|
||
By



§
From the * Department of Immunology,
Department of Biochemistry, § Department of Medicine
(Medical Genetics), and the
Howard Hughes Medical Institute, University of Washington, Seattle,
Washington 98195; and the ¶ Centre d'Immunologie, Institut National de la Santé et de la Recherche
Médicale, Centre National de la Recherche Scientifique, de Marseille-Luminy, 13288 Marseille
Cedex 9, France
An important checkpoint in early thymocyte development ensures that only thymocytes with
an in-frame T cell receptor for antigen
(TCR-
) gene rearrangement will continue to mature. Proper assembly of the TCR-
chain into the pre-TCR complex delivers signals through the src-family protein tyrosine kinase p56lck that stimulate thymocyte proliferation and differentiation to the CD4+CD8+ stage. However, the biochemical mechanisms governing p56lck activation remain poorly understood. In more mature thymocytes, p56lck is associated with the cytoplasmic domain of the TCR coreceptors CD4 and CD8, and cross-linking of CD4 leads to
p56lck activation. To study the effect of synchronously inducing p56lck activation in immature
CD4
CD8
thymocytes, we generated mice expressing a CD4 transgene in Rag2
/
thymocytes. Remarkably, without further experimental manipulation, the CD4 transgene drives
maturation of Rag2
/
thymocytes in vivo. We show that this process is dependent upon the
ability of the CD4 transgene to bind Lck and on the expression of MHC class II molecules.
Together these results indicate that binding of MHC class II molecules to CD4 can deliver a
biologically relevant, Lck-dependent activation signal to thymocytes in the absence of the
TCR-
or -
chain.
In mammals, circulating T lymphocytes derive from bone
marrow progenitors that mature within the thymus. This
maturation process involves both replicative expansion and
differentiation, and yields progeny cells expressing a diverse
repertoire of clonally-distributed TCRs specific for antigenic peptides bound to MHC molecules. Signals derived
from non-receptor protein tyrosine kinases direct the highlyregulated development of thymocyte progenitors (1), which can only take place in close approximation with thymic stromal elements (2).
Immature hematopoietic progenitors arriving in the thymus contain TCR genes in germline configuration, lack
both CD4 and CD8 on their cell surfaces, and express only
very low levels of the TCR-associated CD3 The signaling circuits that link the pre-TCR to appropriate cellular responses remain incompletely elucidated.
However, experiments in genetically manipulated mice
strongly implicate the src-family protein tyrosine kinase
p56lck in the pre-TCR signal transduction pathway (10). In
thymocytes from mice lacking expression of CD3 While the genetic evidence favoring a role for Lck in
signaling from the pre-TCR is persuasive, the biochemical
effectors upon which Lck acts, as well as the mechanisms of
Lck activation, remain unknown. In more mature thymocytes and T cells, p56lck interacts physically and functionally with the TCR coreceptors, CD4 and CD8, by virtue of a sequence motif centered around cysteines 20 and
23 that binds a complementary motif in the cytoplasmic tails of CD4 and CD8 (18). Contemporary models of TCR
signaling posit that CD4 and CD8 act to deliver Lck to the
antigen receptor complex at the time of ligand binding, permitting activation of Lck, which then acts to phosphorylate
specialized tyrosine-containing motifs (ITAMs) in the CD3 Dissection of the biochemical pathways linking Lck to
changes in thymocyte maturation requires a means of directly stimulating Lck activity in vivo. Here we report that
expression of a CD4 transgene in Rag2 Mice.
All Rag2
,
, and
polypeptides. Thereafter, in-frame gene rearrangement at
the TCR-
locus leads to expression of a functional TCR-
polypeptide, which is presented at the cell surface in association with the recently described pT
chain (3) and the
CD3
,
, and
molecules (4, 5). This complex, known as
the pre-T cell receptor (pre-TCR), delivers signals that
block further rearrangements at the TCR-
locus, while
stimulating both proliferation and the onset of rearrangements at the complementary TCR-
locus (6). In addition, the pre-TCR-derived signal leads to simultaneous expression of CD4 and CD8 on the surfaces of developing thymocytes. Subsequent gene rearrangement at the TCR-
locus permits assembly of the mature 
TCR, which can
thereafter deliver signals that trigger the differentiation of
functional T lymphocytes, cells which express either CD4
or CD8 in a mutually exclusive fashion (9).
(11),
pT
(12), or TCR-
(7), failure to assemble the pre-TCR
results in arrested thymocyte development at a very immature CD4
8
(double-negative or DN1) stage. An analogous phenotype obtains in thymocytes of transgenic mice
expressing high levels of a catalytically inactive Lck protein (13) and in mice bearing a targeted disruption of the lck
gene (14), although some thymocyte differentiation does
occur in the latter, likely reflecting the ability of other, related kinases to substitute in the absence of Lck (15, 16).
Importantly, expression of a mutant, activated Lck kinase is
sufficient, by itself, to drive both the proliferative expansion and the differentiation of thymocytes made incapable
of expressing the pre-TCR. For example, an activated-lck
transgene drives thymocyte development in Rag
/
thymocytes, which cannot rearrange their TCR gene loci and
therefore fail to make a TCR-
chain (17). Together these
experiments strongly support a model in which assembly of
the pre-TCR permits, either through binding of an external ligand or through some allosteric alteration, the activation of p56lck, which then directs thymocyte maturation to
the CD4+8+ (double-positive or DP) stage.
,
, and
chains and in the TCR
polypeptides, the latter
found principally as homodimers associated with the TCR
complex (19). This phosphorylation permits binding of the Zap-70 protein tyrosine kinase to the phosphorylated ITAMs,
where it too becomes a target for Lck-mediated phosphorylation (19, 20). Interestingly, antibody-mediated cross-linking of CD4 stimulates Lck kinase activity in murine thymocytes (21) and T cell clones (22), suggesting that binding
of CD4 to MHC class II polypeptides under physiologic
conditions may, by itself, stimulate Lck activity.
/
mice has this effect, directing thymocyte development in a manner that
mimics signaling from the pre-TCR. Remarkably, this
process is dependent upon the expression of MHC class II
molecules, and hence represents a ligand-stimulated signaling process mediated by CD4. While our experiments
leave no doubt as to the ability of CD4 to behave as a receptor in its own right, we also demonstrate that faithful
delivery of the CD4/Lck-derived signal requires the simultaneous presence of CD3 components of the pre-TCR
complex.
/
mice were housed in a specific pathogenfree (SPF) facility and analyzed at 3-6 wk of age. Transgenic lines
were derived by microinjection into DBA/2 × C57BL6/J zygotes as described (23). The 727 CD4 transgenic mouse line has
previously been described (24). A single line of mice transgenic
for tailless CD4 was generated using the previously described
construct (25). Transgene-bearing mice for each of these lines
were mated with Rag2
/
mice (26), and their progeny intercrossed to obtain transgene expression in homozygous Rag2
/
mice. CD4Tg+(CD4 transgenic) Rag2
/
mice were further
crossed with MHC class II
/
mice (27). CD4Tg+ mice were also
crossed with CD3
/
mice (11). PCR analysis was employed to
detect the presence of the transgenes using the following pairs of
forward and reverse primers:
) transgenes:
GTCAGGAGCTTGAATCCCACGATTCGGGGATCATCTAGAC 3
(specific for the junction of proximal lck promoter
sequences with polylinker sequence in the lck-CD4 transgene
[24])
5
CCACAACTCCACCTCCTCTTTCCT 3
(corresponding to nucleotides 518-541 of the murine CD4 cDNA [28])
Rag2:
5
CCAGCTGATAACCACCCACAATAA 3
5
GTATAGTCGAGGGAAAAGCATGGG 3
Neomycin cassette in gene targeting constructs:
5
CAGGATCTCCTGTCATCTCACCTT 3
5
TCAGAAGAACTCGTCAAGAAGGCG 3
I-Ab endogenous locus:
5
CATTTCGTGTACCAGTTCATGGGC 3
5
CTCGTAGTTGTGTCTGCACACCGTGTC 3
I-Ab gene targeting construct:
5
TACATCTACAACCGGGAGGAGTAC 3
Neomycin cassette forward primer
CD3
:
5
TCAGGAACCAGTGTAGAGTTGACG 3
5
GTCCACCTCCACACAGTACTCACA 3
Flow Cytometric Analysis.
Isolated thymocytes were prepared
by disaggregation through a wire mesh, and stained with saturating levels of mAb at 4°C in 1% FCS in PBS. Cells were counted
using a hemocytometer and ~106 thymocytes were stained with
combinations of the following murine-specific mAb: Anti-CD4
PE (CT-CD4) and anti-CD8
(CT-CD8
) from Caltag Laboratories (San Francisco, CA); anti-CD25PE (M-A251), anti-CD8
PE (53-6.7), biotinylated anti-I-Ab (AF6-120.1), biotinylated
anti-CD3
(145-2C11), and biotinylated anti-CD69 (H1.2F3)
from PharMingen (San Diego, CA). For detection of biotinylated
reagents, cells were further stained with tri-color conjugated streptavidin (Caltag Laboratories). After staining, cells were fixed in 2%
paraformaldehyde, pH 7.4. 20,000 live lymphocyte-gated events
were collected for each analysis in list mode files on a FACScan®
flow cytometer (Becton Dickinson) using Cell Quest software, and analyzed using Reproman software (Truefacts Software, Seattle, WA).
Antibody Treatment of Mice.
4-wk-old mice were injected intraperitoneally with 100 µg of anti-CD3
(145-2C11), or 20-500 µg
of anti-CD4 mAb (GK1.5) diluted in 300 µl of PBS. The mAb
were affinity-purified on protein A or G Sepharose, respectively.
Mice were typically analyzed 4 d after mAb treatment. CD69 induction was measured 20 h after intraperitoneal injection of 150 µg
of 145-2C11 or GK1.5 mAb.
/
Mice.
To determine whether we could effect CD4-mediated p56lck activation in pre-T cells in vivo, a CD4 minigene under the control of the lck proximal promoter (24)
was placed on a Rag2
/
background. By flow cytometry,
CD4Tg+ Rag2
/
thymocytes express ~10-fold higher
levels of CD4 on their surfaces as compared with those
found on more mature, wild-type CD4+ thymocytes (Fig. 1).
An effect of the CD4 transgene was readily apparent: thymuses from the CD4 transgenic animals were larger than
those of Rag2
/
littermate controls, and showed a fivefold
increase in cell number (~1 × 107 vs. ~2 × 106 thymocytes in Rag2
/
mice). Remarkably, the majority of
thymocytes in CD4Tg-bearing Rag2
/
mice acquired
surface expression of endogenously encoded CD8 (Fig. 1,
top). These cells also lost expression of CD25 (Fig. 1, middle), and were smaller in size (Fig. 1, bottom), both phenotypes associated with the DN to DP transition in normal
thymocytes (8). Together these results indicate that the
simple expression of CD4 (albeit at high levels) in the DN
compartment faithfully reproduces signals ordinarily associated with satisfactory assembly of the pre-TCR. This occurred without any measurable change in the surface representation of CD3 components (judged by flow cytometric
analysis of CD3
expression), and hence suggests that the
presence of transgene-derived CD4 was directly responsible for this phenomenon.
/
and
CD4 transgenic Rag2
/
mice. Two parameter fluorescence histograms
of lymphocyte gated events are shown after cell surface staining of thymocytes from age matched mice with anti-CD4-PE and anti-CD8-FITC
(top), or anti-CD8-PE and anti-CD25-FITC (middle). Forward light scatter profiles (FSC) are also shown (bottom) as an indication of relative cell
size. The percentage of cells in each population is indicated. Under identical staining conditions, wild-type CD4+ thymocytes lie at ~100 units
on the logarithmic scale.
CD4 Transgene-driven Maturation Requires the Lck-Interacting Region.
Because activated Lck (containing a phenylalanine-for-tyrosine substitution at position 505) can stimulate the DN to DP transition in Rag
/
thymocytes (17),
and because Lck binds directly to CD4 (18), we reasoned
that expression of transgene-derived CD4 in Rag2
/
thymocytes had permitted assembly of a signaling complex
leading to Lck activation in vivo. This hypothesis predicts
that the ability of CD4 to stimulate thymocyte development would depend upon its interaction with Lck. To test
this conjecture, we generated an additional line of transgenic animals expressing a mutant CD4 transgene (CD4
)
in which sequences encoding all but the eight most membrane-proximal cytoplasmic residues were truncated. Prior studies have demonstrated that this truncation yields a molecule that cannot interact with p56lck (25). Fig. 2 A shows
that although the CD4
transgene was expressed under
the lck proximal promoter at levels comparable to those achieved using the wild-type CD4 transgene, Rag2
/
thymocytes were not induced to mature by the presence of
this mutant protein. Indeed, even when the CD4
transgenic mice were intercrossed in the effort to obtain progeny with increased expression of truncated CD4, no improvement in thymocyte maturation was noted (Fig. 2 B).
We conclude that the CD4 cytoplasmic tail, almost certainly reflecting its ability to bind p56lck, is required to permit a CD4-derived signal to drive the DN to DP transition
in thymocytes.
/
and tailless CD4
Rag2
/
transgenic mice. (A) Representative
fluorescence staining profiles of CD4 and CD8 are shown for thymocytes from age matched CD4Tg+ Rag2
/
mice (CD4, left panel) or tailless CD4
(CD4
, middle panel) Rag2
/
mice (n = 6). A single parameter histogram better shows the relative levels of CD4 expression (right panel) for these mice
as compared to a transgene negative littermate control of CD4
(Neg. Cont.). (B) A similar immunofluorescense analysis is shown for thymocytes from a
CD4Tg+ Rag2
/
mouse (left panel), and two of seven CD4
Rag2
/
positive progeny from a CD4
× CD4
mating (middle two panels). Two parameter fluorescence profiles are shown for wild-type CD4Tg+ and the mice expressing the lowest (CD4
lo) and highest (CD4
hi) level of CD4
in the litter. The relative levels of CD4 expression are again shown by a single parameter histogram (right panel). The percentage of cells in each population is indicated. While some CD4
Rag2
/
mice (7/21 analyzed) contained a very small fraction of CD8+CD25
thymocytes (1-2%), this did not correlate
with the level of CD4
expression. The relative percentage of CD8+CD25
thymocytes in wild-type CD4 Rag 2
/
/CD4
Rag 2
/
mice was >50fold.
CD4 Transgene-driven Maturation Requires Expression of MHC Class II Molecules.
We next asked whether the presence of CD4 in immature thymocytes was by itself sufficient to stimulate maturation, or whether interaction with
an MHC class II ligand was required. The extracellular domain of CD4 binds directly to the MHC class II
2 domain
(29, 30), and it is well established that CD4 coreceptor
function requires MHC class II binding in mature T cells
(31). To determine whether CD4 transgene-driven thymocyte maturation in Rag2
/
mice is dependent upon
MHC class II molecules, CD4Tg+ Rag2
/
mice were
crossed with MHC class II
/
mice (generated through targeted disruption of the I-A
locus [27]). Rag2
/
, CD4Tg,
and MHC class II
/
mice share the H-2bhaplotype, and
therefore lack surface expression of MHC class II I-E proteins due to a pre-existing mutation in the E
gene promoter (32). As shown in Fig. 3 A, in the absence of MHC
class II expression (right panel), the CD4 transgene no
longer stimulates the acquisition of CD8 expression in
Rag2
/
thymocytes. Indeed, in CD4Tg mice made simultaneously null for Rag2 and heterozygous for the disrupted
I-A
allele, the representation of DP cells typically reached
only 40% of that observed in those bearing two wild-type
I-A
alleles (Fig. 3 A, middle panels and B). Hence the actual dose of MHC class II molecules available to bind CD4
appears to regulate propagation of a differentiative signal.
/
mice mated onto an MHC class II
/
background. (A) Fluorescence staining profiles of CD4 and CD8 (top panels) or the MHC class II molecule I-Ab (bottom panels)
of thymocytes from a CD4 transgene negative MHC class II wild-type control
(Rag2
/
MHC II+/+) and CD4 transgene positive littermates that are wild-type
(CD4Tg+ Rag2
/
MHC II+/+), heterozygous (CD4Tg+ Rag2
/
MHC II+/
) or
null (CD4Tg+ Rag2
/
MHC II
/
) for MHC class II expression. The percentage
of cells in each population is indicated. Unlike thymi from CD4Tg+ Rag2
/
mice that were first analyzed (Fig. 1), thymi from the crosses of CD4Tg+ Rag2
/
mice with MHC class II
/
mice did not exhibit an increase in cell number relative to CD4 transgene negative littermates. This was observed even in CD4Tg+
Rag2
/
MHC class II+/+ progeny of MHC class II heterozygote crosses. This is
likely due to nonspecific changes in genetic background. (B) Scatter graph of the
percentage of CD4+CD8+ thymocytes from the progeny of CD4Tg+ Rag2
/
× MHC class II
/
matings. Each circle shows a data point from an individual
mouse, with the mean represented by a bold plus sign (+). The number of mice
analyzed for each type is indicated across the top of the graph. CD4 transgene
negative littermate controls (LMC) included MHC class II null, heterozygous
and wild-type mice.
In accord with this observation, the amount of stainable
MHC class II protein on the surfaces of thymocytes was
greatly increased by the presence of transgene-derived CD4
(Fig. 3 A, bottom). Thymocytes transgenic for the CD4
construct also showed increased staining for I-Ab (data not
shown). Passive adsorption of shed class II molecules onto
normal thymocytes has been previously demonstrated using allogeneic bone marrow chimeras (33). The increased I-Ab
staining on CD4 transgenic thymocytes almost certainly reflects direct binding of shed class II molecules to this transgene-encoded class II receptor, supporting the notion that
CD4 delivers an Lck activation signal in Rag2
/
thymocytes in response to binding of the agonist ligand, I-Ab.
Murine thymocytes themselves do not synthesize significant amounts of MHC class II molecules (33, 34).
Previous studies demonstrate that administration of antiCD3 antibodies to Rag2
/
mice stimulates the DN to DP
transition, an effect which depends upon the presence of
Lck (35). Because administration of anti-CD4 antibodies to
T cell clones (22) as well as murine thymocytes (21) stimulates Lck activity, and because expression of MHC class II
molecules stimulates CD4-driven thymocyte maturation in
Rag2
/
mice, we wished to determine whether anti-CD4
mAb treatment would similarly drive maturation of CD4Tg+
Rag2
/
MHC class II
/
thymocytes. Fig. 4 A demonstrates that anti-CD3 treatment effectively stimulates thymocyte maturation in Rag2
/
MHC class II
/
mice, irrespective of the presence of the CD4 transgene. In contrast, administration of the anti-CD4 mAb GK1.5 did not stimulate maturation of CD4Tg-bearing thymocytes. However,
all CD4Tg+ Rag2
/
MHC class II
/
thymocytes clearly
are capable of receiving a GK1.5 stimulated signal: GK1.5
or anti-CD3 induce comparable surface expression of the
activation marker CD69 (36) within 24 h of mAb treatment (Fig. 4 B). CD69 expression is believed to increase after
receipt of normal pre-TCR signals (35). Moreover, antiCD3-stimulated CD69 induction is impaired in Lck
/
mice (35). Hence treatment with anti-CD4 mAb delivers a
signal to CD4Tg+ Rag2
/
MHC class II
/
thymocytes
that recapitulates one feature of the Lck-dependent preTCR signaling process. This signal may differ qualitatively or quantitatively from that which devolves after interaction
of CD4 with class II molecules (see below).
/
MHC
class II
/
littermates treated
with anti-CD3
or anti-CD4
mAb. (A) 4-wk-old mice were
treated intraperitoneally with 100 µg of the anti-CD3
mAb 2C11
(top panels), or 20 µg of the antiCD4 mAb GK1.5 (bottom panels).
After 4 d, thymocytes were
stained and analyzed by flow cytometry using anti-CD4-PE and
anti-CD8-FITC. Identical results were obtained for CD4Tg+
Rag2
/
MHC II
/
mice
treated with 100 µg or 500 µg
GK1.5. The percentage of cells in each population is indicated.
Total thymocyte numbers were as follows: anti-CD3
-treated
Rag2
/
MHC II
/
(1.2 × 107)
or CD4 Rag2
/
MHC II
/
mice (3.2 × 107). (B) Single parameter fluorescence histograms
show CD69 expression 20 h after treatment with 150 µg of
mAb 2C11 (gray line) or GK1.5 (thick black line) as compared to
untreated controls (thin black line).
CD4 Transgene-driven Maturation Requires Expression of CD3 Chains.
Maturation of DN thymocytes ordinarily
requires assembly of the pre-TCR complex (6), which is
composed of the CD3 chains, the pT
polypeptide, and the
TCR-
chain (5, 7, 10). Although the CD4/class II interaction in our transgenic animals mimics pre-TCR signaling
in Rag2
/
thymocytes (in the absence of a TCR-
chain),
it remained plausible that other pre-TCR components, notably the CD3 polypeptides, might be necessary to permit
delivery of an Lck-derived signal. To investigate the signaling requirements in this system, we introduced the CD4 transgene into a CD3
/
background. As in Rag2
/
mice,
thymocytes of CD3
/
mice do not mature beyond the
DN stage (11). These thymocytes also contain greatly reduced levels of the CD3
and CD3
transcripts, an effect
ascribed to the presence of the neomycin phosphotransferase cassette within the closely integrated CD3

gene
cluster (11). Despite high-level expression of the CD4
transgene in CD3
/
thymocytes, no appreciable induction of maturation was observed (Fig. 5). We conclude that
although CD4 expression can substitute for the TCR-
chain in promoting thymocyte development, this effect requires expression of CD3 polypeptides.

/
(left
panel) or CD4 transgene-bearing CD3
/
(right panel) littermates. The
percentage of cells in each population is indicated.
Experiments in genetically manipulated mice support a
generally accepted model for pre-TCR function in which
productive rearrangement of a TCR-
chain in immature
DN thymocytes leads to formation of a functional preTCR complex composed of the TCR-
chain, the nonpolymorphic pT
-chain, and CD3 signaling molecules.
Formation of the pre-TCR complex subsequently results
in the activation of p56lck, leading to both proliferation and
maturation to the DP stage of thymocyte development (6,
10, 37). As Lck is a pivotal component of the TCR signaling apparatus (19), it might be expected to function similarly in pre-TCR and mature TCR signaling.
Animals lacking either of the recombinase activating
genes (Rag1 and Rag2) have provided a convenient experimental platform for identifying signaling components that
regulate early thymocyte maturation (26, 38). For example,
the introduction of transgenes encoding a functional TCR-
chain, or an activated version of p56lck (7, 17), into Rag
/
mice stimulates maturation of DN thymocytes. In addition,
some functional pre-TCR components are expressed at the
cell surface on Rag
/
thymocytes, because treatment of
these cells with anti-CD3
can induce both thymocyte
proliferation and differentiation (35) in an Lck-dependent
manner. However, CD3
treatment almost certainly activates several signaling pathways, including some that may not involve p56lck. Interestingly, a chimeric transgene encoding an IL-2 receptor
chain (CD25) extracellular domain linked to intracellular sequences derived from CD3
or the
chain can also stimulate pre-T cell development
when cross-linked with anti-CD25 antibodies in vivo (39).
This experiment, analogous to those performed using cultured T cell lines, further reinforces the view that preTCR signal transduction involves similar biochemical
mechanisms to those that mediate TCR signaling in mature T cells.
By expressing CD4 in the DN thymocytes of Rag2
/
mice, we sought to develop a system wherein a defined,
extracellularly-imposed signal would stimulate thymocyte
maturation through activation of p56lck. The remarkable
changes provoked by CD4 expression
an increase in cell
number, activation of the CD8 gene, extinction of CD25 synthesis, and a decrease in cell size
mimic those changes
imposed after pre-TCR stimulation. Propagation of these
effects requires sequences in the CD4 cytoplasmic domain
known to couple CD4 to p56lck, as well as the expression
of MHC class II molecules and CD3 proteins. As murine
T-lineage progenitors do not themselves express significant
levels of MHC class II molecules (33, 34), these results
demonstrate that CD4 can couple to endogenous Lck in
such a way that interaction with an extracellular ligand, in
this case class II molecules, stimulates changes in gene expression.
Numerous previous studies have documented the ability
of the CD4 coreceptor to behave as a ligand for MHC
class II molecules and to augment the response of class II-
restricted T cells to appropriate antigen-presenting cells.
Though the ability of CD4 to associate physically with Lck
(18) and to stimulate Lck activity when experimentally oligomerized (21, 22) has long been recognized, the mechanism by which CD4 functions in cell signaling remains unclear. For example, in T cell hybridomas known to require
CD4 for antigen recognition, a chimeric CD4 protein covalently linked to a catalytically inactive Lck molecule
proved equipotent to wild-type CD4 (40). This result was
observed even when the kinase domain of Lck was deleted
entirely. Similarly, a tailless CD4 transgene (a construct
identical to the CD4
construct which we have employed)
was capable of directing substantial maturation of class II-
restricted cells from the DP to the SP stage (41). These observations prompted the development of models in which Lck might act to regulate CD4 adhesion in a kinase-independent manner, rather than to deliver CD4-derived signals through tyrosine phosphate transfer (19).
Our experiments show that CD4, by binding class II,
can stimulate an Lck-dependent process. Prior studies reveal that disruption of the lck gene substantially blocks
thymocyte development at the DN to DP transition (14).
Moreover, high level expression of a catalytically inactive
version of Lck can completely block thymocyte development at the DN stage (13). These experiments demonstrate
that the catalytic activity of Lck is required for satisfactory
thymocyte maturation, a conclusion supported by the ability of activated Lck to stimulate the same maturational
events (17). In a sense, the DN to DP transition serves as an
extremely sensitive in vivo bioassay for Lck function,
which permitted us to demonstrate that the binding of
CD4 to class II molecules can stimulate signal transduction.
This result in turn may serve to explain why
ITAM motifs are constitutively phosphorylated in wild-type DP thymocytes (42): the binding of class II to CD4 triggers an increase in Lck kinase activity, resulting in phosphorylation of antigen receptor components. By inference, the presence of a constitutive Lck-activating stimulus can therefore
be considered a normal feature of cortical thymic environments.
An activated p56lck transgene stimulates
thymocyte development in Rag1
/
mice (17), and augmented expression of wild-type p56lck triggers allelic exclusion at the TCR
-chain locus (43). The results presented
here show that activation of endogenous Lck, using a transgenic wild-type CD4 molecule as a signal sensor, promotes
the DN to DP transition. These observations are consistent with experiments demonstrating that ionizing radiation
(known to activate src-family PTKs) promotes thymocyte
development in an lck-dependent manner (44).
However, the CD4 transgene induced only a modest increase in total thymocyte number in Rag2
/
mice, much
less than that observed when a TCR-
(17) or activated lck
transgene (17) is used. This difference suggests that CD4 behaves less efficiently on a per cell basis in promoting the DN to DP transition. Alternatively CD4 may deliver a
qualitatively different signal to developing thymocytes than
does the normal pre-TCR complex. Using anti-CD4 mAb
treatment, we observed that all DN, transgene-bearing thymocytes can respond to CD4-derived signals, as judged by
CD69 induction (Fig. 4 B). However, inasmuch as even a
50% reduction in class II expression dramatically decreases the efficiency of CD4-stimulated thymocyte maturation
(Fig. 3), satisfactory stimulation of the DN to DP transition
by transgenic CD4 appears to be exquisitely sensitive to the
presence of an appropriate ligand. This limiting effect of
class II abundance suggests that the CD4-derived signal
may differ only quantitatively from that which is entrained
by pre-TCR stimulation. As thymocytes are thought to
undergo at least seven rounds of replication in developing
from the DN to the DP stage (13, 45), CD4 transgenemediated activation of a small number of pre-T cells could
produce thymi in which the majority of cells exhibit a
more mature phenotype, without greatly increasing the total number of thymocytes. We cannot, however, exclude
the possibility that CD4-derived signals differ qualitatively
from pre-TCR signals, perhaps by activating only a subset
of Lck-dependent signal transduction cascades.
Unlike Rag2
/
mice, expression of the CD4
transgene in CD3
/
mice failed to induce thymocyte development (Fig. 5). These results echo those obtained in
the Jurkat transformed T cell line, where coupling of p56lck
to CD3 signaling components is important for the transmission of intracellular signals (46). Viewed from one perspective, the inability of the CD4/Lck signal to mediate
development in the absence of CD3 indicates that the CD3
components function downstream of Lck, especially because CD3 ITAM motifs are good substrates for the Lck
kinase (47). However it remains equally plausible that
CD4/Lck complexes must colocalize with the pre-TCR as
a means of approximating Lck with another positive regulator, e.g., CD45. Prior studies implicate the CD45 phosphatase in the dephosphorylation of a negative regulatory
site (tyrosine 505) in Lck (48).
Although we cannot yet identify the targets of Lckmediated catalysis, it seems certain that simple activation of the Lck kinase cannot serve by itself to stimulate thymocyte development. We conclude that Lck must be juxtaposed with its intracellular targets to permit satisfactory signal transduction. The localization of these proteins therefore could serve as another means of regulating thymocyte maturation.
Finally, it bears mention that the expression of CD4 varies in a peculiar and characteristic way during thymocyte
maturation. Very immature hematopoietic progenitors express CD4, which disappears shortly after arrival in the
thymus (49). CD4 reappears in all thymocytes after preTCR-mediated stimulation, and then is extinguished in
cells that express class I-restricted receptors. Suppression of
CD4 transcription requires the activity of a dedicated silencer, a conserved cis-acting element (50). Because CD4
expression can, as we demonstrate, drive thymocyte maturation even in the absence of TCR-
chain expression, our
results suggest that extinction of CD4 expression in very
immature thymocytes is required to permit proper sensing
of TCR-
chain gene assembly, and the consequent regulation of thymocyte maturation.
Address correspondence to R.M. Perlmutter, Department of Immunology Box 357650, University of Washington, Seattle, WA 98195-7650.
Received for publication 4 September 1996
A.M. Norment is supported by a National Cancer Institute KO8 Clinical Investigator Award (no. K08 CA64448) and R.M. Perlmutter is an Investigator of the Howard Hughes Medical Institute. This work was supported in part by a grant from the National Institutes of Health (no. CA45682) to R.M. Perlmutter.We thank Dr. S. Anderson for the suggestion to generate CD4Tg+ Rag2
/
mice, Dr. F.W. Alt for Rag2
/
mice, and Dr. P. Fink for the class II
/
mice. We also thank S. Chien and R. Peet for technical assistance, K. Prewitt for secretarial assistance, and our colleagues for helpful discussions.
| 1. | Perlmutter, R.M., S.D. Levin, M.W. Appleby, S J. Anderson, and J. Alberola-Ila. 1993. Regulation of lymphocyte function by protein phosphorylation. Ann. Rev. Immunol. 11: 451-499 [Medline] . |
| 2. | Jenkinson, E.J., and J.J. Owen. 1990. T-cell differentiation in thymus organ cultures. Semin. Immunol. 2: 51-58 [Medline] . |
| 3. |
Saint-Ruf, C.,
K. Ungewiss,
M. Groettrup,
L. Bruno,
H.J. Fehling, and
H. von Boehmer.
1994.
Analysis and expression
of a cloned pre-T cell receptor gene.
Science (Wash. DC).
266:
1208-1212
|
| 4. |
Levelt, C.N.,
R. Carsetti, and
K. Eichmann.
1993.
Regulation of thymocyte development through CD3. II. Expression
of T cell receptor CD3 and maturation to the CD4+8+
stage are highly correlated in individual thymocytes.
J. Exp.
Med.
178:
1867-1875
|
| 5. |
Groettrup, M.,
A. Baron,
G. Griffiths,
R. Palacios, and
H. von Boehmer.
1992.
T cell receptor (TCR) chain homodimers on the surface of immature but not mature , , chain deficient T cell lines.
EMBO (Eur. Mol. Biol. Organ.) J.
11:
2735-2746
[Medline]
.
|
| 6. | Kisielow, P., and H. von Boehmer. 1995. Development and selection of T cells: facts and puzzles. Adv. Immunol. 58: 87-209 [Medline] . |
| 7. |
Mombaerts, P.,
A.R. Clarke,
M.A. Rudnicki,
J. Iacomini,
S. Itohara,
J.J. Lafaille,
L. Wang,
Y. Ichikawa,
R. Jaenisch,
M.L. Hooper, and
S. Tonegawa.
1992.
Mutations in the T-cell antigen receptor genes and block thymocyte development
at different stages.
Nature (Lond.).
360:
225-231
[Medline]
.
|
| 8. |
Levelt, C.N.,
P. Mombaerts,
A. Iglesias,
S. Tonegawa, and
K. Eichmann.
1993.
Restoration of early thymocyte differentiation in T-cell receptor -chain-deficient mutant mice by
transmembrane signaling through CD3 .
Proc. Natl. Acad. Sci.
USA.
90:
11401-11405
|
| 9. | Jameson, S.C., K.A. Hogquist, and M.J. Bevan. 1995. Positive selection of thymocytes. Annu. Rev. Immunol. 13: 93-126 [Medline] . |
| 10. | Anderson, S.J., and R.M. Perlmutter. 1995. A signaling pathway governing early thymocyte maturation. Immunol. Today. 16: 99-105 [Medline] . |
| 11. |
Malissen, M.,
A. Gillet,
L. Ardouin,
G. Bouvier,
J. Trucy,
P. Ferrier,
E. Vivier, and
B. Malissen.
1995.
Altered T cell development in mice with a targeted mutation of the CD3
gene.
EMBO (Eur. Mol. Biol. Organ.) J.
14:
4641-4653
[Medline]
.
|
| 12. |
Fehling, H.J.,
A. Krotkova,
C. Saint-Ruf, and
H. von Boehmer.
1995.
Crucial role of the pre-T-cell receptor gene in
development of ![]() but not ![]() T cells.
Nature (Lond.).
375:
795-798
[Medline]
.
|
| 13. | Levin, S.D., S.J. Anderson, K.A. Forbush, and R.M. Perlmutter. 1993. A dominant-negative transgene defines a role for p56lck in thymopoiesis. EMBO (Eur. Mol. Biol. Organ.) J. 4: 1671-1680 . |
| 14. | Molina, T.J., K. Kishihara, D.P. Siderovski, W. van Ewijk, A. Narendran, E. Timms, A. Wakeham, C.J. Paige, K.U. Hartmann, A. Veillette, et al . 1992. Profound block in thymocyte development in mice lacking p56lck. Nature (Lond.). 357: 161-164 [Medline] . |
| 15. | Groves, T., P. Smiley, M.P. Cooke, K.A. Forbush, R.M. Perlmutter, and C.J. Guidos. 1996. Fyn can partially substitute for Lck in T lymphocyte development. Immunity. 5: 417-528 [Medline] . |
| 16. |
van Oers, N.S.C.,
B. Lowin-Kropf,
D. Finlay,
K. Connolly, and
A. Weiss.
1996.
![]() T cell development is abolished in
mice lacking both Lck and Fyn protein tyrosine kinases.
Immunity.
5:
429-436
[Medline]
.
|
| 17. | Mombaerts, P., S.J. Anderson, R.M. Perlmutter, T.W. Mak, and S. Tonegawa. 1994. An activated lck transgene promotes thymocyte development in RAG-1 mutant mice. Immunity. 1: 261-267 [Medline] . |
| 18. | Turner, J.M., M.H. Brodsky, B.A. Irving, S.D. Levin, R.M. Perlmutter, and D.R. Littman. 1990. Interaction of the unique N-terminal region of the tyrosine kinase p56lck with the cytoplasmic domains of CD4 and CD8 is mediated by cysteine motifs. Cell. 60: 755-765 [Medline] . |
| 19. | Weiss, A., and D.R. Littman. 1994. Signal transduction by lymphocyte antigen receptors. Cell. 76: 263-274 [Medline] . |
| 20. |
Iwashima, M.,
B.A. Irving,
N.S. van Oers,
A.C. Chan, and
A. Weiss.
1994.
Sequential interactions of the TCR with two
distinct cytoplasmic tyrosine kinases.
Science (Wash. DC).
263:
1136-1139
|
| 21. |
Veillette, A.,
J.C. Zúñiga-Pfücker,
J.B. Bolen, and
A.M. Kruisbeek.
1989.
Engagement of CD4 and CD8 expressed
on immature thymocytes induces activation of intracellular
tyrosine phosphorylation pathways.
J. Exp. Med.
170:
1671-1680
|
| 22. | Veillette, A., M.A. Bookman, E.M. Horak, L.E. Samelson, and J.B. Bolen. 1989. Signal transduction through the CD4 receptor involves the activation of the internal membrane tyrosine-protein kinase p56lck. Nature (Lond.). 338: 257-259 [Medline] . |
| 23. |
Garvin, A.M.,
K.M. Abraham,
K.A. Forbush,
A.G. Farr,
B.L. Davison, and
R.M. Perlmutter.
1990.
Disruption of thymocyte development and lymphomagenesis induced by SV40
T-antigen.
Int. Immunol.
2:
173-180
|
| 24. | Teh, H., A.M. Garvin, K.A. Forbush, D.A. Carlow, C.B. Davis, D.R. Littman, and R.M. Perlmutter. 1991. Participation of CD4 coreceptor molecules in T-cell repertoire selection. Nature (Lond.). 349: 241-243 [Medline] . |
| 25. | van Oers, N.S.C., A.M. Garvin, C.B. Davis, K.A. Forbush, D.A. Carlow, D.R. Littman, R.M. Perlmutter, and H.S. Teh. 1992. Disruption of CD8-dependent negative and positive selection of thymocytes is correlated with a decreased association between CD8 and the protein tyrosine kinase, p56lck. Eur. J. Immunol. 22: 735-743 [Medline] . |
| 26. | Shinkai, Y., G. Rathbun, K. Lam, E.M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A.M. Stall, and F.W. Alt. 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 68: 855-867 [Medline] . |
| 27. | Cosgrove, D., D. Gray, A. Dierich, J. Kaufman, M. Lemeur, C. Benoist, and D. Mathis. 1991. Mice lacking MHC class II molecules. Cell. 66: 1051-1066 [Medline] . |
| 28. | Littman, D.R., and S.N. Gettner. 1987. Unusual intron in the immunoglobulin domain of the newly isolated murine CD4 (L3T4) gene. Nature (Lond.). 325: 453-455 [Medline] . |
| 29. | König, R., L. Huang, and R.N. Germain. 1992. MHC class interaction with CD4 mediated by a region analogous to the MHC class I binding site for CD8. Nature (Lond.). 356: 796-798 [Medline] . |
| 30. |
Cammarota, G.,
A. Scheirle,
B. Takacs,
D.M. Doran,
R. Knorr,
W. Bannwarth,
J. Guardiola, and
F. Sinigaglia.
1992.
Identification of a CD4 binding site on the 2 domain of
HLA-DR molecules.
Nature (Lond.).
356:
799-801
[Medline]
.
|
| 31. | Janeway, C.A.. 1992. The T cell receptor as a multicomponent signalling machine: CD4/CD8 coreceptors and CD45 in T cell activation. Annu. Rev. Immunol. 10: 645-674 [Medline] . |
| 32. |
Mathis, D.J.,
C. Benoist,
V.E. Williams II,
M. Kanter, and
H.O. McDevitt.
1983.
Several mechanisms can account for
defective E gene expression in different mouse haplotypes.
Proc. Natl. Acad. Sci. USA.
86:
273-277
.
|
| 33. | Sharrow, S.O., B.J. Mathieson, and A. Singer. 1981. Cell surface appearance of unexpected host MHC determinants on thymocytes from radiation bone marrow chimeras. J. Immunol. 126: 1327-1335 [Abstract] . |
| 34. |
Schwartz, B.D.,
A.M. Kask,
S.O. Sharrow,
C.S. David, and
R.H. Schwartz.
1977.
Partial chemical characterization of Ia
antigens derived from murine thymocytes.
Proc. Natl. Acad.
Sci. USA.
74:
1195-1199
|
| 35. |
Levelt, C.N.,
P. Mombaerts,
B. Wang,
H. Kohler,
S. Tonegawa,
K. Eichmann, and
C. Terhorst.
1993.
Regulation of
thymocyte development through CD3: Functional dissociation between p56lck and CD3 in early and late thymic selection.
Immunity.
3:
215-222
.
|
| 36. | Yokoyama, W.M., F. Koning, P.J. Kehn, G.M.B. Pereira, G. Stingl, J.E. Coligan, and E.M. Shevach. 1988. Characterization of a cell surface-expressed disulfide-linked dimer involved in murine T cell activation. J. Immunol. 141: 369-376 [Abstract] . |
| 37. | Owen, M.J., and A.R. Venkitaraman. 1996. Signalling in lymphocyte development. Curr. Opin. Immunol. 8: 191-198 [Medline] . |
| 38. | Mombaerts, P., J. Iacomini, R.S. Johnson, K. Herrup, S. Tonegawa, and V.E. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell. 68: 869-877 [Medline] . |
| 39. |
Shinkai, Y.,
A. Ma,
A. Cheng, and
F.W. Alt.
1995.
CD3
and CD3 cytoplasmic domains can independently generate
signals for T cell development and function.
Immunity.
2:
401-411
[Medline]
.
|
| 40. | Xu, H., and D.R. Littman. 1993. A kinase-independent function of Lck in potentiating antigen-specific T cell activation. Cell. 74: 633-643 [Medline] . |
| 41. | Killeen, N., and D.R. Littman. 1993. Helper T-cell development in the absence of CD4-p56lck association. Nature (Lond.). 364: 729-732 [Medline] . |
| 42. |
Nakayama, T.,
A. Singer,
E.D. Hsi, and
L.E. Samelson.
1989.
Intrathymic signalling in immature CD4+CD8+ thymocytes
results in tyrosine phosphorylation of the T cell receptor chain.
Nature (Lond.).
341:
651-654
[Medline]
.
|
| 43. |
Anderson, S.J.,
K.M. Abraham,
T. Nakayama,
A. Singer, and
R.M. Perlmutter.
1992.
Inhibition of T-cell receptor -chain
gene rearrangement by overexpression of the non-receptor
protein tyrosine kinase p56lck.
EMBO (Eur. Mol. Biol. Organ.)
J.
11:
4877-4886
[Medline]
.
|
| 44. |
Wu, G.,
J.S. Danska, and
C.J. Guidos.
1996.
Lck-dependence
of signaling pathways activated by -irradiation and CD3
engagement of immature RAG-deficient thymocytes.
Int.
Immunol.
8:
1159-1164
|
| 45. | Baron, C., and C. Penit. 1990. Study of the thymocyte cell cycle by bivariate analysis of incorporated bromodeoxyuridine and DNA content. Eur. J. Immunol. 20: 1231-1236 [Medline] . |
| 46. | Straus, D.B., and A. Weiss. 1992. Genetic evidence for the involvement of the lck tyrosine kinase in signal transduction through the T cell antigen receptor. Cell. 70: 585-593 [Medline] . |
| 47. |
Watts, J.D.,
G.M. Wilson,
E. Ettehadieh,
I. Clark-Lewis,
C. Kubanek,
C.R. Astell,
J.D. Marth, and
R. Aebersold.
1992.
Purification and initial characterization of the lymphocytespecific protein-tyrosyl kinase p56lck from a Baculovirus expression system.
J. Biol. Chem.
267:
901-907
|
| 48. | Chan, A.C., D.M. Desai, and A. Weiss. 1994. The role of protein tyrosine kinases and protein tyrosine phosphatases in T cell antigen receptor signal transduction. Annu. Rev. Immunol. 12: 555-592 [Medline] . |
| 49. | Wu, L., R. Scollay, M. Egerton, M. Pearse, G.J. Spangrude, and K. Shortman. 1991. CD4 expressed on earliest T-lineage precursor cells in the adult murine thymus. Nature (Lond.). 349: 71-74 [Medline] . |
| 50. | Sawada, S., J.D. Scarborough, N. Killeen, and D.R. Littman. 1994. A lineage-specific transcriptional silencer regulates CD4 gene expression during T lymphocyte development. Cell. 77: 917-929 [Medline] . |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|