plasmid using BamHI and DraI digestion, blunt ended with Klenow, and subcloned into EcoRV cut pBluescript KS+. To generate a minilocus containing wild-type Talpha 1,2, the insert was excised from this plasmid by digestion with HindIII and SmaI, blunt ended with Klenow, and cloned into XbaI-digested, blunted, and phosphatase-treated pBluescript carrying the enhancerless minilocus.

After confirmation of minilocus construct structures by dideoxynucleotide sequence analysis, minilocus DNA was purified as previously described (24) and microinjected into fertilized (C57BL/6 × SJL/J)F2 eggs by the Duke University Comprehensive Cancer Center Shared Transgenic Mouse Facility. Progeny tail DNA was initially characterized on Southern blots probed with radiolabeled Cdelta and Vdelta 1 fragments. Transgene germline copy number was determined by analysis of Talpha 1,2, Talpha 1,2mEts, and Talpha 1,2mTCF tail DNAs, along with tail DNAs of previously identified single copy integrants, on slot blots (Schleicher & Schuell, Keene, NH). Blots were probed with a radiolabeled Cdelta fragment and the resultant hybridization signals quantified using a Betascope (Betagen, Waltham, MA). Transgenes were maintained on a mixed C57BL/6 × SJL/J background.

PCR. With the exception of experiments using sorted alpha beta and gamma delta cells depicted in Fig. 6, genomic DNA PCR templates were prepared from thymi of 4-wk-old animals by standard techniques (35). For single copy transgenic lines, 12 ng of genomic DNA was used as a template for PCR reactions. For multicopy integrants, the quantity of genomic DNA used in PCR was reduced to account for copy number and to insure that all PCR signals were in the linear range. PCR templates from sorted alpha beta and gamma delta thymocytes (as well as unsorted thymocytes from the same animals) were prepared by incubation of <1 × 106 pelleted cells in 200 µl lysis buffer (10 mM Tris, pH 8.4, 2.5 mM MgCl2, 50 mM KCl, 200 µg/ml gelatin, 0.45% NP40, 0.45% Tween-20, and 60 µg/ml proteinase K) for 1 h at 56°C and then 15 min at 95°C (36). Sample aliquots containing 5 × 103 cell equivalents were immediately used as templates in PCR reactions. All PCR reactions were performed identically using previously described reaction conditions and primers (24).


Fig. 6. Talpha 1,2 minilocus rearrangement in alpha beta and gamma delta thymocytes. Genomic DNA templates from sorted alpha beta and gamma delta thymocytes and total unfractionated thymocytes (Tot.) of Talpha 1,2 line T2, T5, and T7 mice (4 wk old), and a no DNA control (-) were amplified by PCR and probed as in Fig. 2.
[View Larger Version of this Image (28K GIF file)]


Fig. 2. PCR analysis of Talpha 1,2 and Talpha 1,2mTCF minilocus rearrangement. Genomic DNA templates from unfractionated thymocytes of Talpha 1,2 mice from lines T2, T3, T5, and T7, and of Talpha 1,2mTCF mice from lines JI, JJ, JK, JL, and JM (all 4 wk old) were amplifed by PCR using the indicated primers. Southern blots were probed with radiolabeled Cdelta , Vdelta 1, or Vdelta 2 DNA fragments. The positions of 1.2-kb VD and 0.3-kb VDJ rearrangement products are indicated.
[View Larger Version of this Image (35K GIF file)]

Blot Hybridization of Genomic DNA and PCR Products. Gel electrophoresis, blotting, and hybridization with 32P-labeled probes were performed as previously described (24). Hybridization signals were quantified using a Betascope and reported values for VD and VDJ rearrangement signals were normalized to the Cdelta signal for each template.

Antibodies. Biotinylated H57-597 anti-TCR-beta , phycoerythrin-conjugated GL3 anti-TCR-gamma delta , FITC-streptavidin, and unlabeled 2.4G2 anti-Fcgamma RII/III mAbs for flow cytometry were obtained from PharMingen (San Diego, CA). GK1.5 anti-CD4 (37) and 41-3.48 anti-Lyt-2.2 (38) mAbs were used for cell depletions as culture supernatants.

Flow Cytometric Analysis and Cell Sorting. Enriched CD4-CD8- cells were prepared from single cell suspensions of thymocytes from 4-wk-old animals by treatment with saturating amounts of GK1.5 and 41-3.48 mAbs and rabbit complement (Cedarlane Laboratories, Ltd., Hornby, ON, Canada) for 60 min at 37°C. Viable cells were collected after centrifugation over Lympholyte-M (Cedarlane Labs. Ltd.). The enriched CD4-CD8- cells and unfractionated thymocytes from the same animal were incubated with saturating concentrations of unlabeled 2.4G2, biotinylated H57597, and phycoerythrin-GL3 for 40 min at 4°C in PBS with 0.1% BSA and 0.1% NaN3, washed twice, and then stained with FITC-Streptavidin for 20 min at 4°C. Cells were subsequently washed and sorted using a FACStar Plus® (Becton Dickinson, Mountain View, CA). H57-597+ alpha beta cells were sorted using stained unfractionated thymocytes as a starting population while GL3+ gamma delta cells were sorted using identically stained, enriched CD4-CD8- cells as a starting population. Immediate reanalysis of sorted populations by two-color flow cytometry revealed contamination with <1% of cells expressing the inappropriate cell surface TCR in all cases.

Fetal Thymus Samples. Fetal mice were obtained from timed matings of homozygous transgenic males and 6-8-wk-old (C57BL/6 × SJL/J)F1 females (Jackson Laboratory, Bar Harbor, ME). The day of detecting a vaginal plug was designated as day 0.5 of embryonic development. Genomic DNA prepared by standard techniques from pooled fetal thymi of individual litters was analyzed for minilocus rearrangement by PCR.


Results

The 116-bp Core Ealpha Fragment Talpha 1,2 Is Sufficient to Activate Minilocus Rearrangement In Vivo.

The rearrangement substrate used in the present study has been previously described as a 22.5-kb human TCR-delta gene minilocus consisting of germline Vdelta 1, Vdelta 2, Ddelta 3, Jdelta 1, Jdelta 3, and Cdelta gene segments (24). Frameshift mutations within the Vdelta 1 and Vdelta 2 coding segments prevent the rearranged transgene from encoding a functional TCR polypeptide that could alter normal T cell development in transgenic mice. The initial step of transgene rearrangement, V to D, is enhancer independent (24). The second step of transgene rearrangement, VD to J, is dependent on the presence of a functional enhancer in the Jdelta 3-Cdelta intron. Thus, we infer that the enhancer is required to promote J segment accessibility to the recombinase (24). The 1.4-kb Ealpha has been shown to efficiently activate VD to J rearrangement in this system (25). To determine whether Talpha 1,2, the 116-bp core fragment of Ealpha , was also sufficient to activate minilocus VDJ recombination in vivo, we constructed a new TCR-delta gene minilocus containing this fragment in place of Ealpha (Fig. 1 A). Four independent transgenic lines denoted T2, T3, T5, and T7 were established and determined by slot blot analysis to carry 28, 1, 3, and 4 transgene copies, respectively.


Fig. 1. Human TCR-delta gene minilocus. (A) Diagram of the three Talpha 1,2-containing minilocus constructs. Solid boxes, exons, open boxes, protein binding sites. Wild-type and mutant Talpha 2 sequences are shown. (B) PCR products generated from Vdelta 1 rearrangements are depicted along with the Vdelta 1 and Jdelta 1 primers (arrows) used. Similar products are generated using Vdelta 2 and Jdelta 1 primers. Specific PCR products are not generated from unrearranged templates because of the large distances between primers. The primers do not amplify products from the endogenous murine TCR-delta locus.
[View Larger Version of this Image (21K GIF file)]

VDJ recombination in the four Talpha 1,2 transgenic lines was assessed by quantitative PCR of thymic genomic DNA templates that were amplified using primers specific for minilocus Vdelta 1, Vdelta 2, and Jdelta 1 gene segments (24). PCR using primer combinations Vdelta 1-Jdelta 1 or Vdelta 2-Jdelta 1 yields a 0.3-kb product resulting from transgene VDJ rearrangement and a 1.2-kb fragment resulting from VD rearrangement (Fig. 1 B), both of which can be detected on Southern blots probed with radiolabeled Vdelta 1- or Vdelta 2-specific DNA fragments. Amplification of a 0.3-kb rearrangement-independent product with a pair of Cdelta primers serves as an internal control for PCR efficiency and allows quantitative comparison of rearrangement patterns between different templates. As seen in Fig. 2 and Table 1, low levels of Vdelta 1-Ddelta 3 and high levels of Vdelta 1-Ddelta 3-Jdelta 1 rearrangement were observed in three of four Talpha 1,2 lines (T2, T5, and T7). Levels of Vdelta 1Ddelta 3-Jdelta 1 rearrangement in thymocytes from lines T2 and T5 were 60 and 38%, respectively, of that found in thymocytes from Ealpha line J, which includes the intact 1.4-kb Ealpha (Fig. 3, Table 2). However, VD and VDJ rearranged products were barely detectable in Talpha 1,2 line T3 (Fig. 2, Table 1). Similar variability in rearrangement phenotype among different lines of animals bearing an identical construct has been noted in our previous studies (24, 39) and is likely due to inherent differences in transgene integration sites. We suggest that the minilocus is integrated into a relatively inactive region of chromatin in line T3; in support of this notion, preliminary in vivo footprinting studies have demonstrated markedly diminished protection of protein binding sites within Talpha 1,2 in thymus DNA of T3 mice as compared with thymus DNA of T2, T5, or T7 mice (HernandezMunain, C., personal communication). Taken as a whole, our results demonstrate that the 116-bp Talpha 1,2 fragment of Ealpha is, in most contexts, sufficient to mediate activation of the enhancer-dependent VD to J step of minilocus rearrangement. The apparently less efficient conversion of Vdelta 2Ddelta 3 to Vdelta 2-Ddelta 3-Jdelta 1 in these lines is probably related to our previous observation that Vdelta 2 rearrangement is only ~10% as efficient as Vdelta 1 rearrangement in this system (24).

Table 1. Minilocus Rearrangement in Thymocytes of Talpha 1,2 and Talpha 1,2mTCF Mice


Talpha 1,2 Talpha 1,2mTCF
T2 T3 T5 T7 JI JJ JK JL JM

Vdelta 1-Ddelta 3 0.16 0.01 0.15 0.20 0.97 2.77 1.17 0.15 0.03
Vdelta 1-Ddelta 3-Jdelta 1 1.00 0.03 0.88 1.88 0.03 0.07 0.05 nd nd

Blot hybridization signals from the experiment shown in Fig. 2 were quantified using a Betascope. Reported values are normalized to the Cdelta signal for each sample. nd, not detected.


Fig. 3. PCR analysis of Ealpha , Talpha 1,2, and Talpha 1,2mEts minilocus rearrangement. Genomic DNA templates from unfractionated thymocytes of an Ealpha mouse from line J, of Talpha 1,2 mice from lines T2 and T5, and of Talpha 1,2mEts mice from lines JN, JR, and JO (all 4 wk old) were amplified by PCR and probed as in Fig. 2.
[View Larger Version of this Image (54K GIF file)]

Table 2. Minilocus Rearrangement in Thymocytes of Ealpha , Talpha 1,2, and Talpha 1,2mEts Mice


Ealpha Talpha 1,2 Talpha 1,2mEts
J T2 T5 JN JR JO

Vdelta 1-Ddelta 3 0.30 0.15 0.19 1.09 0.77 0.99
Vdelta 1-Ddelta 3-Jdelta 1 4.52 2.67 1.72 0.14 0.19 0.11

Blot hybridization signals from the experiment shown in Fig. 3 were quantified using a Betascope. Reported values are normalized to the Cdelta signal for each sample.

Talpha 1,2 and Ealpha minilocus rearrangement was also analyzed directly by genomic Southern blot (Fig. 4) as an independent means of corroborating results obtained by quantitative PCR. Analysis of Vdelta 1 rearrangements in PstI plus EcoRI-digested thymus DNA from Ealpha line L revealed low levels of 1.0-kb germline Vdelta 1 and 0.9-kb Vdelta 1-Ddelta 3 rearranged fragments, and higher levels of a 1.7-kb species resulting from Vdelta 1-Ddelta 3-Jdelta 1 rearrangement (Fig. 4). Similar results were obtained with Ealpha line J (data not shown). Analysis of similarly digested thymocyte DNA from Talpha 1,2 line T2 also revealed levels of the fully rearranged Vdelta 1Ddelta 3-Jdelta 1 fragment that were more prevalent than the 0.9-kb partially rearranged (Vdelta 1-Ddelta 3) species (Fig. 4). Hence, these results are consistent with those obtained by PCR and provide confirmation that Talpha 1,2 alone can efficiently activate minilocus VDJ recombination.


Fig. 4. Analysis of minilocus rearrangement by genomic Southern blot. PstI plus EcoRI-digested tail and thymus genomic DNA samples from Ealpha line L, Talpha 1,2 line T2, Talpha 1,2mTCF line JI, and Talpha 1,2mEts line JO mice (all 4 wk old) were analyzed by Southern blot using a radiolabeled 1.0-kb Vdelta 1 genomic PstI fragment. Positions of the expected 1.0-kb germline, 0.9-kb Vdelta 1-Ddelta 3, and 3.2-kb Vdelta 1-Ddelta 3-Jdelta 1 rearranged fragments are indicated.
[View Larger Version of this Image (63K GIF file)]

The conspicuous variations in total Vdelta 1 hybridization signal intensities seen in this experiment (Fig. 4) result in part from differences in germline transgene copy number between the various transgenic lines (T2 = 28, L = 13). A diminution of total Vdelta 1 signal intensity in thymus DNA relative to tail DNA isolated from the same animal is also apparent, particularly in line T2 (Fig. 4). Slot blot quantification revealed Cdelta copy number to be 13 in line L tail and 8 in L thymus, and although 28 in T2 tail, only 4 in T2 thymus (data not shown). Such copy number loss has been noted in some other multicopy lines as well, and is likely due to thymocyte rearrangement events between V, D, and J gene segments within different, presumably concatameric, copies of the minilocus, with resultant loss of intervening sequences. These differences in thymus transgene copy number are not apparent in PCR experiments where thymus template amounts were adjusted for Cdelta copy number.

An Intact TCF/LEF Binding Site Is Required for Efficient Activation of Minilocus VD to J Rearrangement by Talpha 1,2.

To determine whether the activation of minilocus VDJ recombination by Talpha 1,2 in vivo is dependent on TCF/LEF family transcription factors, a variant of the Talpha 1,2 minilocus containing a 2-bp mutation in the TCF-1/LEF-1 binding site (Talpha 1,2 mTCF) was constructed (Fig. 1 A). Five independent lines of Talpha 1,2mTCF transgenic mice were generated. Slot blot analysis revealed that Talpha 1,2mTCF lines JL and JM each carry one copy of the minilocus, whereas lines JI, JJ, and JK carry 5, 12, and 9 copies, respectively (data not shown). Analysis of Talpha 1,2mTCF minilocus VDJ recombination was performed by quantitative PCR, as described above. Notably, as assessed using both Vdelta 1-Jdelta 1 and Vdelta 2-Jdelta 1 primer combinations, all five Talpha 1,2mTCF lines displayed dramatically reduced levels of VDJ rearranged products as compared with wild-type Talpha 1,2 lines T2, T5, and T7 (Fig. 2). Quantification revealed levels of Vdelta 1-Ddelta 3Jdelta 1 rearrangement in Talpha 1,2mTCF lines JI, JJ, and JK that were only 3, 7, and 5%, respectively, of that observed in wild-type Talpha 1,2 line T2 (Table 1). In lines JL and JM, Vdelta 1-Ddelta 3-Jdelta 1 rearrangement was undetectable. Because V to D rearrangement was readily detectable in most transgenic lines, these results argue that mutation of the TCF/ LEF site significantly and specifically impairs the VD to J step of minilocus VDJ recombination. Verification of these results was obtained by genomic Southern blot analysis which revealed an abundance of germline Vdelta 1 and Vdelta 1Ddelta 3 rearranged fragments, but no detectable Vdelta 1-Ddelta 3-Jdelta 1 rearrangement in PstI plus EcoRI digested thymus DNA from Talpha 1,2mTCF line JI (Fig. 4).

The relatively low level of V to D rearrangement in Talpha 1,2mTCF lines JL and JM may, in part, be a reflection of unique properties of the transgene integration sites. However, it is interesting that all three transgenic lines examined in this study displaying very low levels of total rearrangement (Talpha 1,2 line T3, and Talpha 1,2mTCF lines JL and JM) are all single copy. This suggests an effect of copy number as well. Nevertheless, multicopy integrants are not required for efficient transgene VDJ recombination, as evidenced by the previously characterized Edelta -containing lines A, B, and C (24), and the Talpha 1,2mEts line JN (see below). It may be that while a single copy transgene experiences the full negative impact of integration into a relatively inactive region of chromatin, internal copies of a concatameric multicopy integrant might be relatively protected from such effects.

An Intact Ets Binding Site Is also Necessary for Efficient Activation of Minilocus VD to J Rearrangement By Talpha 1,2.

To determine whether the activation of minilocus VDJ recombination by Talpha 1,2 in vivo is dependent on Ets family transcription factors, a second variant of the Talpha 1,2 minilocus containing a 3-bp mutation in the Talpha 2 Ets binding site (Talpha 1,2mEts) was constructed. The three independent lines of transgenic mice generated, JN, JO, and JR, were found to carry 1, 13, and 21 copies of the minilocus, respectively, as assessed by slot blot analysis. VDJ rearrangement in thymocytes from Talpha 1,2mEts animals was compared with that of wild-type Talpha 1,2 and Ealpha mice by quantitative PCR. This analysis revealed that the VD to J step of transgene rearrangement was dramatically curtailed in all three lines of Talpha 1,2mEts transgenic animals (Fig. 3). Specifically, the levels of Vdelta 1- Ddelta 3-Jdelta 1 rearrangement in Talpha 1,2mEts lines JN, JR, and JO were only 5, 7, and 4% of that of wild-type Talpha 1,2 line T2 (Table 2); Vdelta 2-Ddelta 3-Jdelta 1 rearrangement was only barely detectable (Fig. 3). Nevertheless, VD rearrangement was high in all three lines (Fig. 3). These results were also corroborated by genomic Southern blot of digested thymus DNA from Talpha 1,2mEts line JO, which failed to reveal a discernible Vdelta 1-Ddelta 3-Jdelta 1 fragment despite readily detectable Vdelta 1Ddelta 3 rearrangement (Fig. 4). From these data we conclude that the presence of an intact Ets binding site within Talpha 1,2 is a prerequisite for efficient activation of the VD to J step of minilocus rearrangement in vivo.

Temporal and Lineage-specific Control of Minilocus Rearrangement By Talpha 1,2 Is Distinct from that of Ealpha .

The 1.4-kb Ealpha has been previously shown to confer physiologically appropriate developmental control to the enhancer-dependent VD to J step of minilocus rearrangement. Because the 116-bp Talpha 1,2 core enhancer fragment proved sufficient to activate minilocus rearrangement, we asked whether the core enhancer fragment is sufficient to impart precise developmental control as well. Accordingly, we examined the timing of minilocus VDJ rearrangement during ontogeny in Talpha 1,2 transgenic animals. PCR analysis of fetal thymus genomic DNA templates from line T2 timed pregnancies revealed that the VD to J step of minilocus rearrangement began on fetal day 15.5 (Fig. 5), one day earlier than that previously noted in Ealpha line J (25). Identical results were obtained from analysis of Talpha 1,2 line T5 (data not shown). Thus, Talpha 1,2 appeared to be activated slightly earlier during fetal thymic ontogeny than the intact Ealpha .


Fig. 5. Time course of Talpha 1,2 minilocus rearrangement during fetal ontogeny. Genomic DNA samples from Talpha 1,2 line T2 thymi isolated on days 14.5-17.5 of gestation, as well as from a postnatal (PN) T2 mouse (4 wk old), were amplified by PCR and probed as in Fig. 2.
[View Larger Version of this Image (36K GIF file)]

We then compared minilocus VDJ recombination in sorted alpha beta and gamma delta T cell populations from adult Talpha 1,2 animals. As expected, PCR analyses revealed abundant VD and VDJ rearrangement in lines T2, T5, and T7 alpha beta thymocytes (Fig. 6). Strikingly, however, gamma delta thymocytes from these animals also exhibited substantial VDJ rearrangement (Fig. 6). Quantification of these data revealed that the level of Vdelta 1-Ddelta 3-Jdelta 1 rearrangement in gamma delta cells relative to alpha beta cells was 8% in line T2, 65% in line T5, and 19% in line T7 (Table 3). These results cannot be explained by contamination of cell populations, since flow cytometric reanalysis demonstrated that <1% of the cells in the sorted populations bore the inappropriate TCR. The results from all three lines contrast dramatically with previous observations in Ealpha mice; the level of Vdelta 1-Ddelta 3-Jdelta 1 rearrangement in gamma delta cells was negligible (2.5, 0.0, and 1.3% of the signal in alpha beta thymocytes in Ealpha lines J, L, and M, respectively, levels that are probably within the limits of purity of the sorted gamma delta populations [25]). From these results, we conclude that truncation of Ealpha results in partial dysregulation of VDJ recombination during development. Specifically, the slightly premature activation of VDJ recombination with relaxed lineage control that is directed by Talpha 1,2 suggests that Ealpha elements that lie outside of Talpha 1,2 are critical for the tightly regulated and physiologically appropriate activation of TCR-alpha gene rearrangement in vivo.

Table 3. Minilocus Rearrangement in alpha beta and gamma delta Thymocytes of Talpha 1,2 Animals


T2 T5 T7
 gamma delta  alpha beta  gamma delta  alpha beta  gamma delta  alpha beta

Vdelta 1-Ddelta 3 1.67 0.34 2.04 0.30 1.21 0.45
Vdelta 1-Ddelta 3-Jdelta 1 0.63 7.77 1.32 2.07 0.54 2.90

Blot hybridization signals from the experiment shown in Fig. 6 were quantified using a Betascope. Reported values are normalized to the Cdelta signal for each sample. Because quantification of T2, T5, and T7 samples was performed on separate blots probed at different times, the values for VD/C and VDJ/C are useful for comparison of the gamma delta and alpha beta samples within a line, but are not useful for comparisons between different lines.


Discussion

In this study, we examined the roles of cis-acting elements of Ealpha in the developmental regulation of VDJ recombination at the TCR-alpha /delta locus. We found that the 116-bp Talpha 1,2 core enhancer fragment of the 1.4-kb Ealpha is sufficient to activate the enhancer-dependent VD to J step of transgenic minilocus rearrangement, and that intact TCF/LEF and Ets binding sites within Talpha 1,2 are required. Investigation of the temporal and lineage-specific control of VDJ recombination afforded by Talpha 1,2 revealed that thymocyte VD to J rearrangement begins on fetal day 15.5 and occurs in both alpha beta and gamma delta cells. This contrasts with previous results obtained in transgenic lines carrying the 1.4-kb Ealpha , in which VD to J rearrangement was found to begin on fetal day 16.5 and to be limited to alpha beta cells (25). Taken together, these data indicate that the core fragment of Ealpha can establish accessibility to the recombinase in developing thymocytes in vivo in a fashion that is dependent on the binding of TCF/LEF and Ets family transcription factors, but that these and other factors that bind to the Ealpha core cannot account for the precise developmental onset of accessibility that is provided by the intact Ealpha . Rather, our data suggests a critical role for factors that bind Ealpha outside of the core Talpha 1,2 region in establishing the precise developmental onset of TCR-alpha rearrangement in vivo.

Previous studies identified the 116-bp Talpha 1,2 as the core fragment of Ealpha on the basis of its ability to potently activate plasmid reporter gene expression in transient transfection experiments, and its ability, as naked DNA, to support the assembly of a stable multiprotein complex consisting of ATF/CREB, LEF-1, Ets-1, and CBF/PEBP2 (26). Our experiments are the first to test the core fragment of Ealpha in a chromosomally integrated context. Our data indicates that this fragment is capable of modifying chromatin structure in vivo over a distance of at least 2 kb, as measured by its ability to modify the accessibility of the Jdelta 1 gene segment to the VDJ recombinase. Furthermore, our data are the first to provide evidence that TCF/LEF and Ets family transcription factors are important regulators of Ealpha in a chromosomal environment, suggesting that the multiprotein complex that was previously documented to assemble in vitro (28) may have an important role in regulating chromatin structure in vivo.

TCF-1 and LEF-1 are members of the HMG box family of transcription factors that bind at the same site within Talpha 1,2 (Fig. 1 A) (29). The roles of both of these factors have been analyzed in vivo by targeted gene disruption. Analysis of LEF-1-/- mice has revealed that, despite early postnatal lethality due to impaired development of multiple organs, TCR-alpha rearrangement and T cell development proceed normally (40). TCF-1-/- animals, on the other hand, are healthy and appear morphologically normal, but exhibit reduced numbers of apparently normal peripheral T cells and a significant impairment in thymocyte differentiation at the transition from the ISP to DP stages of development (41). TCR-beta rearrangement appears to be unaffected in these animals (41). However, since thymocyte TCR rearrangement and expression normally begins around the ISP to DP transition that is inhibited by TCF-1 gene disruption, it is difficult to judge whether TCR-alpha rearrangement is inhibited, albeit incompletely, as a primary consequence of the mutation.

Our experiments, which tested the effects of a disrupted TCF-1/LEF-1 binding site within Talpha 1,2 in a phenotypically neutral recombination reporter construct, clearly implicate TCF-1, LEF-1, or related factors in the developmental activation of minilocus VD to J rearrangement, and by implication, in the developmental activation of Valpha to Jalpha rearrangement at the endogenous TCR-alpha /delta locus. There are several reasons why our results may appear to contrast with those obtained by targeted gene disruption. First, our results may be easier to interpret unambiguously because there is no confounding effect on T cell development clouding the interpretation of perturbed transgene rearrangement. Second, our experimental approach, in which the binding site is mutated, accounts for the possibility that TCF-1 and LEF-1 might play important but redundant roles in regulating TCR-alpha gene rearrangement. Such redundancy might allow apparently normal TCR-alpha rearrangement and expression in gene targeted animals that lack either TCF-1 or LEF-1, but not both. Third, our experimental approach would detect an effect even if a related HMG family member, rather than TCF-1 or LEF-1, were the critical regulator of TCR-alpha gene rearrangement in vivo. Finally, our test of the TCF/LEF binding site mutation in the context of the Talpha 1,2 core enhancer, rather than the 1.4-kb Ealpha , may represent a more sensitive measure of the effect of protein binding to this site, as it eliminates the contribution of potentially redundant cis-acting Ealpha elements that lie outside of Talpha 1,2. Such elements might mask an effect in a TCF-1 or LEF-1 knockout, or in mutated versions of an otherwise intact Ealpha . Indeed, in transient transfection experiments, the DraI-ApaI Ealpha fragment containing the Talpha 3 and Talpha 4 nuclear protein-binding sites can partially compensate for deleterious mutations in Talpha 1,2 (27). The nature of our experiment does not allow us to conclude that TCF/LEF family members are strictly required for the activation of TCR-alpha gene rearrangement within the endogenous TCR-alpha /delta locus in vivo. We can reasonably conclude, however, that these factors are likely to contribute to the developmental activation of TCR-alpha gene rearrangement in vivo.

Ets transcription factors constitute a large family of DNA binding proteins, among which, Ets-1, Ets-2, GABPalpha , Elf-1, Fli-1, and Spi-B are all expressed in T cells (42, 43). Ets-1 in particular has been thought to be a regulator of Talpha 1,2 on the basis of its ability to transactivate gene expression in transient transfection experiments, and its ability to interact with ATF/CREB and CBF/PEBP2 to form a stable multiprotein complex on Talpha 1,2 in vitro (28, 33). Ets-1 is preferentially expressed in resting lymphocytes of adult mice, and its expression in fetal and postnatal thymocytes roughly parallels that of TCR-alpha (44, 45). Nevertheless, although gene disruption experiments have revealed diminished numbers of mature thymocytes and peripheral T cells with impaired activation and survival characteristics in Ets-1-/- animals, TCR expression appears to be normal (46, 47).

Our results, which clearly establish that an intact binding site for Ets family members is required for efficient activation of minilocus VD to J rearrangement by Talpha 1,2 in vivo, might imply that another Ets family member is the crucial regulator of Ealpha or compensates for the loss of Ets-1 in Ets-1-/- mice. The only other Ets-related transcription factor that is expressed in the T lineage and whose role has been examined genetically is Fli-1. Mice expressing an altered Fli-1 allele display reduced numbers of all thymocyte subsets; however, TCR-alpha rearrangement and expression was not specifically examined (48). Fli-1 has been shown to bind to and transactivate gene expression via Talpha 1,2 in transient transfection experiments. However, the magnitude of transactivation was substantially less than that observed using Ets-1, and unlike Ets-1, Fli-1 did not interact with ATF/ CREB proteins (28). Elf-1, on the other hand, has a distinct binding specificity and does not stably interact with Talpha 1,2 (49). Thus, the physiologically relevant factor that interacts with the Talpha 1,2 Ets site in vivo remains uncertain. Finally, as noted above for the TCF/LEF binding site mutation, our test of the Ets site mutation in the context of the Talpha 1,2 rather than the 1.4-kb Ealpha might, due to redundancy of cis-acting elements, detect an effect that would not be readily detected in the Ets-1 knockout or in mutated versions of the 1.4-kb Ealpha . While we cannot conclude that the binding of Ets family members is absolutely required for the activation of TCR-alpha gene rearrangement within the endogenous TCR-alpha /delta locus, our data does implicate these factors as potentially important contributors to the developmental activation of TCR-alpha gene rearrangement in vivo.

Although our data demonstrates quite clearly that the accessibility required for the activation of VDJ recombination can be established by the binding of TCF/LEF family, Ets family, and presumbably other transcription factors to the core of Ealpha , our data also indicates that the binding of these factors cannot account for the precise developmental onset of accessibility that is provided by the intact Ealpha . Rather, we detect both a partial loss of lineage specificity and a partial loss of temporal or developmental stage specificity in Talpha 1,2 transgenic lines. We propose that the loss of lineage specificity is a direct consequence of the loss of temporal or developmental stage specificity, as follows. Our observation that an intact Ealpha activates the VD to J step of minilocus rearrangement exclusively in developing alpha beta T cells implies that the transgenic Ealpha is developmentally activated either coordinately with, or subsequent to, activation of the endogenous Ealpha , which, by inducing endogenous Valpha to Jalpha rearrangement, commits developing thymocytes to become alpha beta cells. On the other hand, the relaxed lineage specificity of Talpha 1,2 implies that in at least a fraction of thymocytes, Talpha 1,2 is activated before the endogenous Ealpha . This would result in the activation of at least some minilocus VD to J rearrangement in as yet uncommitted thymic precursors, some of which would give rise to gamma delta cells. The uncommitted thymocyte population in which Talpha 1,2-dependent minilocus VD to J rearrangement occurs is a matter of speculation, but should be positive for RAG-1 and RAG-2. One candidate would be the CD44lowCD25+ subset of DN cells, which expresses high levels of RAG-1 and RAG-2, and is actively rearranging endogenous TCR-beta , -gamma , and -delta genes (7, 14). However, CD44lowCD25- DN and ISP thymocytes may also be candidates if their reduced levels of RAG-1 and RAG-2 maintain permissiveness for at least low level VDJ recombination (7, 13).

The potential for premature activation of Ealpha directed by factors that interact with Talpha 1,2 is apparently normally held in check by additional cis-elements of Ealpha . Although the identities of the cis-elements that mediate this effect are uncertain at present, we speculate that they might map to the previously defined protein binding sites Talpha 3 and Talpha 4 (26, 27). Although little is known about protein binding to these sites, it is interesting that they contain two E box motifs. Restriction of the activity of the immunoglobulin heavy-chain enhancer to B cells has been shown to be due, at least in part, to negative regulation involving two E boxes, µE5 and µE4, present within the enhancer (50). In addition, an E box has been implicated in the negative regulation of CD4 gene expression during T cell development by the CD4 transcriptional silencer (53). It is therefore tempting to speculate that the Talpha 3 and Talpha 4 E boxes may play similar roles in the developmental activation of Ealpha , and, as a consequence, the developmental activation of Valpha to Jalpha rearrangement. We are currently investigating this possibility.


Footnotes

Address correspondence to Michael S. Krangel, Department of Immunology, PO Box 3010, Duke University Medical Center, Durham, NC 27710. The current address of P. Lauzurica is Seccion de Immunologia, Hospital de la Princesa, 28006 Madrid, Spain.

Received for publication 18 September 1996

   This work was supported by National Institutes of Health grant GM41052. M.S. Krangel is the recipient of American Cancer Society Faculty Research Award FRA-414. J.L. Roberts was supported in part by Public Health Service Training grant CA09058.
   1Abbreviations used in this paper: DN, double negative; DP, double positive; Ealpha , alpha  enhancer; Edelta , delta  enhancer; HMG, high mobility group; ISP, immature single positive.

We thank Drs. C. Hernandez-Munain and Y. Zhuang for their critical comments on the manuscript, and Cheryl Bock and Wendy Callahan of the Duke University Comprehensive