Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article Abstract Full Text (PDF, 237K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Wolf, S. D. Articles by Janeway, C. A. Search for Related Content PubMed PubMed Citation Articles by Wolf, S. D. Articles by Janeway, C. A., Jr. Social Bookmarking                            What's this?

Articles

From the Howard Hughes Medical Institute, Section of Immunobiology, Yale University School of Medicine, New Haven, Connecticut 06510

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Experimental autoimmune encephalomyelitis (EAE) is an animal model for autoimmune central nervous system disease mediated by CD4 T cells. To examine the role of B cells in the induction of EAE, we used B10.PL (I-A^u) mice rendered deficient in B cells by deletion of their µ chain transmembrane region (B10.PLµMT). By immunizing B10.PL and B10.PLµMT mice with the NH-terminal myelin basic protein encephalitogenic peptide Ac1-11, we observed no difference in the onset or severity of disease in the absence of mature B cells. There was, however, a greater variation in disease onset, severity, and especially of recovery in the B cell–deficient mice compared to controls. B10.PLµMT mice rarely returned to normal in the absence of B cells. Taken together, our data suggest that B cells do not play a role in the activation of encephalitogenic T cells, but may contribute to the immune modulation of acute EAE. The mechanisms to explain these effects are discussed.

Experimental autoimmune encephalomyelitis (EAE)¹ is a demyelinating disease that is characterized by focal areas of inflammation and demyelination throughout the central nervous system (CNS) (1). The disease is acute or chronic relapsing with a clinical course characterized by a rapid onset of hind limb weakness which commonly progresses to paralysis, followed by spontaneous remission 7–10 d after the initial appearance of symptoms. EAE can be actively induced in genetically susceptible animal strains by the injection of myelin basic protein (MBP) in appropriate adjuvants, and it is mediated by activated CD4 T cells that are specific for the encephalitogenic portion of MBP (2–4). Immunization of the B10.PL mouse strain with MBP or its encephalitogenic NH₂-terminal peptide (MBP Ac1-11) emulsified in CFA leads to the development of acute EAE (5).

Using the B10.PL mouse model, we addressed the need for B cells in the induction of EAE. Previous reports with the Lewis rat have shown that EAE could not be induced by MBP antigen/CFA immunization in animals injected from birth with anti–rat Ig to eliminate B cells (6). However, it was later shown that EAE could be induced in B cell–depleted rats if the animal was also injected with MBP specific antiserum (7). In the mouse model, it was reported that mice depleted of B cells with anti-IgM from birth were refractory to disease induction with MBP antigen/CFA and lacked secondary T cell proliferative responses in primed LN (8).

In this study, we compared induction of EAE in B10.PL and B10.PL mice rendered deficient of B cells by disruption of the µ heavy chain transmembrane exon (B10.PLµMT) (9). We show that B10.PLµMT mice have a similar incidence rate of EAE induction when compared to controls. The B10.PLµMT animals had greater variation in day of disease onset and disease severity, and they failed to completely recover as compared to B10.PL in which spontaneous recovery was the norm. Our data show that B cells are not required for the activation of encephalitogenic T cells, and hence the induction of EAE, but may play a role in the immune regulation of the course of this disease.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Mice.
B10.PL mice (I-A^u) were purchased from the Jackson Laboratory (Bar Harbor, ME), or reared in our colony at Yale University. C57/BL6 µMT (B cell-deficient) mice were provided to us by Dr. K. Rajewsky (10), and were backcrossed onto B10.PL mice for over eight generations and then intercrossed to generate homozygous B10.PLµMT in our colony at Yale University. All mice were between 2 and 6 mo of age upon use.

Peptides and Antibodies.
The MBP Ac1-11 (Ac-ASQKRPSQRSK) peptide and the HEL 30-53 (CAAKFESNFNTQATNRNTDGSTDY) peptide were synthesized and HPLC purified by the W.M. Keck Foundation Biotechnology Resource Laboratory at Yale University. YCD3.1 (rat anti–mouse CD3), GK1.5 (rat anti–mouse CD4), 53-6.72 (rat anti–mouse CD8), Y3JP (mouse anti–mouse I-A), and Y19 (rat anti–mouse Thy1) were purchased from American Type Culture Collection (Rockville, MD) or grown locally. Anti–mouse CD4-FITC, anti–mouse CD4-R613, and anti–mouse CD8-R613 were purchased from GIBCO BRL (Gaithersburg, MD). Anti–mouse β TCR-PE and anti–mouse Vβ8.1,8.2 TCR-FITC were purchased from PharMingen (San Diego, CA). Anti–mouse polyvalent Ig-FITC was purchased from Sigma Chemical Co. (St. Louis, MO).

Immunofluorescence.
Two-color immunofluorescence staining using anti-TCR β-PE and anti-Ig-FITC was carried out on whole naive spleen cells from B10.PL and B10.PLµMT mice. Threecolor immunofluorescence staining with anti-CD4-FITC, antiTCR β-PE, and anti-CD8-R613 or anti-TCR Vβ8.1,8.2-FITC, anti-TCR β-PE, and anti-CD4-R613 was carried out on whole naive spleen and thymus from B10.PL and B10.PLµMT mice. Antibody incubations were carried out on ice and the cells were fixed in 1% paraformaldehyde and analyzed using CellQuest on a FACScan^® (Becton Dickinson, Mountain View, CA).

EAE Induction.
Groups of four to five B10.PL and B10.PLµMT female mice were immunized with 150 µg of MBP Ac1-11 emulsified in 100 µl of CFA containing 4 mg/ml of heat-killed mycobacterium tuberculosis H37Ra (Difco Laboratories, Detroit, MI) subcutaneously in each internal flank. 200 ng of pertussis toxin (List Biological Labs. Inc., Campbell, CA) in PBS was injected intravenously at the time of immunization and again 48 h later.

T Cell Activation Assay.
CD4⁺ T cells were isolated from spleen of B10.PL and B10.PLµMT mice, and 10⁵ cells in Click's modified EHAA medium with 5% FCS (Click's 5%) were added to 96-well flat-bottom microtiter plates containing plate-bound anti-CD3 in serial 1:3 dilutions from 0.1–10 µg/ml. Anti-CD3 diluted in PBS was preabsorbed onto 96-well flat-bottom microtiter plates for 1 h at 37°C, and washed three times. Con A stimulation was performed by culturing CD4⁺ T cells from the spleen of B10.PL and B10.PLµMT mice at serial 1:3 dilutions from 0.1– 3.0 x 10⁵ cells/well in the presence of 5 µg/ml Con A (Pharmacia CKB Biotechnology Inc., Piscataway, NJ). Cultures were pulsed after 48 h with 1 µCi [³H]TdR and harvested after 15–18 h. Individual data points were set up in triplicate.

T Cell Recall Proliferation.
B10.PL and B10.PLµMT mice were immunized with 150 µg Ac 1-11 or HEL 30-53 emulsified in CFA in the hind foot pads. After 10 d, the popliteal LN were removed and CD4⁺ cells were isolated by depleting the LN cells of CD8⁺ T cells and B cells using anti-CD8 (TIB 105) and Y3JP (anti-IA), respectively, and magnetic beads. 2 x 10⁵ CD4⁺ LN cells were cocultured with 2 x 10⁵ irradiated splenic APC isolated from B10.PL mice by depleting T cells with anti-CD4 (GK1.5), anti-CD8 (TIB 105), Thy1 (Y19), and magnetic beads. Proliferation to Ac 1-11 or HEL 30-53 was detected at 72 h by adding 1 µCi [³H]TdR to each well for the last 15–18 h of culture. CD4⁺ T cells were >90% pure.

Cytokine mRNA Production.
Semi-quantitative reverse transcriptase (RT)-PCR was used to detect cytokine mRNA synthesis from LN cells isolated from B10.PL and B10.PLµMT mice immunized in the footpads with 150 µg Ac 1-11 or HEL 30-53 emulsified in CFA. After 10 d, the popliteal LN were removed and CD4⁺ T cells were isolated as described above. Detection of cytokine mRNA was performed according to Pfeiffer et al. (11) with modifications. Briefly, 4 x 10⁶ CD4⁺ T cells were cocultured with 2 x 10⁶ I-A^u irradiated splenic APC (isolated as described above) in the presence of 100 µg/ml Ac 1-11 or HEL 30-53. After 48 h, cDNA was prepared and PCR amplified for the housekeeping gene hypoxanthine-guanine phosphoribosyl transferase (HPRT) with 1 cycle of 94°C for 5 min, 55°C for 1 min, and 72°C for 1 min, followed by 25–30 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1, min and ending with a final extension at 72°C for 15 min. The PCR reaction for HPRT was used to confirm that equal amounts of cDNA were used from each cDNA preparation. The HPRT-PCR products were quantitated using the Is-1000 Digital Imaging System (Alpha Innotech, Corp., San Leandro, CA). Subsequent PCR reactions were performed using cDNA from 2 x 10⁵ cell equivalents to detect IL-2, IL-4, IFN-, and TNF-.

Forward primer for IL-2 was TCCACTTCAAGCTCTACAG; reverse primer was GAGTCAAATCCAGAACATGCC; PCR product length is 247 bp. Forward primer for IL-4 was CATCGGCATTTTGAACGAGGTCA; reverse primer was CTTATCGATGAATCCAGGCATCG; PCR product length is 240 bp. Forward primer for IFN- was CATTGAAAGCCTAGAAAGTCTG; reverse primer was CTCATGAATGCATCCTTTTTCG; PCR product length is 267 bp. Forward primer for HPRT was GTTGGATACAGGCCAGACTTTGTTG; reverse primer was GAGGGTAGGCTGGCCTATTGGCT; PCR product is 352 bp. Forward primer for TNF- was GTTCTATGGCCCAGACCCTCACA; reverse primer was TCCCAGGTATATGGGTTCATACC; PCR product length is 383 bp. Bands were visualized by loading 10 µl of the PCR reaction onto a 1.2% agarose gel, running the gel at 100 V for 1 h, staining for 30 min in 0.5 µg/ml ethidium bromide, and destaining in water.

	Results

Top Abstract Materials and Methods Results Discussion References

 
B Cell–deficient Mice (B10.PL µMT) Have Normal Numbers of CD4 and CD8 T Cells in Thymus and Spleen, but No Mature B Cells.
To test whether B cells are involved in the induction or recovery of EAE in mice immunized with MBP Ac1-11, we generated B10.PL (I-A^u) mice deficient in mature B cells (B10.PLµMT). We backcrossed the EAE susceptible strain, B10.PL, for 8 generations with the µMT B cell–deficient mouse (I-A^b) provided by Dr. K. Rajewsky (10), and then intercrossed these F1-backcross mice to create homozygous B10.PLµMT animals. As shown in Fig. 1 B, B10.PLµMT mice lack mature Ig expressing B cells in the spleen, while maintaining an increased percentage of T cells as measured by staining for the β TCR. This is in contrast with the normal B10.PL mice which contain both B and T cell populations in the spleen (Fig. 1 A). We also analyzed the B10.PLµMT mice for the expression of the B cell specific CD45 isoform, B220, and did not detect any positive cells (data not shown).

View larger version (26K): [in this window] [in a new window] [Download PPT slide]   Figure 1 Two-color dot plots of Ig and TCR β expression on spleen cells from B10.PL and B10.PLµMT mice. Spleen cells were stained for the expression of Ig (x-axis) and β TCR (y-axis). Data represent analysis performed on male age matched B10.PL (A) and B10.PLµMT (B) mice from one of five sets of experiments each with similar results.

 
Although spleens from B10.PLµMT have 50–75% lower total cell numbers than B10.PL control mice, the total numbers of TCR-CD4⁺ and TCR-CD8⁺ cells are similar (Table 1). Likewise, the total cell numbers in the thymus of B10.PL and B10.PLµMT mice are also similar (Table 1). These observations are in agreement with a similar analysis described by Epstein et al., which used B6µMT mice (12). We also examined CD4⁺ T cells in the spleen and thymus for the usage of the Vβ8.2 TCR because this population of T cells is the predominant encephalitogenic cell in I-A^u mouse strains (13, 14). As shown in Table 1, both B10.PL and B10.PLµMT have a prominent population of CD4⁺, Vβ8.2⁺ T cells in both the thymus and spleen. The presence of CD4⁺,Vβ8.2⁺ cells in the spleen confirms that there is no defect in the selection and exportation from the thymus of these cells in our B10.PLµMT mice.

View this table: [in this window] [in a new window]   Table 1 Comparison of T Cell Populations in B10.PL and B10.PLµMT Mice*

 
Naive T Cells in the B10.PLµMT Mice Can Be Activated by Anti-CD3 and Con A.
Since T cells in both B10.PLµMT and B10.PL mice are quantitatively similar, we examined whether functional differences in T cell activation could be detected in T cells from B10.PL and B10.PLµMT mice. Naive CD4⁺ T cells were isolated from the spleen of B10.PL and B10.PLµMT mice and stimulated using platebound anti-CD3 or soluble Con A. As shown in Fig. 2 A, proliferation to anti-CD3 in both B10.PL and B10.PLµMT mice as measured by [³H]TdR incorporation was identical and occurred in a dose-dependent manner. Similarly, naive CD4⁺ T cells from the B10.PLµMT mice responded as well as wild-type T cells to Con A activation in a cell dose– dependent manner (Fig. 2 B). These data demonstrate that T cells in the B10. PLµMT mice are functionally intact and can be activated through conventional activation pathways.

View larger version (13K): [in this window] [in a new window] [Download PPT slide]   Figure 2 Proliferation of CD4+ T cells from B10.PL and B10.PLµMT mice in response to Con A and anti-CD3. CD4+ spleen cells from one B10.PL mouse (open square) and one B10.PLµMT mouse (closed circle) were cultured in the presence of 1:3 dilutions of plate-bound anti-CD3 from 10 to 0.12 µg/ ml (A) or 1:3 dilutions of CD4+ T cells from 0.1 to 3.0 x 105 cells/well in the presence of 5 µg/ml Con A (B). Proliferation was measured by [3H]TdR incorporation and is presented as CPM performed in duplicate. Data in A and B are from the same mice with identical animals sharing symbols and represents one third of the experiments, each with similar results.

 
B10.PL and B10.PLµMT Mice Immunized with MBP Ac1-11 Have a Th1 Recall Response.
To examine the cytokine profile induced in response to MBP Ac1-11, we immunized B10.PL and B10.PLµMT mice with MBP Ac1-11 and the control peptide HEL 30-53. After 10 d, we isolated CD4⁺ T cells from the popliteal LN and measured the recall response to MBP Ac1-11 and HEL 30-53. As shown in Fig. 3 A, CD4⁺ T cells from both the B10.PL normal and B10.PLµMT mice proliferated in response to MBP Ac1-11 in a dose-dependent manner, as measured by [³H]TdR incorporation. Similarly, as shown in Fig. 3 B, both B10.PL and B10.PLµMT mice also responded well when challenged with the control I-A^u binding peptide HEL 30-53. However, unlike the response to MPB Ac 1-11, the response to HEL 30-53 was lower in the B10.PLµMT mice when compared to the B10.PL normal mice.

View larger version (55K): [in this window] [in a new window] [Download PPT slide]   Figure 3 Proliferation of CD4+ LN cells from B10.PL and B10.PLµMT mice immunized with MBP Ac 1-11 (A) or HEL 30-53 (B). CD4+ LN cells from B10.PL (open squares) and B10.PLµMT (closed circles) were isolated as described in the Material and Methods from the popliteal LN of mice immunized in the footpads with 150 µg MBP Ac1-11 or HEL 30-53 10 d before, and cocultured with splenic APC in the presence of 1:5 dilutions of MBP Ac1-11 or HEL 30-53 from 100 to 0.16 µg/ml. Background proliferation in the absence of stimulating peptide was subtracted from each data point and is shown as zero on the proliferation curves and was less than 10,000 cpm. Proliferation was measured by [3H]TdR incorporation and presented as counts per minute performed in duplicate. (C) CD4+ LN cells from the identical mice used in A and B were incubated with splenic APC as described in the Material and Methods in the presence of 100 µg/ml MBP Ac1-11 or HEL 30-53. After 48 h, total cellular RNA was isolated from 3.2 x 106 cells. RT-PCR was then performed using primers for HPRT and the HPRT product was quantitated to ensure equal levels of cDNA used in subsequent PCR reactions. PCR was then performed using cDNA from 2 x 105 cell equivalents for IL-2, IL-4, IFN-, and TNF- for 30 cycles. The HPRT-PCR reaction was performed with 25 cycles. D10, a Th2 clone, was used as a positive control for IL-4, and D10.TCR 25, a Th1 clone, was used as a positive control for IL-2, IFN-, and TNF-.

 
Because EAE has been shown to be mediated by T cells with a Th1 cytokine response indicative of the disease phase and a Th2 cytokine response associated with the recovery phase of EAE, we analyzed primed CD4⁺ LN cells for cytokine production following in vitro stimulation with Ac1-11 or HEL 30-53. Using semi-quantitative RT-PCR, transcripts for the Th1 cytokines IFN-, TNF-, and IL-2 were detected in both B10.PL and B10.PLµMT mice immunized with MBP Ac1-11 or HEL 30-53 (Fig. 3 C). We did not detect mRNA transcripts for the Th2 cytokines IL-4 (Fig. 3 C) or IL-5 (data not shown), nor for the cytokines TGF-β₁ or TGF-β₂ (data not shown). However, faint transcripts for IL-10 were detected from all mice analyzed (data not shown). We used the Th2 D10 clone and the Th1 D10.TCR 25 clone (11) which respond to peptide 134-146 of hen egg conalbumin (CA 134-146) in the context of I-A^k as controls for Th2 and Th1 cytokine responses. As shown in Fig. 3 C, the D10 clone produced mRNA transcripts for the Th2 cytokine IL-4, but not Th1 cytokines, while D10.TCR 25 produced transcripts only for the Th1 cytokines IFN- and TNF-.

EAE Is Inducible in B10.PLµMT Mice Using MBP Ac1-11 With No Observable Differences in Disease Onset or Disease Severity, but Highly Significant Differences in Spontaneous Recovery as Compared to Wild-type Animals.
Since B10.PLµMT mice have normal T cell function and lack mature B cells, we used these mice to examine the previously reported requirement for B cells in the induction and recovery from peptideinduced EAE. We immunized B10.PL and B10.PLµMT mice with 150 µg MBP Ac1-11 emulsified in CFA in the flanks combined with the intravenous injection of pertussis toxin. We successfully used this immunization protocol to induce EAE with a peak incidence in normal mice at 16.2 ± 0.68 d. We were also able to induce disease in B10. PLµMT with a peak incidence at 15.4 ± 0.92 d (Table 2, Fig. 4). In the B10.PLµMT mice, initial signs of disease were noticed as early as day 9 and as late as day 25 after immunization, compared to the B10.PL group which had a smaller range of EAE onset, days 13–21. The variation in disease onset was not significantly different in the two groups of animals. In addition, B10.PLµMT and B10.PL mice have a similar incidence of EAE induction, with a total of 19/22 B10.PLµMT animals demonstrating symptoms associated with EAE as compared to 16/19 B cell sufficient B10.PL mice. Likewise, when the average disease severity was analyzed (rated on a sliding scale from 0 to 5, ranging from no disease to death), no difference was detected between B10.PL and B10.PLµMT mice (Table 2). However, it was observed that individual B10.PLµMT as compared to wild type achieved a higher grade of disease severity (Fig. 4, B and C).

View this table: [in this window] [in a new window]   Table 2 Induction of EAE and Spontaneous Recovery*

 

View larger version (24K): [in this window] [in a new window] [Download PPT slide]   Figure 4 Comparison of EAE clinical course in B10.PL versus B10.PLµMT mice. B10.PL and B10.PLµMT mice were immunized with 150 µg MBP Ac1-11 in the flanks and intravenously injected with pertussis toxin on the day of immunization, and again 48 h later. The individual mice were scored for the severity of EAE using the following scale: 0, no disease; 1, limp tail; 2, hind limb paresis; 3, hind limb paralysis; 4, hind and fore limb paralysis; 5, death. Mice were examined daily from day 8 to 40, and the daily score from all B10.PL mice (open squares) and B10.PLµMT mice (closed circles) that developed signs of clinical disease were averaged (A). The data in A represents the average of 16/19 B10.PL mice and 19/22 B10.PLµMT mice that manifested disease. Data from individual mice were plotted from three consecutive B10.PL (squares) (B) and four consecutive B10.PLµMT (circles) (C) mice. The data was collected from one fifth of the experiments set up.

 
By day 40, spontaneous recovery reached a plateau in both groups, and it was consistently observed that B10.PLµMT animals did not recover completely in comparison to wildtype controls (Fig. 4 A–C). The average clinical grade in B cell–deficient mice was 2.03 ± 0.20 compared to 0.44 ± 0.14 in wild-type animals, which is a statistically significant difference (P = 0.01). The variability of individual mice with respect to the range of disease onset, severity, and recovery between the two groups is represented in Fig. 4, B and C. Our data show that the B cell–deficient B10.PLµMT mice are just as susceptible to the peptide induction of EAE, but differ in the various degrees of disease severity and in the ability to completely recover. Thus, although B cells are not necessary for the induction of EAE, they may play a role in the immune regulation required of animals to completely recover from the limb paralysis characteristic of EAE.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
We have examined the role of B cells in the induction of EAE. We found that in the absence of B cells, EAE could be induced in mice. In contrast to the results we have obtained in our genetically B cell–deficient mouse model, previous studies in rat and murine models reported that EAE induction did not occur in B cell–depleted animals (6, 8). However, two important differences exist between our B cell– deficient mice and those previously used. First, the earlier B cell–deficient animals were obtained by depletion of B cells with infusion of anti-IgM antibodies in neonatal animals. Our mice were generated by targeted disruption of the IgM heavy chain gene transmembrane region, which prevents the development of mature B cells (10). Our model has the advantage of eliminating any possibility of B cell leakage or unknown deleterious effects on other APC from infusion of exogenous protein. Second, in previous experiments, EAE induction was attempted using whole MBP emulsified in CFA for immunization or injections of mouse spinal cord homogenized in CFA. In these experiments, we immunized with a peptide antigen, MBP Ac1-11 in CFA. However, preliminary results from our lab show that B10.PLµMT mice develop EAE using whole mouse MBP as antigen and also that isolated CD4⁺ T cells from spleen taken at day 40 from these mice proliferate to the encephalitogenic peptide MBP Ac1-11 (our unpublished data).

Our results are in concordance with recently published data by other investigators who showed that efficient in vivo priming of T cells (as measured by proliferation to recall antigen), to peptide, and to some proteins occurs in genetically B cell–deficient mice (12, 15, 16). Our results are also in agreement with Sunshine's results showing that T cells can be primed in SCID mice in the absence of B cells (17). The B10.PLµMT (I-A^u) strain used in our experiments has the benefit of demonstrating for the first time that the lack of B cells has no impact on the in situ function of primed CD4⁺ T cells, measured in our model by the ability of encephalitogenic T cells to become activated and to induce EAE.

Our data support the hypothesis that the initiating APC in immune responses to peptide antigens is most likely the dendritic cell (DC). DCs efficiently take up, process, and present soluble protein, and can stimulate naive T cells more efficiently than do B cells or macrophages (18–21). Recently, Guery et al. demonstrated that antigen complexes capable of activating T cell hybridomas are expressed only by LN-DC, and not B cells, after subcutaneous administration of protein antigen in adjuvant (22). Though their data strongly support the hypothesis that DC, and not B cells, are required for stimulating unprimed T cell proliferative responses in vivo (20, 23–27), other investigators have generated data supporting the ability of activated B cells to stimulate naive T cells (18, 28–33).

Lin et al. (34) proposed a model in which dendritic cells prime the first cohort of native T cells, which then provide help for the activation of B cells. Once activated, the B cells can then directly prime additional naive T cells (34–36). The variability we observed in our mice with respect to disease onset, severity, and spontaneous recovery (Fig. 4, B and C) could be interpreted using Lin's model in conjunction with the Th1–Th2 immune deviation hypothesis for inflammatory autoimmune disease (37, 38).

It is known that EAE is mediated by CD4 T cells secreting the Th1 cytokines IL-2, INF-, TNF-, and lymphotoxin, and once activated, these encephalitogenic T cells express 4 integrin on their cell surface which is required for entry into the CNS (39). Furthermore, it has been shown that T cells producing the Th2 cytokines IL-4, IL-10, and TGF-β₁ interact with and regulate Th1 T cells in EAE (40–42). Several pieces of evidence suggest B cells acting as APC, skew T helper cells to differentiate toward a Th2 response (35, 38, 43–46). The lack of spontaneous recovery observed in our B10.PLµMT mice could be due to the lack of B cells acting as APCs for Th2 cells. An absence of Th2 cytokines may allow continued expansion and migration of activated Th1 encephalitogenic cells into the CNS, thus prolonging inflammation and demyelination in the target organ and hence, preventing complete recovery. We are currently investigating this possibility by using the RTPCR method to examine Th1 and Th2 cytokine production in LN cells and spleen, while simultaneously examining CNS histology for the presence of CD4⁺Vβ8.2⁺ cells in the B10.PLµMT and comparing this to B10.PL mice at multiple time points during the disease course.

In this study, we introduced a mouse model genetically deficient in B cells and susceptible to EAE. We demonstrated that B cells are not necessary for activating MBP Ac1-11–specific encephalitogenic T cells, and that the absence of B cells does not impair the resulting T cell effector functions. These results are in contrast to previous studies which showed impairment of T cell function in normal mice depleted of B cells by neonatal treatment with antiIgM antibodies. This difference may be explained by the antigen-presenting property of the remaining endogenous APCs, having been disrupted by the process of B cell depletion used (47–51). An additional finding in this study was the observation that the spontaneous recovery in B10.PLµMT mice was incomplete and heterogeneous as compared to B10.PL controls. We propose that B cells may play a role in immune regulation in EAE through immune deviation from Th1 to Th2 cytokines (37), possibly by altering peptide dose, complexity, or costimulator expression (52). However, other possibilities also exist. For instance, B cells could present peptides of the T cell receptor in the context of I-A^u, which are not found on T cells in mice. Because T cells have been reported to protect against EAE, to be induced during disease, and to contribute to recovery (53), this is also possible.

In conclusion, our genetically B cell–deficient model gives us the opportunity to contribute to the understanding of the complex cellular interactions that are responsible for EAE, and perhaps for human autoimmune diseases such as multiple sclerosis as well.

	Acknowledgments

Submitted: 16 September 1996

Dr. Charles A. Janeway Jr., Howard Hughes Medical Institute, Section of Immunobiology, Yale University School of Medicine, New Haven, CT 06510.

¹ Abbreviations used in this paper: CNS, central nervous system; DC, dendritic cell; EAE, experimental autoimmune encephalomyelitis; HPRT, hypoxanthine-guanine phosphoribosyl transferase; MBP, myelin basic protein; RT, reverse transcriptase.

	References

Top Abstract Materials and Methods Results Discussion References

 

1 Martin R & McFarland HF. Immunological aspects of experimental allergic encephalomyelitis and multiple sclerosis, Crit Rev Clin Lab Sci, 1995, 32, 121–182.[Medline]

2 Ben-Nun A, Wekerle H & Cohen IR. The rapid isolation of clonable antigen-specific T lymphocyte lines capable of mediating autoimmune encephalomyelitis, Eur J Immunol, 1981, 11, 195–199.[Medline]

3 Zamil SS & Steinman L. The T lymphocyte in experimental allergic encephalomyelitis, Annu Rev Immunol, 1990, 8, 579–621.[Medline]

4 Fritz RB, Skeen MJ, Jen-Chou CH, Garcia M & Egorov IK. Major histocompatibility complex–linked control of the murine immune response to myelin basic protein, J Immunol, 1985, 134, 2328–2332.[Abstract]

5 Martin R, McFarland HF & McFarlin DE. Immunology of demyelinating diseases, Annu Rev Immunol, 1992, 10, 153–187.[Medline]

6 Willenborg DO & Prowse SJ. Immunoglobulindeficient rats fail to develop experimental allergic encephalomyelitis, J Neuroimmunol, 1983, 5, 99–109.[Medline]

7 Willenborg DO, Sjollema P & Danta G. Immunoglobulin deficient rats as donors and recipients of effector cells of allergic encephalomyelitis, J Neuroimmunol, 1986, 11, 93–103.[Medline]

8 Myers KJ, Sprent J, Dougherty JP & Ron Y. Synergy between encephalitogenic T cells and myelin basic protein-specific antibodies in the induction of experimental autoimmune encephalomyelitis, J Neuroimmunol, 1992, 41, 1–8.[Medline]

9 Kitamura D & Rajewsky K. Targeted disruption of µ chain membrane exon causes loss of heavy-chain allelic exclusion, Nature (Lond), 1992, 356, 154–156.[Medline]

10 Kitamura D, Roes J, Kühn R & Rajewsky K. A B cell–deficient mouse by targeted disruption of the membrane exon of the immunoglobulin µ chain gene, Nature (Lond), 1991, 350, 423–426.[Medline]

11 Pfeiffer C, Stein J, Southwood S, Ketelaar H, Sette A & Bottomly K. Altered peptide ligands can control CD4 T lymphocyte differentiation in vivo, J Exp Med, 1995, 181, 1569–1574.[Abstract/Free Full Text]

12 Epstein MM, DiRosa F, Jankovic D, Sher A & Matzinger P. Successful T cell priming in B cell–deficient mice, J Exp Med, 1995, 182, 915–922.[Abstract/Free Full Text]

13 Urban JL, Kumar V, Kono DH, Gomez C, Horvath SJ, Clayton J, Ando DG, Sercarz EE & Hood L. Restricted use of the T cell receptor V genes in murine autoimmune encephalomyelitis raises the possibilities for antibody therapy, Cell, 1988, 54, 577–592.[Medline]

14 Acha-Orbea H, Mitchell DJ, Timmermann L, Wraith DC, Tausch GS, Waldor MK, Zamvill SS, McDevitt HO & Steinman L. Limited heterogeneity of T cell receptors from lymphocytes mediating autoimmune encephalomyelitis allows specific immune intervention, Cell, 1988, 54, 263–273.[Medline]

15 Constant S, Schweitzer N, West J, Ranney P & Bottomly K. B lymphocytes can be competent antigen-presenting cells for priming CD4⁺T cells to protein antigens in vivo, J Immunol, 1995, 155, 3734–3741.[Abstract]

16 Phillips JA, Romball CG, Hobbs MV, Ernst DN, Shultz L & Weigle WO. CD4⁺T cell activation and tolerance induction in B cell knockout mice, J Exp Med, 1996, 183, 1339–1344.[Abstract/Free Full Text]

17 Sunshine GH, Jimmo BL, Ianelli C & Jarvis L. Strong priming of T cells adoptively transferred into scidmice, J Exp Med, 1991, 174, 1653–1656.[Abstract/Free Full Text]

18 Metlay JP, Puré E & Steinman RM. Distinct features of dendritic cells and anti-Ig activated B cells as stimulators of the primary mixed leukocyte reaction, J Exp Med, 1989, 169, 239–254.[Abstract/Free Full Text]

19 Inaba K & Steinman RM. Resting and sensitized T lymphocytes exhibit distinct stimulatory (antigen-presenting cell) requirements for growth and lymphokine release, J Exp Med, 1984, 160, 1717–1735.[Abstract/Free Full Text]

20 Inaba K, Metlay JP, Crowley MT & Steinman RM. Dendritic cells pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted T cells in situ, J Exp Med, 1990, 172, 631–640.[Abstract/Free Full Text]

21 Sornasse T, Flamand V, De Becker G, Bazin H, Tielemans F, Thielmans K, Urbain J, Leo O & Moser M. Antigen-pulsed dendritic cells can efficiently induce antibody response in vivo, J Exp Med, 1992, 175, 15–21.[Abstract/Free Full Text]

22 Guery JC, Ria F & Adorini L. Dendritic cells but not B cells present antigenic complexes to class II–restricted T cells after administration of protein in adjuvant, J Exp Med, 1996, 183, 751–757.[Abstract/Free Full Text]

23 Ronchese F & Hausmann B. B lymphocytes in vivo fail to prime naive T cells but can stimulate antigenexperienced T lymphocytes, J Exp Med, 1993, 177, 679–690.[Abstract/Free Full Text]

24 Morris SC, Lees A & Finkelman FD. In vivo activation of naive T cells by antigen-presenting B cells, J Immunol, 1994, 152, 3777–3785.[Abstract]

25 Eynon EE & Parker DC. Small B cells as antigenpresenting cells in the induction of tolerance to soluble protein antigens, J Exp Med, 1992, 175, 131–138.[Abstract/Free Full Text]

26 Lassila O, Vainio O & Matzinger P. Can B cells turn on virgin T cells? , Nature (Lond), 1988, 334, 253–255.[Medline]

27 Fuchs EF & Matzinger P. B cells turn off virgin but not memory T cells, Science (Wash DC), 1992, 258, 1156–1159.[Abstract/Free Full Text]

28 Lanzavecchia A. Antigen-specific interaction between T and B cells, Nature (Lond), 1985, 314, 537–539.[Medline]

29 Metlay JP, Puré E & Steinman RM. Control of the immune response at the level of antigen-presenting cells: a comparison of the function of dendritic and B lymphocytes, Adv Immunol, 1989, 47, 45–116.[Medline]

30 Cassell DJ & Schwartz RH. A quantitative analysis of antigen-presenting cell function: activated B cells stimulate naive CD4 T cells but are inferior to dendritic cells in providing costimulation, J Exp Med, 1994, 180, 1829–1840.[Abstract/Free Full Text]

31 Krieger JI, Grammer SF, Grey HM & Chesnut RW. Antigen presentation by splenic B cells: resting B cells are ineffective, whereas activated B cells are effective accessory cells for T cell responses, J Immunol, 1985, 135, 2937–2945.[Abstract]

32 Hawrylowicz CM & Unanue ER. Regulation of antigen-presentation-I. INF- induces antigen-presenting properties on B cells, J Immunol, 1988, 141, 4083–4088.[Abstract]

33 Liu Y & Janeway CA Jr. Microbial induction of costimulatory activity for CD4 T-cell growth, Int Immunol, 1991, 3, 323–332.[Abstract/Free Full Text]

34 Lin RH, Mamula MJ, Hardin JA & Janeway CA Jr. Induction of autoreactive B cells allows priming of autoreactive T cells, J Exp Med, 1991, 173, 1433–1439.[Abstract/Free Full Text]

35 Croft M & Swain SL. Recently activated naive CD4 T cells can help resting B cells, and can produce sufficient autocrine Il-4 to drive differentiation to secretion of T helper 2-type cytokines, J Immunol, 1995, 154, 4269–4282.[Abstract]

36 Kurt-Jones EA, Liano D, Hayglass KA, Benacerraf B, Sy MS & Abbas AK. The role of antigen-presenting B cells in T cell priming in vivo. Studies of B cell–deficient mice, J Immunol, 1988, 140, 3773–3778.[Abstract]

37 Finkelman FD. Relationships among antigen presentation, cytokines, immune deviation, and autoimmune disease, J Exp Med, 1995, 182, 279–282.[Free Full Text]

38 Racke MK, Bonomo A, Scott DE, Cannella B, Levine A, Raine CS, Shevach EM & Röcken M. Cytokine-induced immune deviation as a therapy for inflammatory autoimmune disease, J Exp Med, 1994, 180, 1961–1966.[Abstract/Free Full Text]

39 Baron JL, Madri JA, Ruddle NH, Hashim G & Janeway CA Jr. Surface expression of 4 integrin by CD4 T cells is required for their entry into brain parenchyma, J Exp Med, 1993, 177, 57–68.[Abstract/Free Full Text]

40 Röcken M, Urban J & Shevach EM. Antigenspecific activation, tolerization, and reactivation of the interleukin 4 pathway in vivo, J Exp Med, 1994, 179, 1885–1893.[Abstract/Free Full Text]

41 Fiorentino DF, Bond MW & Mosmann TR. Two types of mouse T helper cells. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones, J Exp Med, 1989, 170, 2081–2095.[Abstract/Free Full Text]

42 Powrie F, Correa-Oliveira R, Mauze S & Coffman RL. Regulatory interactions between CD45RB^high and CD45RB^low CD4⁺T cells are important for the balance between protective and pathogenic cell-mediated immunity, J Exp Med, 1994, 179, 589–600.[Abstract/Free Full Text]

43 Stockinger B, Zal T, Zal A & Gray D. B cells solicit their own help from T cells, J Exp Med, 1996, 183, 891–899.[Abstract/Free Full Text]

44 Gajewski TF, Schell SR, Nau G & Fitch FW. Regulation of T-cell activation: differences among T-cell subsets, Immunol Rev, 1989, 111, 79–110.[Medline]

45 Saoudi A, Simmonds S, Huitinga I & Mason D. Prevention of experimental allergic encephalomyelitis in rats by targeting autoantigen to B cells: evidence that the protective mechanism depends on changes in the cytokine response and migratory properties of the autoantigen-specific T cells, J Exp Med, 1995, 182, 335–344.[Abstract/Free Full Text]

46 Windhagen A, Newcombe J, Dangond F, Strand C, Woodroofe MN, Cuzner ML & Hafler DA. Expression of costimulatory molecule B7-1 (CD80), B7-2 (CD86), and interleukin 12 cytokine in multiple sclerosis lesions, J Exp Med, 1995, 182, 1985–1996.[Abstract/Free Full Text]

47 Ron Y, De Baetselier P, Gordon J, Feldman M & Segal S. Defective induction of antigen-reactive proliferating T cells in B cell–deprived mice, Eur J Immunol, 1981, 11, 964–968.[Medline]

48 Sacks DL, Scott PA, Asofsky R & Sher FA. Cutaneous leishmaniasis in anti-IgM-treated mice: enhanced resistance due to functional depletion of a B cell-dependent T cell involved in the suppressor pathway, J Immunol, 1984, 132, 2072–2077.[Abstract]

49 Hayglass KT, Naides SJ, Scott CF Jr, Benacerraf B & Sy MS. T cell development in B cell–deficient mice. IV. The role of B cells as antigen-presenting cell in vivo, J Immunol, 1986, 136, 823–829.[Abstract]

50 Janeway CA Jr, Ron J & Katz ME. The B cell is the initiating antigen-presenting cell in peripheral lymph nodes, J Immunol, 1987, 138, 1051–1055.[Abstract/Free Full Text]

51 von der Weid T & Langhorne J. Altered response of CD4⁺T cell subsets to Plasmodium chabaudi chaboudi in B cell-deficient mice, Int Immunol, 1993, 5, 1343–1348.[Abstract/Free Full Text]

52 Kuchroo VK, Das MP, Brown JA, Ranger AM, Zamvil SS, Sobel RA, Weiner HL, Nabavi N & Glimcher LH. B7-1 and B7-2 costimulatory molecules activate differentially the Th1/Th2 developmental pathways: application to autoimmune disease therapy, Cell, 1995, 80, 707–718.[Medline]

53 Kumar V & Sercarz EE. The involvement of T cell receptor peptide-specific regulatory CD4⁺T cells in recovery from antigen-induced autoimmune disease, J Exp Med, 1993, 178, 909–916.[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Facebook

Reddit

Technorati

Twitter

This article has been cited by other articles:

• Trabattoni, D., Saresella, M., Pacei, M., Marventano, I., Mendozzi, L., Rovaris, M., Caputo, D., Borelli, M., Clerici, M. (2009). Costimulatory Pathways in Multiple Sclerosis: Distinctive Expression of PD-1 and PD-L1 in Patients with Different Patterns of Disease. J. Immunol. 183: 4984-4993 [Abstract] [Full Text]  
• Selvaraj, V., Soundarapandian, M. M., Chechneva, O., Williams, A. J., Sidorov, M. K., Soulika, A. M., Pleasure, D. E., Deng, W. (2009). PARP-1 Deficiency Increases the Severity of Disease in a Mouse Model of Multiple Sclerosis. J. Biol. Chem. 284: 26070-26084 [Abstract] [Full Text]  
• Podbielska, M, Hogan, E. (2009). Molecular and immunogenic features of myelin lipids: incitants or modulators of multiple sclerosis?. Mult Scler 15: 1011-1029 [Abstract]  
• Madan, R., Demircik, F., Surianarayanan, S., Allen, J. L., Divanovic, S., Trompette, A., Yogev, N., Gu, Y., Khodoun, M., Hildeman, D., Boespflug, N., Fogolin, M. B., Grobe, L., Greweling, M., Finkelman, F. D., Cardin, R., Mohrs, M., Muller, W., Waisman, A., Roers, A., Karp, C. L. (2009). Nonredundant Roles for B Cell-Derived IL-10 in Immune Counter-Regulation. J. Immunol. 183: 2312-2320 [Abstract] [Full Text]  
• Yanaba, K., Bouaziz, J.-D., Matsushita, T., Tsubata, T., Tedder, T. F. (2009). The Development and Function of Regulatory B Cells Expressing IL-10 (B10 Cells) Requires Antigen Receptor Diversity and TLR Signals. J. Immunol. 182: 7459-7472 [Abstract] [Full Text]  
• Sun, J.-B., Flach, C.-F., Czerkinsky, C., Holmgren, J. (2008). B Lymphocytes Promote Expansion of Regulatory T Cells in Oral Tolerance: Powerful Induction by Antigen Coupled to Cholera Toxin B Subunit. J. Immunol. 181: 8278-8287 [Abstract] [Full Text]  
• Tretter, T., Venigalla, R. K. C., Eckstein, V., Saffrich, R., Sertel, S., Ho, A. D., Lorenz, H.-M. (2008). Induction of CD4+ T-cell anergy and apoptosis by activated human B cells. Blood 112: 4555-4564 [Abstract] [Full Text]  
• Ehrenstein, M. R., Mauri, C. (2007). If the treatment works, do we need to know why?: the promise of immunotherapy for experimental medicine. JEM 204: 2249-2252 [Abstract] [Full Text]  
• Greve, B., Weissert, R., Hamdi, N., Bettelli, E., Sobel, R. A., Coyle, A., Kuchroo, V. K., Rajewsky, K., Schmidt-Supprian, M. (2007). I{kappa}B Kinase 2/beta Deficiency Controls Expansion of Autoreactive T Cells and Suppresses Experimental Autoimmune Encephalomyelitis. J. Immunol. 179: 179-185 [Abstract] [Full Text]  
• Mann, M. K., Maresz, K., Shriver, L. P., Tan, Y., Dittel, B. N. (2007). B Cell Regulation of CD4+CD25+ T Regulatory Cells and IL-10 Via B7 is Essential for Recovery From Experimental Autoimmune Encephalomyelitis. J. Immunol. 178: 3447-3456 [Abstract] [Full Text]  
• Urich, E., Gutcher, I., Prinz, M., Becher, B. (2006). Autoantibody-mediated demyelination depends on complement activation but not activatory Fc-receptors. Proc. Natl. Acad. Sci. USA 103: 18697-18702 [Abstract] [Full Text]  
• Seamons, A., Perchellet, A., Goverman, J. (2006). Endogenous Myelin Basic Protein Is Presented in the Periphery by Both Dendritic Cells and Resting B Cells with Different Functional Consequences. J. Immunol. 177: 2097-2106 [Abstract] [Full Text]  
• Komiyama, Y., Nakae, S., Matsuki, T., Nambu, A., Ishigame, H., Kakuta, S., Sudo, K., Iwakura, Y. (2006). IL-17 Plays an Important Role in the Development of Experimental Autoimmune Encephalomyelitis. J. Immunol. 177: 566-573 [Abstract] [Full Text]  
• Matsushita, T., Fujimoto, M., Hasegawa, M., Komura, K., Takehara, K., Tedder, T. F., Sato, S. (2006). Inhibitory Role of CD19 in the Progression of Experimental Autoimmune Encephalomyelitis by Regulating Cytokine Response. Am. J. Pathol. 168: 812-821 [Abstract] [Full Text]  
• Mizoguchi, A., Bhan, A. K. (2006). A Case for Regulatory B Cells. J. Immunol. 176: 705-710 [Abstract] [Full Text]  
• Frohman, E. M., Filippi, M., Stuve, O., Waxman, S. G., Corboy, J., Phillips, J. T., Lucchinetti, C., Wilken, J., Karandikar, N., Hemmer, B., Monson, N., De Keyser, J., Hartung, H., Steinman, L., Oksenberg, J. R., Cree, B. A. C., Hauser, S., Racke, M. K. (2005). Characterizing the Mechanisms of Progression in Multiple Sclerosis: Evidence and New Hypotheses for Future Directions. Arch Neurol 62: 1345-1356 [Abstract] [Full Text]  
• McGeachy, M. J., Stephens, L. A., Anderton, S. M. (2005). Natural Recovery and Protection from Autoimmune Encephalomyelitis: Contribution of CD4+CD25+ Regulatory Cells within the Central Nervous System. J. Immunol. 175: 3025-3032 [Abstract] [Full Text]  
• O'Connor, K. C., Appel, H., Bregoli, L., Call, M. E., Catz, I., Chan, J. A., Moore, N. H., Warren, K. G., Wong, S. J., Hafler, D. A., Wucherpfennig, K. W. (2005). Antibodies from Inflamed Central Nervous System Tissue Recognize Myelin Oligodendrocyte Glycoprotein. J. Immunol. 175: 1974-1982 [Abstract] [Full Text]  
• Vollmer, T. L., Liu, R., Price, M., Rhodes, S., La Cava, A., Shi, F.-D. (2005). Differential Effects of IL-21 during Initiation and Progression of Autoimmunity against Neuroantigen. J. Immunol. 174: 2696-2701 [Abstract] [Full Text]  
• Wei, B., Velazquez, P., Turovskaya, O., Spricher, K., Aranda, R., Kronenberg, M., Birnbaumer, L., Braun, J. (2005). Mesenteric B cells centrally inhibit CD4+ T cell colitis through interaction with regulatory T cell subsets. Proc. Natl. Acad. Sci. USA 102: 2010-2015 [Abstract] [Full Text]  
• Ugrinovic, S., Menager, N., Goh, N., Mastroeni, P. (2003). Characterization and Development of T-Cell Immune Responses in B-Cell-Deficient (Igh-6-/-) Mice with Salmonella enterica Serovar TyphimuriumInfection. Infect. Immun. 71: 6808-6819 [Abstract] [Full Text]  
• Weir, C., Bernard, C. C. A., Backstrom, B. T. (2003). IL-5-deficient mice are susceptible to experimental autoimmune encephalomyelitis. Int Immunol 15: 1283-1289 [Abstract] [Full Text]  
• Bell, J., Gray, D. (2003). Antigen-capturing Cells Can Masquerade as Memory B Cells. JEM 197: 1233-1244 [Abstract] [Full Text]  
• Mauri, C., Gray, D., Mushtaq, N., Londei, M. (2003). Prevention of Arthritis by Interleukin 10-producing B Cells. JEM 197: 489-501 [Abstract] [Full Text]  
• Singh, A. K., Wilson, M. T., Hong, S., Olivares-Villagomez, D., Du, C., Stanic, A. K., Joyce, S., Sriram, S., Koezuka, Y., Van Kaer, L. (2001). Natural Killer T Cell Activation Protects Mice Against Experimental Autoimmune Encephalomyelitis. JEM 194: 1801-1811 [Abstract] [Full Text]  
• Rivera, A., Chen, C.-C., Ron, N., Dougherty, J. P., Ron, Y. (2001). Role of B cells as antigen-presenting cells in vivo revisited: antigen-specific B cells are essential for T cell expansion in lymph nodes and for systemic T cell responses to low antigen concentrations. Int Immunol 13: 1583-1593 [Abstract] [Full Text]  
• Ahmed, Z., Gveric, D., Pryce, G., Baker, D., Leonard, J. P., Cuzner, M. L. (2001). Myelin/Axonal Pathology in Interleukin-12 Induced Serial Relapses of Experimental Allergic Encephalomyelitis in the Lewis Rat. Am. J. Pathol. 158: 2127-2138 [Abstract] [Full Text]  
• Gonnella, P. A., Waldner, H. P., Weiner, H. L. (2001). B Cell-Deficient ({micro}MT) Mice Have Alterations in the Cytokine Microenvironment of the Gut-Associated Lymphoid Tissue (GALT) and a Defect in the Low Dose Mechanism of Oral Tolerance. J. Immunol. 166: 4456-4464 [Abstract] [Full Text]  
• Pal, E., Tabira, T., Kawano, T., Taniguchi, M., Miyake, S., Yamamura, T. (2001). Costimulation-Dependent Modulation of Experimental Autoimmune Encephalomyelitis by Ligand Stimulation of V{{alpha}}14 NK T Cells. J. Immunol. 166: 662-668 [Abstract] [Full Text]  
• Kondo, S., Iwata, I., Anzai, K., Akashi, T., Wakana, S., Ohkubo, K., Katsuta, H., Ono, J., Watanabe, T., Niho, Y., Nagafuchi, S. (2000). Suppression of insulitis and diabetes in B cell-deficient mice treated with streptozocin: B cells are essential for the TCR clonotype spreading of islet-infiltrating T cells. Int Immunol 12: 1075-1083 [Abstract] [Full Text]  
• Mizoguchi, E., Mizoguchi, A., Preffer, F. I., Bhan, A. K. (2000). Regulatory role of mature B cells in a murine model of inflammatory bowel disease. Int Immunol 12: 597-605 [Abstract] [Full Text]  
• Deshpande, S. P., Zheng, M., Daheshia, M., Rouse, B. T. (2000). Pathogenesis of Herpes Simplex Virus-Induced Ocular Immunoinflammatory Lesions in B-Cell-Deficient Mice. J. Virol. 74: 3517-3524 [Abstract] [Full Text]  
• Colombo, M., Dono, M., Gazzola, P., Roncella, S., Valetto, A., Chiorazzi, N., Mancardi, G. L., Ferrarini, M. (2000). Accumulation of Clonally Related B Lymphocytes in the Cerebrospinal Fluid of Multiple Sclerosis Patients. J. Immunol. 164: 2782-2789 [Abstract] [Full Text]  
• Ozaki, M. E., Coren, B. A., Huynh, T. N., Redondo, D. J., Kikutani, H., Webb, S. R. (1999). CD4+ T Cell Responses to CD40-Deficient APCs: Defects in Proliferation and Negative Selection Apply Only with B Cells as APCs. J. Immunol. 163: 5250-5256 [Abstract] [Full Text]  
• Malkiel, S., Factor, S., Diamond, B. (1999). Autoimmune Myocarditis Does Not Require B Cells for Antigen Presentation. J. Immunol. 163: 5265-5268 [Abstract] [Full Text]  
• Hall, L. R., Lass, J. H., Diaconu, E., Strine, E. R., Pearlman, E. (1999). An Essential Role for Antibody in Neutrophil and Eosinophil Recruitment to the Cornea: B Cell-Deficient ({micro}MT) Mice Fail to Develop Th2-Dependent, Helminth-Mediated Keratitis. J. Immunol. 163: 4970-4975 [Abstract] [Full Text]  
• Skok, J., Poudrier, J., Gray, D. (1999). Dendritic Cell-Derived IL-12 Promotes B Cell Induction of Th2 Differentiation: A Feedback Regulation of Th1 Development. J. Immunol. 163: 4284-4291 [Abstract] [Full Text]  
• Dittel, B. N., Visintin, I., Merchant, R. M., Janeway, C. A. Jr. (1999). Presentation of the Self Antigen Myelin Basic Protein by Dendritic Cells Leads to Experimental Autoimmune Encephalomyelitis. J. Immunol. 163: 32-39 [Abstract] [Full Text]  
• Stefferl, A., Brehm, U., Storch, M., Lambracht-Washington, D., Bourquin, C., Wonigeit, K., Lassmann, H., Linington, C. (1999). Myelin Oligodendrocyte Glycoprotein Induces Experimental Autoimmune Encephalomyelitis in the ""Resistant"" Brown Norway Rat: Disease Susceptibility Is Determined by MHC and MHC-Linked Effects on the B Cell Response. J. Immunol. 163: 40-49 [Abstract] [Full Text]  
• Dittel, B. N., Merchant, R. M., Janeway, C. A. Jr. (1999). Evidence for Fas-Dependent and Fas-Independent Mechanisms in the Pathogenesis of Experimental Autoimmune Encephalomyelitis. J. Immunol. 162: 6392-6400 [Abstract] [Full Text]  
• Brown, D. R., Reiner, S. L. (1999). Polarized Helper-T-Cell Responses against Leishmania major in the Absence of B Cells. Infect. Immun. 67: 266-270 [Abstract] [Full Text]  
• Olivares-Villagomez, D., Wang, Y., Lafaille, J. J. (1998). Regulatory CD4+ T Cells Expressing Endogenous T Cell Receptor Chains Protect Myelin Basic Protein-specific Transgenic Mice from Spontaneous Autoimmune Encephalomyelitis. JEM 188: 1883-1894 [Abstract] [Full Text]  
• Ufret-Vincenty, R. L., Quigley, L., Tresser, N., Pak, S. H., Gado, A., Hausmann, S., Wucherpfennig, K. W., Brocke, S. (1998). In Vivo Survival of Viral Antigen-specific T Cells that Induce Experimental Autoimmune Encephalomyelitis. JEM 188: 1725-1738 [Abstract] [Full Text]  
• Hjelmstrom, P., Juedes, A. E., Fjell, J., Ruddle, N. H. (1998). Cutting Edge: B Cell-Deficient Mice Develop Experimental Allergic Encephalomyelitis with Demyelination After Myelin Oligodendrocyte Glycoprotein Sensitization. J. Immunol. 161: 4480-4483 [Abstract] [Full Text]  
• Knopf, P. M., Harling-Berg, C. J., Cserr, H. F., Basu, D., Sirulnick, E. J., Nolan, S. C., Park, J. T., Keir, G., Thompson, E. J., Hickey, W. F. (1998). Antigen-Dependent Intrathecal Antibody Synthesis in the Normal Rat Brain: Tissue Entry and Local Retention of Antigen-Specific B Cells. J. Immunol. 161: 692-701 [Abstract] [Full Text]  
• Langhorne, J., Cross, C., Seixas, E., Li, C., von der Weid, T. (1998). A role for B cells in the development of T cell helper function in a malaria infection in mice. Proc. Natl. Acad. Sci. USA 95: 1730-1734 [Abstract] [Full Text]  
• Jankovic, D., Cheever, A. W., Kullberg, M. C., Wynn, T. A., Yap, G., Caspar, P., Lewis, F. A., Clynes, R., Ravetch, J. V., Sher, A. (1998). CD4+ T Cell-mediated Granulomatous Pathology in Schistosomiasis Is Downregulated by a B Cell-dependent Mechanism Requiring Fc Receptor Signaling. JEM 187: 619-629 [Abstract] [Full Text]  
• Zhang, B.-n., Yamamura, T., Kondo, T., Fujiwara, M., Tabira, T. (1997). Regulation of Experimental Autoimmune Encephalomyelitis by Natural Killer (NK) Cells. JEM 186: 1677-1687 [Abstract] [Full Text]  
• Mizoguchi, A., Mizoguchi, E., Smith, R. N., Preffer, F. I., Bhan, A. K. (1997). Suppressive Role of B Cells in Chronic Colitis of T Cell Receptor {alpha} Mutant Mice. JEM 186: 1749-1756 [Abstract] [Full Text]  
• Frei, K., Eugster, H.-P., Bopst, M., Constantinescu, C. S., Lavi, E., Fontana, A. (1997). Tumor Necrosis Factor {alpha} and Lymphotoxin {alpha} Are Not Required for Induction of Acute Experimental Autoimmune Encephalomyelitis. JEM 185: 2177-2182 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF, 237K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Wolf, S. D. Articles by Janeway, C. A. Search for Related Content PubMed PubMed Citation Articles by Wolf, S. D. Articles by Janeway, C. A., Jr. Social Bookmarking                            What's this?