|
||
Enhancer
By
From the Department of Immunology, Duke University Medical Center, Durham, North Carolina 27710
The role of T cell receptor
enhancer (E
) cis-acting elements in the developmental regulation
of VDJ recombination at the TCR
/
locus was examined in transgenic mice containing variants of a minilocus VDJ recombination substrate. We demonstrate that the 116-bp T
1,2
core enhancer fragment of the 1.4-kb E
is sufficient to activate the enhancer-dependent step
of minilocus rearrangement, and that within T
1,2, intact binding sites for TCF/LEF and Ets
family transcription factors are essential. Although minilocus rearrangement under the control
of the 1.4-kb E
initiates at fetal day 16.5 and is strictly limited to 
T cells, we find that rearrangement under the control of T
1,2 initiates slightly earlier during ontogeny and occurs in
both 
and 
T cells. We conclude that the core fragment of E
can establish accessibility to
the recombinase in developing thymocytes in vivo in a fashion that is dependent on the binding of TCF/LEF and Ets family transcription factors, but that these and other factors that bind
to the E
core cannot account for the precise developmental onset of accessibility that is provided by the intact E
. Rather, our data suggests a critical role for factors that bind E
outside
of the core T
1,2 region in establishing the precise developmental onset of TCR
rearrangement in vivo.
Ordered recombination of TCR variable (V), diversity
(D), and joining ( J ) gene segments is a process that is
crucial for the generation of the diverse antigen recognition
repertoires that characterize mature The relationship between TCR gene rearrangement events
and thymocyte commitment to the Numerous studies have demonstrated that transcriptional
promoters and enhancers play an important role in the developmental regulation of VDJ recombination at TCR and
Ig loci, probably by modulating accessibility of chromosomal recombination substrates to the recombinase machinery (for recent reviews, see references 22, 23). We
have examined the role of transcriptional enhancers in the
temporal and lineage-specific control of VDJ recombination at the TCR- An important goal of ours has been to identify the cisacting elements of E In the present study, we examine VDJ recombination of
the TCR Transgenic Mice.
The Ets binding site mutation (T
and 
T cells (1).
The most immature thymic population has a CD4low
CD8
CD3
CD25
HSA+ phenotype and has all TCR
genes in unrearranged configuration (4). These cells subsequently lose expression of CD4 to become CD4
CD8
double negative (DN)1 cells, which can be further subdivided into four distinct populations on the basis of CD44
and CD25 expression. DN thymocytes mature from CD44hi
CD25
to CD44hiCD25+ to CD44lowCD25+ to CD44low
CD25
(5, 6). The CD44lowCD25+ DN subset expresses
high levels of RAG-1 and RAG-2 and undergoes extensive
VDJ recombination at the TCR-
, -
, and -
loci (7, 8).
In-frame TCR-
rearrangement directs the synthesis of a TCR-
protein which, in conjunction with pT
, forms a
pre-TCR (9, 10) that functions to inhibit RAG-1 and
RAG-2 expression, to drive thymocyte proliferation, and to
drive thymocyte maturation through the CD44lowCD25
DN
and immature single positive (ISP) stages to the CD4+CD8+
double positive (DP) stage (7, 8, 11). TCR-
rearrangement is activated as thymocytes transit into the DP
stage (5, 7, 14).

or 
lineage has
been an area of intense interest. As TCR-
and TCR-
rearrangements are found in both 
and 
T cells, the
initiation of rearrangement events at these loci is not associated with lineage commitment. TCR-
gene segments lie
within V
and J
gene segments in the complex TCR-
/
locus and are therefore deleted by V
to J
rearrangement
(15). Recent reports have identified rearranged TCR-
genes in ISP precursors of 
T cells before the onset of
TCR-
rearrangement (14) and on V
-J
excision products
in 
thymocytes and peripheral T cells (18), arguing
that TCR-
gene rearrangement is initiated in a common precursor of 
and 
T cells as well. Because excised
TCR-
gene VDJ recombination products are relatively
depleted of in-frame rearrangements (18, 19), it appears likely
that functional TCR-
and TCR-
rearrangement can
commit thymocytes towards the 
pathway and away from
the 
pathway. However, because at least some 
cells
show evidence of selection on the basis of functional TCR-
gene rearrangement (11), and late stage CD44lowCD25
DN
thymocytes have been shown to include precursors of both

and 
T cells (21), at least some thymocytes may remain uncommitted until very late in the DN population. The
activation of TCR-
rearrangement as thymocytes transit
into the DP stage, with concomitant deletion of TCR-
,
must irrevocably assign all remaining uncommitted thymocytes
to the 
pathway. TCR-
is therefore the only TCR gene
whose rearrangement is activated in a lineage-specific fashion. The mechanisms that establish the developmental onset of
TCR-
rearrangement are therefore of particular interest.
/
locus by evaluating VDJ recombination in transgenic mice carrying variants of a human TCR-
gene minilocus rearrangement substrate that included either
the 1.4-kb TCR-
enhancer (E
) or the 1.4-kb TCR-
enhancer (E
) (24, 25). We found that the developmental
regulation of minilocus rearrangement under the control of
E
or E
paralleled that found at the endogenous TCR-
/
locus. Specifically, in E
-bearing transgenic lines, the enhancer-dependent VD to J step of minilocus rearrangement began on fetal day 14.5 and was equivalent in 
and 
T
cells, much like endogenous V
D
J
rearrangement. In E
bearing transgenic lines, VD to J rearrangement was delayed until fetal day 16.5 and was limited to 
cells, much
like endogenous V
J
rearrangement (25). These results
imply that E
and E
play important roles in the developmental regulation of V
D
J
and V
J
rearrangement, respectively, at the endogenous TCR-
/
locus.
that are critical in establishing the
precise developmental regulation of V
J
rearrangement at the TCR-
/
locus. The core or minimal enhancer fragment of E
has been defined as a 116-bp fragment (T
1,2)
that contains binding sites for several transcription factors,
including ATF/CREB, TCF-1/LEF-1, CBF/PEBP2, and
Ets proteins (26). This definition as a core or minimal
enhancer is based on the ability of T
1,2 to potently activate plasmid reporter gene expression in transient transfection experiments and the critical role played by each of the
defined factor binding sites for significant enhancer activity.
Further supporting the role of this enhancer fragment as a
discrete functional unit is its ability to support the cooperative assembly of a stable nucleoprotein complex in vitro in
the presence of the various transcription factors noted
above (28). These transcription factors and their cognate
binding sites in T
1,2 are therefore attractive candidates for
contributing to the developmental regulation of VDJ recombination by E
in vivo. Two of these binding sites
were selected for analysis in the present study. The first binds the related TCF-1 and LEF-1 members of the high
mobility group (HMG)
1 box family of DNA binding
proteins (29). These proteins bind to the minor groove
of DNA and induce a sharp bend in the DNA helix that, in
the case of LEF-1, has been shown to facilitate interactions
between Ets-1 and ATF/CREB proteins bound at nonadjacent sites in T
1,2 to generate a stable and active nucleoprotein complex (28, 32). Transient transfection experiments have shown that an intact TCF-1/LEF-1 binding
site is essential for T
1,2 enhancer activity, and that LEF-1
and TCF-1 can both transactivate reporter gene expression
by binding to T
1,2 (28, 29, 31). The second cis-acting element studied is the binding site for members of the Ets
family of transcription factors. Transient transfection experiments have shown that an intact Ets binding site is also required for T
1,2 enhancer activity, and that the Ets-1 protein can bind to T
1,2 and transactivate a T
1,2-driven reporter gene as well (28, 33).
gene minilocus under the control of wild-type
T
1,2 sequences and compare it with VDJ recombination
mediated by T
1,2 fragments carrying mutations in either
the TCF/LEF- or Ets binding sites. Our results indicate the
T
1,2 core enhancer can activate VDJ recombination in a
fashion that is dependent on TCF/LEF and Ets family transcription factors, but that additional E
sequences that lie
outside of the enhancer core are required for precise developmental control.
1,2mEts)
was generated by PCR using the 700-bp BstXI fragment of the
human E
cloned into the BamHI site of pUC13 (E
0.7) as a template (26) (provided by J. Leiden, University of Chicago, Chicago,
IL). PCR was performed using the mutagenic oligonucleotide Ets
( TATTTTAAACTCTTCTTTCCAGAACTTGTGGCTTCT ) and the
40 primer. The PCR product was digested with DraI
and EcoRI to generate a 135-bp fragment that was ligated into
SmaI and EcoRI cut pBluescript KS+. Dideoxynucleotide sequence analysis of the resultant plasmid confirmed that the insert
carried a 3-bp change in the T
1,2 Ets binding site. The 125-bp
T
1,2mEts was excised from this plasmid by digestion with
BamHI (plus PvuI to further cleave the plasmid and prevent subsequent religation), and the ends were blunted by treatment with
the Klenow fragment of Escherichia coli DNA polymerase I. The
T
1,2mEts fragment was then ligated into XbaI-digested, blunted,
and phosphatase-treated pBluescript carrying the previously described enhancerless minilocus (24).
1,2 with a 2-bp mutation in the TCF/LEF binding site
(T
1,2mTCF) was generated by PCR overlap extension (34) using
E
0.7 template DNA, mutagenic oligonucleotides TCF-1A (GGGAGAGCTTCTATGGGTGCCCTAC) and TCF-1B (GTAGGGCACCCATAGAAGCTCTCCC), along with the
40 and reverse
primers. The final PCR product was digested with DraI and EcoRI,
cloned into SmaI and EcoRI cut pBluescript KS+, and sequenced.
The 125-bp T
1,2mTCF fragment was then excised from the
plasmid with BamHI, blunt ended with Klenow, and ligated into XbaI-digested, blunted, and phosphatase-treated pBluescript carrying the enhancerless minilocus.
1,2 fragment of E
had been previously excised from
the E
0.7 plasmid using BamHI and DraI digestion, blunt ended
with Klenow, and subcloned into EcoRV cut pBluescript KS+. To generate a minilocus containing wild-type T
1,2, the insert was excised from this plasmid by digestion with HindIII and
SmaI, blunt ended with Klenow, and cloned into XbaI-digested,
blunted, and phosphatase-treated pBluescript carrying the enhancerless minilocus.
After confirmation of minilocus construct structures by dideoxynucleotide sequence analysis, minilocus DNA was purified
as previously described (24) and microinjected into fertilized (C57BL/6 × SJL/J)F2 eggs by the Duke University Comprehensive Cancer Center Shared Transgenic Mouse Facility. Progeny
tail DNA was initially characterized on Southern blots probed
with radiolabeled C
and V
1 fragments. Transgene germline
copy number was determined by analysis of T
1,2, T
1,2mEts,
and T
1,2mTCF tail DNAs, along with tail DNAs of previously
identified single copy integrants, on slot blots (Schleicher & Schuell,
Keene, NH). Blots were probed with a radiolabeled C
fragment
and the resultant hybridization signals quantified using a Betascope
(Betagen, Waltham, MA). Transgenes were maintained on a mixed
C57BL/6 × SJL/J background.
PCR.
With the exception of experiments using sorted 
and 
cells depicted in Fig. 6, genomic DNA PCR templates
were prepared from thymi of 4-wk-old animals by standard techniques (35). For single copy transgenic lines, 12 ng of genomic
DNA was used as a template for PCR reactions. For multicopy
integrants, the quantity of genomic DNA used in PCR was reduced to account for copy number and to insure that all PCR
signals were in the linear range. PCR templates from sorted 
and 
thymocytes (as well as unsorted thymocytes from the same
animals) were prepared by incubation of <1 × 106 pelleted cells
in 200 µl lysis buffer (10 mM Tris, pH 8.4, 2.5 mM MgCl2, 50 mM KCl, 200 µg/ml gelatin, 0.45% NP40, 0.45% Tween-20, and 60 µg/ml proteinase K) for 1 h at 56°C and then 15 min at 95°C (36). Sample aliquots containing 5 × 103 cell equivalents
were immediately used as templates in PCR reactions. All PCR
reactions were performed identically using previously described
reaction conditions and primers (24).
1,2 minilocus rearrangement in 
and 
thymocytes.
Genomic DNA templates from sorted 
and 
thymocytes and total unfractionated thymocytes (Tot.) of T
1,2 line T2, T5, and T7 mice (4 wk
old), and a no DNA control (
) were amplified by PCR and probed as in Fig. 2.
1,2 and T
1,2mTCF minilocus rearrangement. Genomic DNA templates from unfractionated thymocytes of
T
1,2 mice from lines T2, T3, T5, and T7, and of T
1,2mTCF mice
from lines JI, JJ, JK, JL, and JM (all 4 wk old) were amplifed by PCR using the indicated primers. Southern blots were probed with radiolabeled C
, V
1, or V
2 DNA fragments. The positions of 1.2-kb VD and 0.3-kb
VDJ rearrangement products are indicated.
Blot Hybridization of Genomic DNA and PCR Products.
Gel electrophoresis, blotting, and hybridization with 32P-labeled probes
were performed as previously described (24). Hybridization signals were quantified using a Betascope and reported values for
VD and VDJ rearrangement signals were normalized to the C
signal for each template.
Antibodies.
Biotinylated H57-597 anti-TCR-
, phycoerythrin-conjugated GL3 anti-TCR-
, FITC-streptavidin, and unlabeled 2.4G2 anti-Fc
RII/III mAbs for flow cytometry were obtained from PharMingen (San Diego, CA). GK1.5 anti-CD4 (37)
and 41-3.48 anti-Lyt-2.2 (38) mAbs were used for cell depletions
as culture supernatants.
Flow Cytometric Analysis and Cell Sorting.
Enriched CD4
CD8
cells were prepared from single cell suspensions of thymocytes
from 4-wk-old animals by treatment with saturating amounts of
GK1.5 and 41-3.48 mAbs and rabbit complement (Cedarlane Laboratories, Ltd., Hornby, ON, Canada) for 60 min at 37°C.
Viable cells were collected after centrifugation over Lympholyte-M
(Cedarlane Labs. Ltd.). The enriched CD4
CD8
cells and unfractionated thymocytes from the same animal were incubated with
saturating concentrations of unlabeled 2.4G2, biotinylated H57597, and phycoerythrin-GL3 for 40 min at 4°C in PBS with 0.1% BSA and 0.1% NaN3, washed twice, and then stained with
FITC-Streptavidin for 20 min at 4°C. Cells were subsequently
washed and sorted using a FACStar Plus® (Becton Dickinson,
Mountain View, CA). H57-597+ 
cells were sorted using
stained unfractionated thymocytes as a starting population while
GL3+ 
cells were sorted using identically stained, enriched
CD4
CD8
cells as a starting population. Immediate reanalysis of
sorted populations by two-color flow cytometry revealed contamination with <1% of cells expressing the inappropriate cell
surface TCR in all cases.
Fetal Thymus Samples. Fetal mice were obtained from timed matings of homozygous transgenic males and 6-8-wk-old (C57BL/6 × SJL/J)F1 females (Jackson Laboratory, Bar Harbor, ME). The day of detecting a vaginal plug was designated as day 0.5 of embryonic development. Genomic DNA prepared by standard techniques from pooled fetal thymi of individual litters was analyzed for minilocus rearrangement by PCR.
Fragment T
1,2 Is Sufficient to Activate Minilocus Rearrangement In Vivo.
The rearrangement
substrate used in the present study has been previously described as a 22.5-kb human TCR-
gene minilocus consisting of germline V
1, V
2, D
3, J
1, J
3, and C
gene segments (24). Frameshift mutations within the V
1 and V
2
coding segments prevent the rearranged transgene from encoding a functional TCR polypeptide that could alter normal T cell development in transgenic mice. The initial step
of transgene rearrangement, V to D, is enhancer independent (24). The second step of transgene rearrangement, VD
to J, is dependent on the presence of a functional enhancer in the J
3-C
intron. Thus, we infer that the enhancer is required to promote J segment accessibility to the recombinase (24). The 1.4-kb E
has been shown to efficiently activate VD to J rearrangement in this system (25). To
determine whether T
1,2, the 116-bp core fragment of
E
, was also sufficient to activate minilocus VDJ recombination in vivo, we constructed a new TCR-
gene minilocus containing this fragment in place of E
(Fig. 1 A). Four
independent transgenic lines denoted T2, T3, T5, and T7
were established and determined by slot blot analysis to
carry 28, 1, 3, and 4 transgene copies, respectively.
gene minilocus. (A) Diagram of the three
T
1,2-containing minilocus constructs. Solid boxes, exons, open boxes, protein binding sites. Wild-type and mutant T
2 sequences are shown. (B)
PCR products generated from V
1 rearrangements are depicted along
with the V
1 and J
1 primers (arrows) used. Similar products are generated
using V
2 and J
1 primers. Specific PCR products are not generated from
unrearranged templates because of the large distances between primers.
The primers do not amplify products from the endogenous murine TCR-
locus.
VDJ recombination in the four T
1,2 transgenic lines
was assessed by quantitative PCR of thymic genomic DNA
templates that were amplified using primers specific for
minilocus V
1, V
2, and J
1 gene segments (24). PCR using
primer combinations V
1-J
1 or V
2-J
1 yields a 0.3-kb
product resulting from transgene VDJ rearrangement and a
1.2-kb fragment resulting from VD rearrangement (Fig. 1 B), both of which can be detected on Southern blots probed
with radiolabeled V
1- or V
2-specific DNA fragments.
Amplification of a 0.3-kb rearrangement-independent product with a pair of C
primers serves as an internal control
for PCR efficiency and allows quantitative comparison of
rearrangement patterns between different templates. As
seen in Fig. 2 and Table 1, low levels of V
1-D
3 and high
levels of V
1-D
3-J
1 rearrangement were observed in
three of four T
1,2 lines (T2, T5, and T7). Levels of V
1D
3-J
1 rearrangement in thymocytes from lines T2 and
T5 were 60 and 38%, respectively, of that found in thymocytes from E
line J, which includes the intact 1.4-kb E
(Fig. 3, Table 2). However, VD and VDJ rearranged products were barely detectable in T
1,2 line T3 (Fig. 2, Table 1).
Similar variability in rearrangement phenotype among different lines of animals bearing an identical construct has been
noted in our previous studies (24, 39) and is likely due to
inherent differences in transgene integration sites. We suggest that the minilocus is integrated into a relatively inactive
region of chromatin in line T3; in support of this notion,
preliminary in vivo footprinting studies have demonstrated
markedly diminished protection of protein binding sites
within T
1,2 in thymus DNA of T3 mice as compared with thymus DNA of T2, T5, or T7 mice (HernandezMunain, C., personal communication). Taken as a whole,
our results demonstrate that the 116-bp T
1,2 fragment of
E
is, in most contexts, sufficient to mediate activation of
the enhancer-dependent VD to J step of minilocus rearrangement. The apparently less efficient conversion of V
2D
3 to V
2-D
3-J
1 in these lines is probably related to our
previous observation that V
2 rearrangement is only ~10%
as efficient as V
1 rearrangement in this system (24).
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
, T
1,2, and T
1,2mEts minilocus rearrangement. Genomic DNA templates from unfractionated thymocytes of
an E
mouse from line J, of T
1,2 mice from lines T2 and T5, and of
T
1,2mEts mice from lines JN, JR, and JO (all 4 wk old) were amplified
by PCR and probed as in Fig. 2.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
T
1,2 and E
minilocus rearrangement was also analyzed directly by genomic Southern blot (Fig. 4) as an independent means of corroborating results obtained by quantitative PCR. Analysis of V
1 rearrangements in PstI plus
EcoRI-digested thymus DNA from E
line L revealed low
levels of 1.0-kb germline V
1 and 0.9-kb V
1-D
3 rearranged fragments, and higher levels of a 1.7-kb species resulting from V
1-D
3-J
1 rearrangement (Fig. 4). Similar
results were obtained with E
line J (data not shown).
Analysis of similarly digested thymocyte DNA from T
1,2
line T2 also revealed levels of the fully rearranged V
1D
3-J
1 fragment that were more prevalent than the 0.9-kb
partially rearranged (V
1-D
3) species (Fig. 4). Hence,
these results are consistent with those obtained by PCR
and provide confirmation that T
1,2 alone can efficiently activate minilocus VDJ recombination.
line L, T
1,2 line T2, T
1,2mTCF line JI, and T
1,2mEts line
JO mice (all 4 wk old) were analyzed by Southern blot using a radiolabeled 1.0-kb V
1 genomic PstI fragment. Positions of the expected 1.0-kb
germline, 0.9-kb V
1-D
3, and 3.2-kb V
1-D
3-J
1 rearranged fragments
are indicated.
The conspicuous variations in total V
1 hybridization
signal intensities seen in this experiment (Fig. 4) result in part from differences in germline transgene copy number
between the various transgenic lines (T2 = 28, L = 13). A
diminution of total V
1 signal intensity in thymus DNA
relative to tail DNA isolated from the same animal is also
apparent, particularly in line T2 (Fig. 4). Slot blot quantification revealed C
copy number to be 13 in line L tail and
8 in L thymus, and although 28 in T2 tail, only 4 in T2
thymus (data not shown). Such copy number loss has been
noted in some other multicopy lines as well, and is likely
due to thymocyte rearrangement events between V, D, and
J gene segments within different, presumably concatameric, copies of the minilocus, with resultant loss of intervening
sequences. These differences in thymus transgene copy number are not apparent in PCR experiments where thymus
template amounts were adjusted for C
copy number.
1,2.
To determine whether the activation of minilocus VDJ recombination by T
1,2 in vivo is dependent on TCF/LEF
family transcription factors, a variant of the T
1,2 minilocus containing a 2-bp mutation in the TCF-1/LEF-1 binding site (T
1,2 mTCF) was constructed (Fig. 1 A). Five
independent lines of T
1,2mTCF transgenic mice were generated. Slot blot analysis revealed that T
1,2mTCF lines JL and JM each carry one copy of the minilocus, whereas lines
JI, JJ, and JK carry 5, 12, and 9 copies, respectively (data
not shown). Analysis of T
1,2mTCF minilocus VDJ recombination was performed by quantitative PCR, as described above. Notably, as assessed using both V
1-J
1 and
V
2-J
1 primer combinations, all five T
1,2mTCF lines
displayed dramatically reduced levels of VDJ rearranged
products as compared with wild-type T
1,2 lines T2, T5,
and T7 (Fig. 2). Quantification revealed levels of V
1-D
3J
1 rearrangement in T
1,2mTCF lines JI, JJ, and JK that
were only 3, 7, and 5%, respectively, of that observed in
wild-type T
1,2 line T2 (Table 1). In lines JL and JM,
V
1-D
3-J
1 rearrangement was undetectable. Because V
to D rearrangement was readily detectable in most transgenic lines, these results argue that mutation of the TCF/
LEF site significantly and specifically impairs the VD to J
step of minilocus VDJ recombination. Verification of these
results was obtained by genomic Southern blot analysis
which revealed an abundance of germline V
1 and V
1D
3 rearranged fragments, but no detectable V
1-D
3-J
1
rearrangement in PstI plus EcoRI digested thymus DNA
from T
1,2mTCF line JI (Fig. 4).
The relatively low level of V to D rearrangement in
T
1,2mTCF lines JL and JM may, in part, be a reflection
of unique properties of the transgene integration sites.
However, it is interesting that all three transgenic lines examined in this study displaying very low levels of total rearrangement (T
1,2 line T3, and T
1,2mTCF lines JL and
JM) are all single copy. This suggests an effect of copy
number as well. Nevertheless, multicopy integrants are not
required for efficient transgene VDJ recombination, as evidenced by the previously characterized E
-containing lines
A, B, and C (24), and the T
1,2mEts line JN (see below).
It may be that while a single copy transgene experiences
the full negative impact of integration into a relatively inactive region of chromatin, internal copies of a concatameric
multicopy integrant might be relatively protected from
such effects.
1,2.
To determine
whether the activation of minilocus VDJ recombination by
T
1,2 in vivo is dependent on Ets family transcription factors, a second variant of the T
1,2 minilocus containing a 3-bp mutation in the T
2 Ets binding site (T
1,2mEts)
was constructed. The three independent lines of transgenic
mice generated, JN, JO, and JR, were found to carry 1, 13, and 21 copies of the minilocus, respectively, as assessed by
slot blot analysis. VDJ rearrangement in thymocytes from
T
1,2mEts animals was compared with that of wild-type
T
1,2 and E
mice by quantitative PCR. This analysis revealed that the VD to J step of transgene rearrangement
was dramatically curtailed in all three lines of T
1,2mEts
transgenic animals (Fig. 3). Specifically, the levels of V
1-
D
3-J
1 rearrangement in T
1,2mEts lines JN, JR, and JO
were only 5, 7, and 4% of that of wild-type T
1,2 line T2
(Table 2); V
2-D
3-J
1 rearrangement was only barely detectable (Fig. 3). Nevertheless, VD rearrangement was high
in all three lines (Fig. 3). These results were also corroborated by genomic Southern blot of digested thymus DNA
from T
1,2mEts line JO, which failed to reveal a discernible V
1-D
3-J
1 fragment despite readily detectable V
1D
3 rearrangement (Fig. 4). From these data we conclude
that the presence of an intact Ets binding site within T
1,2
is a prerequisite for efficient activation of the VD to J step
of minilocus rearrangement in vivo.
1,2 Is Distinct from that of E
.
The 1.4-kb E
has been previously shown to confer physiologically appropriate developmental control to the enhancer-dependent VD
to J step of minilocus rearrangement. Because the 116-bp
T
1,2 core enhancer fragment proved sufficient to activate
minilocus rearrangement, we asked whether the core enhancer fragment is sufficient to impart precise developmental control as well. Accordingly, we examined the timing of
minilocus VDJ rearrangement during ontogeny in T
1,2
transgenic animals. PCR analysis of fetal thymus genomic DNA templates from line T2 timed pregnancies revealed
that the VD to J step of minilocus rearrangement began on
fetal day 15.5 (Fig. 5), one day earlier than that previously
noted in E
line J (25). Identical results were obtained from
analysis of T
1,2 line T5 (data not shown). Thus, T
1,2
appeared to be activated slightly earlier during fetal thymic
ontogeny than the intact E
.
1,2 minilocus rearrangement during fetal
ontogeny. Genomic DNA samples from T
1,2 line T2 thymi isolated on
days 14.5-17.5 of gestation, as well as from a postnatal (PN) T2 mouse
(4 wk old), were amplified by PCR and probed as in Fig. 2.
We then compared minilocus VDJ recombination in
sorted 
and 
T cell populations from adult T
1,2 animals. As expected, PCR analyses revealed abundant VD
and VDJ rearrangement in lines T2, T5, and T7 
thymocytes (Fig. 6). Strikingly, however, 
thymocytes from
these animals also exhibited substantial VDJ rearrangement (Fig. 6). Quantification of these data revealed that the level of V
1-D
3-J
1 rearrangement in 
cells relative to 
cells was 8% in line T2, 65% in line T5, and 19% in line T7
(Table 3). These results cannot be explained by contamination of cell populations, since flow cytometric reanalysis
demonstrated that <1% of the cells in the sorted populations bore the inappropriate TCR. The results from all
three lines contrast dramatically with previous observations
in E
mice; the level of V
1-D
3-J
1 rearrangement in 
cells
was negligible (2.5, 0.0, and 1.3% of the signal in 
thymocytes in E
lines J, L, and M, respectively, levels that
are probably within the limits of purity of the sorted 
populations [25]). From these results, we conclude that truncation of E
results in partial dysregulation of VDJ recombination during development. Specifically, the slightly premature activation of VDJ recombination with relaxed lineage
control that is directed by T
1,2 suggests that E
elements
that lie outside of T
1,2 are critical for the tightly regulated
and physiologically appropriate activation of TCR-
gene
rearrangement in vivo.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
In this study, we examined the roles of cis-acting elements of E
in the developmental regulation of VDJ recombination at the TCR-
/
locus. We found that the
116-bp T
1,2 core enhancer fragment of the 1.4-kb E
is
sufficient to activate the enhancer-dependent VD to J step
of transgenic minilocus rearrangement, and that intact
TCF/LEF and Ets binding sites within T
1,2 are required.
Investigation of the temporal and lineage-specific control of VDJ recombination afforded by T
1,2 revealed that
thymocyte VD to J rearrangement begins on fetal day 15.5 and occurs in both 
and 
cells. This contrasts with
previous results obtained in transgenic lines carrying the
1.4-kb E
, in which VD to J rearrangement was found to
begin on fetal day 16.5 and to be limited to 
cells (25).
Taken together, these data indicate that the core fragment
of E
can establish accessibility to the recombinase in developing thymocytes in vivo in a fashion that is dependent
on the binding of TCF/LEF and Ets family transcription factors, but that these and other factors that bind to the E
core cannot account for the precise developmental onset of
accessibility that is provided by the intact E
. Rather, our
data suggests a critical role for factors that bind E
outside
of the core T
1,2 region in establishing the precise developmental onset of TCR-
rearrangement in vivo.
Previous studies identified the 116-bp T
1,2 as the core
fragment of E
on the basis of its ability to potently activate plasmid reporter gene expression in transient transfection
experiments, and its ability, as naked DNA, to support the
assembly of a stable multiprotein complex consisting of
ATF/CREB, LEF-1, Ets-1, and CBF/PEBP2 (26). Our
experiments are the first to test the core fragment of E
in a
chromosomally integrated context. Our data indicates that
this fragment is capable of modifying chromatin structure
in vivo over a distance of at least 2 kb, as measured by its
ability to modify the accessibility of the J
1 gene segment
to the VDJ recombinase. Furthermore, our data are the first
to provide evidence that TCF/LEF and Ets family transcription factors are important regulators of E
in a chromosomal environment, suggesting that the multiprotein
complex that was previously documented to assemble in
vitro (28) may have an important role in regulating chromatin structure in vivo.
TCF-1 and LEF-1 are members of the HMG box family
of transcription factors that bind at the same site within
T
1,2 (Fig. 1 A) (29). The roles of both of these factors
have been analyzed in vivo by targeted gene disruption.
Analysis of LEF-1
/
mice has revealed that, despite early
postnatal lethality due to impaired development of multiple
organs, TCR-
rearrangement and T cell development
proceed normally (40). TCF-1
/
animals, on the other
hand, are healthy and appear morphologically normal, but
exhibit reduced numbers of apparently normal peripheral T
cells and a significant impairment in thymocyte differentiation at the transition from the ISP to DP stages of development (41). TCR-
rearrangement appears to be unaffected
in these animals (41). However, since thymocyte TCR rearrangement and expression normally begins around the
ISP to DP transition that is inhibited by TCF-1 gene disruption, it is difficult to judge whether TCR-
rearrangement is inhibited, albeit incompletely, as a primary consequence of the mutation.
Our experiments, which tested the effects of a disrupted
TCF-1/LEF-1 binding site within T
1,2 in a phenotypically neutral recombination reporter construct, clearly implicate TCF-1, LEF-1, or related factors in the developmental activation of minilocus VD to J rearrangement, and
by implication, in the developmental activation of V
to J
rearrangement at the endogenous TCR-
/
locus. There
are several reasons why our results may appear to contrast
with those obtained by targeted gene disruption. First, our
results may be easier to interpret unambiguously because
there is no confounding effect on T cell development clouding the interpretation of perturbed transgene rearrangement. Second, our experimental approach, in which the
binding site is mutated, accounts for the possibility that
TCF-1 and LEF-1 might play important but redundant roles in regulating TCR-
gene rearrangement. Such redundancy might allow apparently normal TCR-
rearrangement and expression in gene targeted animals that
lack either TCF-1 or LEF-1, but not both. Third, our experimental approach would detect an effect even if a related HMG family member, rather than TCF-1 or LEF-1, were the critical regulator of TCR-
gene rearrangement
in vivo. Finally, our test of the TCF/LEF binding site mutation in the context of the T
1,2 core enhancer, rather
than the 1.4-kb E
, may represent a more sensitive measure
of the effect of protein binding to this site, as it eliminates
the contribution of potentially redundant cis-acting E
elements that lie outside of T
1,2. Such elements might mask
an effect in a TCF-1 or LEF-1 knockout, or in mutated
versions of an otherwise intact E
. Indeed, in transient
transfection experiments, the DraI-ApaI E
fragment containing the T
3 and T
4 nuclear protein-binding sites can
partially compensate for deleterious mutations in T
1,2
(27). The nature of our experiment does not allow us to
conclude that TCF/LEF family members are strictly required for the activation of TCR-
gene rearrangement
within the endogenous TCR-
/
locus in vivo. We can
reasonably conclude, however, that these factors are likely
to contribute to the developmental activation of TCR-
gene rearrangement in vivo.
Ets transcription factors constitute a large family of DNA
binding proteins, among which, Ets-1, Ets-2, GABP
, Elf-1,
Fli-1, and Spi-B are all expressed in T cells (42, 43). Ets-1
in particular has been thought to be a regulator of T
1,2
on the basis of its ability to transactivate gene expression in
transient transfection experiments, and its ability to interact
with ATF/CREB and CBF/PEBP2 to form a stable multiprotein complex on T
1,2 in vitro (28, 33). Ets-1 is preferentially expressed in resting lymphocytes of adult mice, and
its expression in fetal and postnatal thymocytes roughly parallels that of TCR-
(44, 45). Nevertheless, although gene
disruption experiments have revealed diminished numbers
of mature thymocytes and peripheral T cells with impaired activation and survival characteristics in Ets-1
/
animals,
TCR expression appears to be normal (46, 47).
Our results, which clearly establish that an intact binding
site for Ets family members is required for efficient activation of minilocus VD to J rearrangement by T
1,2 in vivo, might
imply that another Ets family member is the crucial regulator of E
or compensates for the loss of Ets-1 in Ets-1
/
mice. The only other Ets-related transcription factor that is expressed in the T lineage and whose role has been examined genetically is Fli-1. Mice expressing an altered Fli-1
allele display reduced numbers of all thymocyte subsets;
however, TCR-
rearrangement and expression was not
specifically examined (48). Fli-1 has been shown to bind to
and transactivate gene expression via T
1,2 in transient
transfection experiments. However, the magnitude of transactivation was substantially less than that observed using Ets-1, and unlike Ets-1, Fli-1 did not interact with ATF/
CREB proteins (28). Elf-1, on the other hand, has a distinct binding specificity and does not stably interact with
T
1,2 (49). Thus, the physiologically relevant factor that
interacts with the T
1,2 Ets site in vivo remains uncertain.
Finally, as noted above for the TCF/LEF binding site mutation, our test of the Ets site mutation in the context of the
T
1,2 rather than the 1.4-kb E
might, due to redundancy
of cis-acting elements, detect an effect that would not be
readily detected in the Ets-1 knockout or in mutated versions of the 1.4-kb E
. While we cannot conclude that the
binding of Ets family members is absolutely required for
the activation of TCR-
gene rearrangement within the
endogenous TCR-
/
locus, our data does implicate these
factors as potentially important contributors to the developmental activation of TCR-
gene rearrangement in
vivo.
Although our data demonstrates quite clearly that the accessibility required for the activation of VDJ recombination
can be established by the binding of TCF/LEF family, Ets
family, and presumbably other transcription factors to the
core of E
, our data also indicates that the binding of these
factors cannot account for the precise developmental onset
of accessibility that is provided by the intact E
. Rather, we
detect both a partial loss of lineage specificity and a partial
loss of temporal or developmental stage specificity in T
1,2
transgenic lines. We propose that the loss of lineage specificity is a direct consequence of the loss of temporal or developmental stage specificity, as follows. Our observation
that an intact E
activates the VD to J step of minilocus rearrangement exclusively in developing 
T cells implies
that the transgenic E
is developmentally activated either
coordinately with, or subsequent to, activation of the endogenous E
, which, by inducing endogenous V
to J
rearrangement, commits developing thymocytes to become 
cells. On the other hand, the relaxed lineage specificity
of T
1,2 implies that in at least a fraction of thymocytes,
T
1,2 is activated before the endogenous E
. This would
result in the activation of at least some minilocus VD to J
rearrangement in as yet uncommitted thymic precursors,
some of which would give rise to 
cells. The uncommitted thymocyte population in which T
1,2-dependent minilocus VD to J rearrangement occurs is a matter of speculation,
but should be positive for RAG-1 and RAG-2. One candidate would be the CD44lowCD25+ subset of DN cells,
which expresses high levels of RAG-1 and RAG-2, and is
actively rearranging endogenous TCR-
, -
, and -
genes
(7, 14). However, CD44lowCD25
DN and ISP thymocytes
may also be candidates if their reduced levels of RAG-1
and RAG-2 maintain permissiveness for at least low level
VDJ recombination (7, 13).
The potential for premature activation of E
directed by
factors that interact with T
1,2 is apparently normally held in check by additional cis-elements of E
. Although the identities of the cis-elements that mediate this effect are
uncertain at present, we speculate that they might map to
the previously defined protein binding sites T
3 and T
4
(26, 27). Although little is known about protein binding to
these sites, it is interesting that they contain two E box motifs. Restriction of the activity of the immunoglobulin
heavy-chain enhancer to B cells has been shown to be
due, at least in part, to negative regulation involving two
E boxes, µE5 and µE4, present within the enhancer (50). In addition, an E box has been implicated in the negative
regulation of CD4 gene expression during T cell development by the CD4 transcriptional silencer (53). It is therefore tempting to speculate that the T
3 and T
4 E boxes
may play similar roles in the developmental activation of
E
, and, as a consequence, the developmental activation of
V
to J
rearrangement. We are currently investigating this
possibility.
Address correspondence to Michael S. Krangel, Department of Immunology, PO Box 3010, Duke University Medical Center, Durham, NC 27710. The current address of P. Lauzurica is Seccion de Immunologia, Hospital de la Princesa, 28006 Madrid, Spain.
Received for publication 18 September 1996
This work was supported by National Institutes of Health grant GM41052. M.S. Krangel is the recipient of American Cancer Society Faculty Research Award FRA-414. J.L. Roberts was supported in part by Public Health Service Training grant CA09058.
,
enhancer; E
,
enhancer; HMG, high mobility group; ISP, immature single positive.
We thank Drs. C. Hernandez-Munain and Y. Zhuang for their critical comments on the manuscript, and Cheryl Bock and Wendy Callahan of the Duke University Comprehensive