Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article Abstract Full Text (PDF, 226K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Gong, S. Articles by Nussenzweig, M. C. Search for Related Content PubMed PubMed Citation Articles by Gong, S. Articles by Nussenzweig, M. C. Social Bookmarking                            What's this?

Articles

Counterselection against Dµ Is Mediated through Immunoglobulin (Ig)-Igβ

From the Laboratory of Molecular Immunology, The Howard Hughes Medical Institute, The Rockefeller University, New York 10021

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
The pre-B cell receptor is a key checkpoint regulator in developing B cells. Early events that are controlled by the pre-B cell receptor include positive selection for cells express membrane immunoglobulin heavy chains and negative selection against cells expressing truncated immunoglobulins that lack a complete variable region (Dµ). Positive selection is known to be mediated by membrane immunoglobulin heavy chains through Ig-Igβ, whereas the mechanism for counterselection against Dµ has not been determined. We have examined the role of the Ig-Igβ signal transducers in counterselection against Dµ using mice that lack Igβ. We found that Dµ expression is not selected against in developing B cells in Igβ mutant mice. Thus, the molecular mechanism for counterselection against Dµ in pre-B cells resembles positive selection in that it requires interaction between mDµ and Ig-Igβ.

The object of B lymphocyte development is to produce cells with a diverse group of clonally restricted antigen receptors that are not self reactive (1). Antigen receptor diversification is achieved through regulated genomic rearrangements that result in the random assembly of Ig gene segments into productive transcription units (2, 3). These gene rearrangements are in large part regulated by the preB cell receptor (BCR)¹.

B cells undergoing Ig heavy chain gene rearrangements (pre-B) can express at least two types of BCRs. One form of the receptor is composed of membrane immunoglobulin heavy chain (mIgµ), 5, V–pre-B, and Ig-Igβ, and is referred to as the pre-BCR (4–6). A second form of the preB cell receptor, known as the Dµ pre-BCR (7), is found only in pre-B1 cells (8) and contains truncated mIgµ chains lacking a V_H domain (mDµ). mDµ is produced by Ig genes that have rearranged DJ_H gene segments in reading frame (RF) 2 producing an in-frame start codon and a truncated transcription unit (7). Like authentic mIgµ, mDµ is a membrane protein that forms a complex with 5, V–pre-B, and Ig-Igβ, and in tissue culture cell lines the Dµ pre-BCR can activate cellular signaling responses (9–14). But despite its ability to activate nonreceptor tyrosine kinases, Dµ preBCR producing pre-B cells are selected against by a process that is mediated through the transmembrane domain of the mDµ protein (15). In contrast, pre-B cells that express intact mIgµ containing pre-BCRs are positively selected. Counterselection is reflected in the relative lack of mature B cells that express mIgµ in RF2 (15–17). The mechanism by which mDµ activates counterselection has not been defined, but is known to require expression of syk (18). Here we report on experiments showing that Igβ is essential for counterselection against mDµ in vivo.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Mice.
Igβ^–/–, mIgµ, and Bcl-2 transgenic strains have been previously described and were maintained by backcrossing with BALB/c mice under specific pathogen-free conditions (19–21). All experiments were performed with 4–8-wk-old female mice.

Fluorescence Analysis and Cell Sorting.
Single cell suspensions prepared from bone marrow or spleen were stained with PE-labeled anti-B220 and FITC-labeled anti-CD43 (PharMingen, San Diego, CA) or FITC-labeled anti-IgM, and analyzed on a FACScan^®. For cell sorting, bone marrow cells from four to six mice were stained with the same reagents and separated on a FACSvantage^®. CD43⁺B220^– and CD43⁺B220⁺ cells were collected based on gating with RAG-1^–/– controls.

DNA and PCR.
Total bone marrow DNA was prepared for PCR as previously described (22). DNA from sorted cells was prepared for PCR in agarose plugs (23). Primers for V_H–DJ_H and D_H–J_H rearrangement were as in reference 22; these primers are mouse specific and do not detect the human Igµ transgene. All experiments were performed a minimum of three times with two independently derived DNA samples. Nonrearranging Ig gene intervening sequences were amplified in parallel with other reactions and used as a loading control (22). Amplified DNA was visualized after transfer to nylon membranes by hybridization with a 6-kb EcoR1 fragment that spans the mouse J_H region.

Isolation and Sequencing of V_H–DJ_H and D_H–J_H Joints.
A J_H4 primer was combined with either a D_H primer or a VHJ558L primer to amplify DJ_H and VDJ_H rearrangements, respectively. The primers were: (a) J_H4, ACGGATCCGGTGACTGAGGTTCCT; (b) D_H, ACAAGCTTCAAAGCACAATGCCTGGCT; and (c) VHJ558L, GCGAAGCTTA(A,G)GCCTGGG(A,G)CTTCAGTGAAG. PCR amplification for DJ_H joints was for 35 cycles of 0.5 min at 94°C, and 2 min at 72°C; for VDJ_H joints, it was for 0.5 min at 94°C, 1 min at 68°C, and 1.5 min at 72°C. PCR products were purified by agarose gel electrophoresis, subcloned into pBluescript, sequenced using an Applied Biosystems (Foster City, CA) DNA sequencing kit, and analyzed on a genetic analyzer (ABI-310; Applied Biosystems).

	Results

Top Abstract Materials and Methods Results Discussion References

 
mIgM Cannot Induce the Pre-B Cell Transition or Allelic Exclusion in the Absence of Igβ.
Expression of Igβ is required for B cells to efficiently complete Ig V_H to DJ_H gene rearrangements (19). B cells in Igβ^–/– mice fail to express normal levels of mIgµ, and B cell development is arrested at the CD43⁺B220⁺ pre-B1 stage (19). A similar celltype specific developmental arrest is also found in mice that carry a mutation in the transmembrane domain of mIgµ (24), and mice that fail to complete Ig V(D)J recombination (25–29). In view of the abnormally low levels of mIgµ in Igβ^–/– mice, failed pre-B cell development might simply be due to lack of Ig expression.

To determine whether mIgµ could induce the pre-B cell transition in the absence of Igβ, we introduced a productively rearranged immunoglobulin gene (20) into the Igβ^–/– background (TG.mµ Igβ^–/–). We then measured B cell development by staining bone marrow cells with antiCD43 and anti-B220 monoclonal antibodies (30). We found that expression of a pre-rearranged Ig transgene was not sufficient to activate the pre-B cell transition in the absence of Igβ (Fig. 1). TG.mµ Igβ^–/– B cells did not develop past the CD43⁺B220⁺ pre-B cell stage (Fig. 1). In control experiments, the same mIgµ transgene did induce the appearance of more mature CD43^–B220⁺ pre-B cells in a RAG^–/– mutant background where B cell development was similarly arrested at the CD43⁺B220⁺ stage (20, 25, 26; data not shown). We conclude that in the absence of Igβ, a productively rearranged mIgµ is unable to activate the pre-B cell transition.

View larger version (38K): [in this window] [in a new window] [Download PPT slide]   Figure 1 Flow cytometric analysis of spleen (Spl) and bone marrow cells (BM) from Igβ–/–, transgenic, and wild-type mice. Single-cell suspensions from lymphoid organs of 6-wkold mice were prepared and analyzed on FACScan®. Bone marrow cells were stained with PE–anti-B220 and FITC–anti-CD43. Spleen cells were stained with FITC–anti-IgM and PE– anti-B220. The lymphocyte population was gated according to standard forward- and side-scatter values. The numbers in each quadrant represent the percentages of gated lymphocytes. WT, wild type; RAG–/–, RAG-1 mutant; Igβ–/–, Igβ mutant; Igβ–/– µ.TG, Igβ mutant, mIgµ, transgenic.

 
Allelic exclusion is established as early as the CD43⁺ B220⁺ stage of B cell development (31–33). This early stage of development is found in the bone marrow of Igβ^–/– mice (19). However, we were initially unable to measure allelic exclusion in Igβ mutant mice due to the low efficiency of complete Ig V_H to DJ_H gene rearrangements and absence of surface Igµ expression (19). To determine whether expression of mIgµ could activate allelic exclusion in TG.mµ Igβ^–/– mice, we measured inhibition of V_H to DJ_H gene rearrangements by PCR (34). In controls, the mIgµ transgene inhibited V_H to DJ_H gene rearrangement (22), but the same transgene had no effect in the Igβ^–/– background (Fig. 2). We had previously shown that the cytoplasmic domains of Ig and Igβ are sufficient to activate allelic exclusion (20, 35). The finding that mIgµ is unable to induce allelic exclusion in the absence of Igβ suggests that Igβ is essential for allelic exclusion.

View larger version (72K): [in this window] [in a new window] [Download PPT slide]   Figure 2 Ig gene rearrangements in Igβ–/–, transgenic, and wild-type mice. Bone marrow DNA from 6-wk-old mice was amplified with VH558L, VH7183 (not shown), or DH and JH2 primers. Control primers were from the J-CH1 intervening sequence (IVS) (22).

 
Igβ Is Required for RF2 Counterselection.
Igs with D_H joined to J_H in RF2 are rarely found in mature B cells (15–17). Genetic experiments in mice have shown that counterselection against RF2 requires the transmembrane domain of mIgµ and the syk tyrosine kinase (15, 18). To determine whether counterselection is mediated through Igβ, we sequenced DJ_H joints amplified from sorted CD43⁺B220⁺ pre-B cells from Igβ^–/– mice and controls. In control samples, only 10% of the DJ_H joints were in RF2 (Fig. 3), which is in agreement with similar measurements performed in other laboratories (15–17, 31–33). In contrast, there was no counterselection in the bone marrow cells of Igβ^–/– mice; 13 out of 30 DJ_H joints were in RF2 with the remainder being distributed in RF1 and 3 (Fig. 3). Thus, in the absence of Igβ, there was no RF2 counterselection at the level of DJ_H rearrangements in CD43⁺B220⁺ cells in the bone marrow.

View larger version (51K): [in this window] [in a new window] [Download PPT slide]   Figure 3 Nucleotide sequences of DH–JH joints from Igβ–/– and wild-type sorted bone marrow B cells. DH segment, N or P nucleotides, and JH4 segment sequences are shown. The number of DJH4 joints in DH RF 1, 2, or 3 are noted. Stop codons in DH segments are underlined.

 
V_H to DJ_H joining and counterselection are normally completed in CD43⁺B220⁺ pre-B cells (31–33), but in Igβ^–/– mice, V_H to DJ_H joining is inefficient (19). To determine whether RF2 was counterselected in the few Igβ mutant B cells that completed V_H to DJ_H rearrangements, we amplified and sequenced VHJ558L-DJ_H4 joints from unfractionated bone marrow cells (Fig. 4). As with the DJ_H joints, we found no evidence for counterselection against RF2 in VDJ_H joints in Igβ^–/– B cells. 10/33 VHJ558LDJ_H4 joints sequenced from Igβ^–/– mice were in RF2. By contrast, RF2 was only found in 1 of 11 mature Ig's in the controls. The VDJ_H and DJ_H Igβ^–/– joints otherwise resembled the wild type in the number of N and P nucleotides as well as in the extent of nucleotide deletion (Figs. 3 and 4). We conclude that there was no selection against RF2 in the absence of Igβ, and that the absence of Igβ has no significant impact on the mechanics of recombination as measured by the variability of the joints.

View larger version (28K): [in this window] [in a new window] [Download PPT slide]   Figure 4 Nucleotide sequences of V(D)J (VH558L to DJH4) joints from Igβ–/– and wild-type bone marrow B cells. DH segment, N or P nucleotides, and JH4 segment sequences are shown. The number of DJH4 joints in DH RF 1, 2, or 3 are noted. Stop codons in DH segments are underlined, and the DH segments used (S) are indicated.

 

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
The transmembrane domain of mIgµ is required to produce the signals that mediate several antigen-independent events in developing B cells, including allelic exclusion and the pre-B cell transition (24, 36–39). However, mIgµ itself is insufficient for signal transduction (40), and it requires the Ig and Igβ signaling proteins to activate B cell responses in vitro and in vivo.

The earliest developmental checkpoint regulated by IgIgβ appears to involve either activation of cellular competence to complete V_H to DJ_H rearrangements, or positive selection for cells that express mIgµ (19). In the next phase of the B cell pathway, the same transducers are necessary (Fig. 2) and sufficient to produce the signals that activate allelic exclusion and the pre-B cell transition (19, 20, 35, 41). In the present report, we show that in addition to these functions, Ig-Igβ transducers are also necessary for negative selection against Dµ.

Two models have been proposed to explain counterselection against mDµ. The first model states that mDµ is toxic, and that cells expressing this protein are deleted by a mechanism that involves inhibition of proliferation (31). A second theory postulates that Dµ proteins produce the signal for heavy chain allelic exclusion and block the completion of productive heavy chain gene rearrangements (15). According to this second model, cells expressing mDµ are then unable to continue along the B cell pathway. Support for the active signaling model comes from three sets of observations: (a) that there is no counterselection in the absence of a Igµ transmembrane exon (15); (b) that there is no RF counterselection in the absence of syk (18); and (c) that there is no counterselection in early CD43⁺B220⁺ B cell precursors in the absence of 5 (33). These experiments partially define the receptor structure for counterselection as composed of mDµ associated with 5. Our observation that negative selection against Dµ does not occur in the absence of Igβ supports the signaling model, and identifies Ig-Igβ as the transducers that activate counterselection possibly by linking mDµ to nonreceptor tyrosine kinases.

Why does the expression of the Dµ pre-BCR lead to arrested development, whereas mature mIgµ in the same complex activates positive selection in early B cells? Both signals are produced in CD43⁺B220⁺ pre-B cells, both require 5 (33, 39, 42), and the Ig-Igβ coreceptors (19, 41), and both are transmitted through a cascade that induces syk (18, 43). One way to explain the difference between the cellular response to mDµ pre-BCR and mIgµ pre-BCR expression might be an inability of Dµ to pair with conventional or Ig light chains (14). According to this model, cells expressing mDµ should be trapped in the CD43^–B220⁺ preB cell compartment since B cell development can progress to the CD43^–B220⁺ stage in the absence of conventional light chains (44, 45). However, elegant single cell sorting experiments have shown that mDµ-producing cells are selected against before this stage in CD43⁺B220⁺ pre-B cells (33, 42). Thus, the idea that abnormal pairing of mDµ with light chains is responsible for counterselection fails to take into account the observation that counterselection normally occurs independently of light chain gene rearrangements.

Two alternative explanations for the disparate cellular responses to the Dµ pre-BCR and the mIgµ pre-BCR are: (a) that there are qualitative differences between signals generated by a mDµ and a mIgµ receptor complex, and (b) pre-B-I cells that contain DJ_H rearrangements are in a different stage of differentiation than pre-B-II cells that have completed VDJ_H and express mIgµ (8). An example of two qualitatively distinct signals resulting in alternative biologic responses has been found in the highly homologous TCR receptor (46, 47). TCR interaction with ligand can produce either anergy or activation, depending on the affinity of the TCR for the peptide-MHC complex (48). High affinity ligands that produce T cell responses fully activate CD3 tyrosine phosphorylation, whereas peptides that induce anergy bind with low affinity and induce a reduced level of CD3 phosphorylation. The low level CD3 phosphorylation induced by the anergizing peptides is associated with less than optimal ZAP-70 kinase activation (46, 47).

Less is known about the physiologic responses activated by Ig-Igβ in developing B cells, but experiments in transgenic mice have shown that early B cell development requires tyrosine phosphorylation of Igβ (20), and by inference, receptor cross-linking. Although the cytoplasmic domains Ig and Igβ appear to have redundant functions in allelic exclusion and the pre-B cell transition (20, 35), neither Ig, (41) nor Igβ (Papavasiliou, N., and M.C. Nussenzweig, manuscript in preparation) alone are able to fully restore B cell development in the bone marrow, suggesting that there are specific functions for Ig and Igβ, or the IgIgβ heterodimer. Biochemical support for the idea that individual coreceptors could have unique biologic functions also comes from transfection experiments in B cell lines (49–51) and from the observation that the cytoplasmic domains of Ig and Igβ bind to different sets of nonreceptor tyrosine kinases (52).

We would like to propose that positive and negative selection in developing B cells, like activation and anergy in T cells, may be mediated by differential phosphorylation of Ig and Igβ in the pre-BCR. Given the requirement for cross-linking in pre-BCR activation, the mechanism that produces the proposed differential phosphorylation of the mDµ and mIgµ pre-BCRs may be a function of their affinities for the cross-linker.

	Acknowledgments

Submitted: 13 September 1996
Revised: 15 October 1996

¹Abbreviations used in this paper: BCR, B cell receptor; mIgµ, membrane immunoglobulin heavy chain; RF, reading frame.

	References

Top Abstract Materials and Methods Results Discussion References

 

1 Rajewsky K. Clonal selection and learning in the antibody system, Nature (Lond), 1996, 381, 751–758.[Medline]

2 Tonegawa S. Somatic generation of antibody diversity, Nature (Lond), 1983, 302, 575–581.[Medline]

3 Alt FW, Yancopoulos GD, Blackwell KT, Wood E, Boss M, Coffman R, Rosenberg N, Tonegawa S & Baltimore D. Ordered rearrangements of immunoglobulin heavy chain variable region segments, EMBO (Eur Mol Biol Organ) J, 1984, 3, 1209–1219.[Medline]

4 Pillai S & Baltimore D. Formation of disulfide linked µ22 tetramers by the 18 KD -immunoglobulin light chain, Nature (Lond), 1987, 329, 172–174.[Medline]

5 Karasuyama H, Kudo A & Melchers F. The proteins encoded by V pre-B and 5 pre–B cell specific genes can associate with each other and with µ heavy chain, J Exp Med, 1990, 172, 969–972.[Abstract/Free Full Text]

6 Tsubata T & Reth MG. The products of the pre–B cell specific genes (5 and V pre-B) and the immunoglobulin µ chain form a complex that is transported to the cell surface, J Exp Med, 1990, 172, 973–976.[Abstract/Free Full Text]

7 Reth MG & Alt FW. Novel immunoglobulin heavy chains are produced from DJ_Hgene segment rearrangements in lymphoid cells, Nature (Lond), 1984, 312, 418–423.[Medline]

8 Rolink A & Melchers F. Molecular and cellular origins of B lymphocyte diversity, Cell, 1991, 66, 1081–1094.[Medline]

9 Nomura J, Matsuo T, Kubola F, Kimoto M & Sakaguchi N. Signal transmission through the B cell specific MB-1 molecule at the pre–B cell stage, Int Immunol, 1991, 3, 117–126.[Abstract/Free Full Text]

10 Misener V, Downey GP & Jongstra J. The immunoglobulin light chain related protein 5 is expressed on the surface of pre–B cell lines and can function as a signaling molecule, Int Immunol, 1991, 3, 1–8.[Abstract/Free Full Text]

11 Takemori T, Mizuguchi J, Miyazoe I, Nakanishi M, Shigemoto K, Kimoto H, Shirasawa T, Maruyama N & Taniguchi M. Two types of µ chain complexes are expressed during differentiation from pre–B to mature B cells, EMBO (Eur Mol Biol Organ) J, 1990, 9, 2493–2500.[Medline]

12 Tsubata T, Tsubata R & Reth MG. Cross-linking of the cell surface immunoglobulin (µ surrogate light chain complex) on pre–B cells induces activation of V gene rearrangements at the immunoglobulin locus, Int Immunol, 1992, 4, 637–641.[Abstract/Free Full Text]

13 Tsutsumi A, Terajima J, Jung W & Ransom J. Surface µ heavy chain expressed on pre–B lymphomas transduces Ca⁺⁺signals but fails to cause arrest of pre–B cell lymphomas, Cell Immunol, 1992, 139, 44–57.[Medline]

14 Horne MC, Roth PE & DeFranco AL. Assembly of the truncated immunoglobulin heavy chain Dµ into antigen receptor-like complexes in pre–B cells but not in B cells, Immunity, 1996, 4, 145–158.[Medline]

15 Gu H, Kitamura D & Rajewsky K. B cell development regulated by gene rearrangement: arrest of maturation by membrane-bound Dµ protein and selection of D_Helement reading frames, Cell, 1991, 65, 47–54.[Medline]

16 Meek K. Analysis of junctional diversity during B lymphocyte development, Science (Wash DC), 1990, 250, 820–823.[Abstract/Free Full Text]

17 Kaartinen M & Makela O. Reading of D genes in variable frames as a source of antibody diversity, Immunol Today, 1985, 6, 324–330.

18 Cheng AM, Rowley B, Pao W, Hayday A, Bolen JB & Pawson T. Syk tyrosine kinase required for mouse viability and B cell development, Nature (Lond), 1995, 378, 303–306.[Medline]

19 Gong S & Nussenzweig MC. Regulation of an early developmental checkpoint in the B cell pathway by Igβ, Science (Wash DC), 1996, 272, 411–414.[Abstract]

20 Papavasiliou F, Misulovin Z, Suh H & Nussenzweig MC. The role of Igβ in precursor B cell transition and allelic exclusion, Science (Wash DC), 1995, 268, 408–411.[Abstract/Free Full Text]

21 Vaux DL, Cory S & Adams J. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre–B cells, Nature (Lond), 1988, 335, 440–442.[Medline]

22 Costa TEF, Suh H & Nussenzweig MC. Chromosomal position of rearranging gene segments influences allelic exclusion in transgenic mice, Proc Natl Acad Sci USA, 1992, 89, 2205–2208.[Abstract/Free Full Text]

23 Petree HP, Livak F, Burtrum D & Mazel S. T cell receptor gene recombination patterns and mechanisms: cell death, rescue, and T cell production, J Exp Med, 1995, 182, 121–127.[Abstract/Free Full Text]

24 Kitamura D, Roes J, Kuhn R & Rajewsky K. A B cell deficient mouse by targeted disruption of the membrane exons of the immunoglobulin µ chain gene, Nature (Lond), 1991, 350, 423–426.[Medline]

25 Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S & Papaioannou VE. RAG-1 deficient mice have no mature B and T lymphocytes, Cell, 1992, 68, 869–877.[Medline]

26 Shinkai Y, Rathbun G, Lam K-P, Oltz EM, Stewart V, Mendelsohn M, Charron J, Datta M, Young F, Stall AM & Alt FW. RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement, Cell, 1992, 68, 855–867.[Medline]

27 Ehlich A, Schaal S, Gu H, Kitamura D, Muller W & Rajewsky K. Immunoglobulin heavy and light chain genes rearrange independently at early stages of B cell development, Cell, 1993, 72, 695–704.[Medline]

28 Nussenzweig A, Chen C, Soares V, Sanchez M, Sokol K, Nussenzweig MC & Li GC. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination, Nature (Lond), 1996, 383, 551–555.

29 Zhu C, Bogue MA, Lim D, Hasty P & Roth DB. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates, Cell, 1996, 86, 379–389.[Medline]

30 Hardy RR, Carmack CE, Shinton SA, Kemp JD & Hayakawa K. Resolution and characterization of proB and pre–pro-B cell stages in normal mouse bone marrow, J Exp Med, 1991, 173, 1213–1225.[Abstract/Free Full Text]

31 Haasner D, Rolink A & Melchers F. Influence of surrogate light chain on D_HJ_H-reading frame 2 suppression in mouse precursor B cells, Int Immunol, 1994, 6, 21–30.[Abstract/Free Full Text]

32 Ehlich A, Martin V, Muller W & Rajewsky K. Analysis of the B cell progenitor compartment at the level of single cells, Curr Biol, 1994, 4, 573–583.[Medline]

33 Loffert D, Ehlich A, Muller W & Rajewsky K. Surrogate light chain expression is required to establish immunoglobulin heavy chain allelic exclusion during early B cell development, Immunity, 1996, 4, 133–144.[Medline]

34 Schlissel MS, Corcoran LM & Baltimore D. Virus-transformed pre–B cells show ordered activation but not inactivation of immunoglobulin gene rearrangement and transcription, J Exp Med, 1991, 173, 711–720.[Abstract/Free Full Text]

35 Papavasiliou F, Jancovic M, Suh H & Nussenzweig MC. The cytoplasmic domains of Ig and Igβ can independently induce the pre–B cell transition and allelic exclusion, J Exp Med, 1995, 182, 1389–1394.[Abstract/Free Full Text]

36 Nussenzweig MC, Schmidt EV, Shaw AC, Sinn E, Campos-Torres J, Mathew-Prevot B, Pattengale PK & Leder P. A human immunoglobulin gene reduces the incidence of lymphomas in c-Myc–bearing transgenic mice, Nature (Lond), 1988, 336, 446–450.[Medline]

37 Nussenzweig MC, Shaw AC, Sinn E, Danner DB, Holmes KL, Morse HC & Leder P. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin µ, Science (Wash DC), 1987, 236, 816–819.[Abstract/Free Full Text]

38 Manz J, Denis K, Witte O, Brinster R & Storb U. Feedback inhibition of immunoglobulin gene rearrangement by membrane mu, but not by secreted mu heavy chains (erratum published 169:2269), J Exp Med, 1988, 168, 1363–1381.[Abstract/Free Full Text]

39 Kitamura D & Rajewsky K. Targeted disruption of mu chain membrane exon causes loss of heavy-chain allelic exclusion, Nature (Lond), 1992, 356, 154–156.[Medline]

40 Costa TE, Franke RR, Sanchez M, Misulovin Z & Nussenzweig MC. Functional reconstitution of an immunoglobulin antigen receptor in T cells, J Exp Med, 1992, 175, 1669–1676.[Abstract/Free Full Text]

41 Torres RM, Flaswinkiel H, Reth M & Rajewsky K. Aberrant B cell development and immune response in mice with a compromised BCR complex, Science (Wash DC), 1996, 272, 1804–1808.[Abstract]

42 Loffert D, Schaal S, Ehlich A, Hardy RR, Zou YR, Muller W & Rajewsky R. Early B-cell development in the mouse: insights from mutations introduced by gene targeting, Immunol Rev, 1994, 137, 135–153.[Medline]

43 Turner M, Mee PJ, Costello PS, Williams O, Price AA, Duddy LP, Furlong MT, Geahlen RL & Tybulewicz VL. Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk, Nature (Lond), 1995, 378, 298–302.[Medline]

44 Spanopoulou E, Roman CAJ, Corcoran LM, Schlissel MS, Silver DP, Nemazee D, Nussenzweig MC, Shinton SA, Hardy RR & Baltimore D. Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1–deficient mice, Genes Dev, 1994, 8, 1030–1042.[Abstract/Free Full Text]

45 Young F, Ardman B, Shinkai Y, Lansford R, Blackwell TK, Mendelsohn M, Rolink A, Melchers F & Alt FW. Influence of Immunoglobulin heavy- and light-chain expression on B-cell differentiation, Genes Dev, 1994, 8, 1043–1057.[Abstract/Free Full Text]

46 Sloan-Lancaster J, Shaw AS, Rothbard JB & Allen PM. Partial T cell signaling: altered phospho-zeta and lack of zap-70 recruitment in APL induced T cell anergy, Cell, 1994, 79, 913–922.[Medline]

47 Madrenas J, Wange RL, Wang JL, Isakov N, Samelson LE & Germain RN. Zeta phosphorylation without ZAP-70 activation induced by TCR antagonists or partial agonists, Science (Wash DC), 1995, 267, 515–518.[Abstract/Free Full Text]

48 Lyons DS, Lieberman SA, Hampl J, Boniface JJ, Chien Y, Berg LJ & Davis MM. A TCR binds to antagonist ligands with lower affinities and faster dissociation rates than to agonists, Immunity, 1996, 5, 53–61.[Medline]

49 Kim K-M, Alber G, Weiser P & Reth M. Differential signaling through the Ig- and Ig-β components of the B cell antigen receptor, Eur J Immunol, 1993, 23, 911–916.[Medline]

50 Sanchez M, Misulovin Z, Burkhardt AL, Mahajan S, Costa T, Franke R, Bolen JB & Nussenzweig M. Signal transduction by immunoglobulin is mediated through Ig and Igβ, J Exp Med, 1993, 178, 1049–1056.[Abstract/Free Full Text]

51 Luisiri P, Lee YJ, Eisfelder BJ & Clark MR. Cooperativity and segregation of function within the Ig-alpha/ beta heterodimer of the B cell antigen receptor complex, J Biol Chem, 1996, 271, 5158–5163.[Abstract/Free Full Text]

52 Clark MR, Campbell KS, Kazlauskas A, Johnson SA, Hertz M, Potter TA, Pleiman C & Cambier JC. The B cell antigen receptor complex: association of Ig-alpha and Ig-beta with distinct cytoplasmic effectors, Science (Wash DC), 1992, 258, 123–126.[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Facebook

Reddit

Technorati

Twitter

This article has been cited by other articles:

• Xu, S., Lee, K.-G., Huo, J., Kurosaki, T., Lam, K.-P. (2007). Combined deficiencies in Bruton tyrosine kinase and phospholipase C{gamma}2 arrest B-cell development at a pre-BCR+ stage. Blood 109: 3377-3384 [Abstract] [Full Text]  
• Ma, S., Turetsky, A., Trinh, L., Lu, R. (2006). IFN Regulatory Factor 4 and 8 Promote Ig Light Chain {kappa} Locus Activation in Pre-B Cell Development. J. Immunol. 177: 7898-7904 [Abstract] [Full Text]  
• Pelanda, R., Braun, U., Hobeika, E., Nussenzweig, M. C., Reth, M. (2002). B Cell Progenitors Are Arrested in Maturation but Have Intact VDJ Recombination in the Absence of Ig-{alpha} and Ig-{beta}. J. Immunol. 169: 865-872 [Abstract] [Full Text]  
• Fang, T., Smith, B. P., Roman, C. A. J. (2001). Conventional and Surrogate Light Chains Differentially Regulate Ig {micro} and D{micro} Heavy Chain Maturation and Surface Expression. J. Immunol. 167: 3846-3857 [Abstract] [Full Text]  
• Marshall, A. J., Doyen, N., Bentolila, L. A., Paige, C. J., Wu, G. E. (1998). Terminal Deoxynucleotidyl Transferase Expression During Neonatal Life Alters DH Reading Frame Usage and Ig-Receptor-Dependent Selection of V Regions. J. Immunol. 161: 6657-6663 [Abstract] [Full Text]  
• Tornberg, U.-C., Bergqvist, I., Haury, M., Holmberg, D. (1998). Regulation of B Lymphocyte Development by the Truncated Immunoglobulin Heavy Chain Protein D{micro}. JEM 187: 703-709 [Abstract] [Full Text]  
• Rieske, P., Pongubala, J. M. R. (2001). AKT Induces Transcriptional Activity of PU.1 through Phosphorylation-mediated Modifications within Its Transactivation Domain. J. Biol. Chem. 276: 8460-8468 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF, 226K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Gong, S. Articles by Nussenzweig, M. C. Search for Related Content PubMed PubMed Citation Articles by Gong, S. Articles by Nussenzweig, M. C. Social Bookmarking                            What's this?