The Journal of Experimental Medicine
Torrey Pines Biolabs
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 226K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gong, S.
Right arrow Articles by Nussenzweig, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gong, S.
Right arrow Articles by Nussenzweig, M. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Exp. Med.
© The Rockefeller University Press
0022-1007/96/12/2079/06 $2.00
Volume 184 December 1996 2079-2084

Counterselection against Dµ Is Mediated through Immunoglobulin (Ig)alpha -Igbeta

By Shiaoching Gong, Mercedes Sanchez, and Michel C. Nussenzweig

From the Laboratory of Molecular Immunology, The Howard Hughes Medical Institute, The Rockefeller University, New York 10021

Summary
Materials and Methods
Results
Discussion
Footnotes
Acknowledgements
References


Summary

The pre-B cell receptor is a key checkpoint regulator in developing B cells. Early events that are controlled by the pre-B cell receptor include positive selection for cells express membrane immunoglobulin heavy chains and negative selection against cells expressing truncated immunoglobulins that lack a complete variable region (Dµ). Positive selection is known to be mediated by membrane immunoglobulin heavy chains through Igalpha -Igbeta , whereas the mechanism for counterselection against Dµ has not been determined. We have examined the role of the Igalpha -Igbeta signal transducers in counterselection against Dµ using mice that lack Igbeta . We found that Dµ expression is not selected against in developing B cells in Igbeta mutant mice. Thus, the molecular mechanism for counterselection against Dµ in pre-B cells resembles positive selection in that it requires interaction between mDµ and Igalpha -Igbeta .


The object of B lymphocyte development is to produce cells with a diverse group of clonally restricted antigen receptors that are not self reactive (1). Antigen receptor diversification is achieved through regulated genomic rearrangements that result in the random assembly of Ig gene segments into productive transcription units (2, 3). These gene rearrangements are in large part regulated by the preB cell receptor (BCR)1.

B cells undergoing Ig heavy chain gene rearrangements (pre-B) can express at least two types of BCRs. One form of the receptor is composed of membrane immunoglobulin heavy chain (mIgµ), lambda 5, V-pre-B, and Igalpha -Igbeta , and is referred to as the pre-BCR (4). A second form of the preB cell receptor, known as the Dµ pre-BCR (7), is found only in pre-B1 cells (8) and contains truncated mIgµ chains lacking a VH domain (mDµ). mDµ is produced by Ig genes that have rearranged DJH gene segments in reading frame (RF) 2 producing an in-frame start codon and a truncated transcription unit (7). Like authentic mIgµ, mDµ is a membrane protein that forms a complex with lambda 5, V-pre-B, and Igalpha -Igbeta , and in tissue culture cell lines the Dµ pre-BCR can activate cellular signaling responses (9). But despite its ability to activate nonreceptor tyrosine kinases, Dµ preBCR producing pre-B cells are selected against by a process that is mediated through the transmembrane domain of the mDµ protein (15). In contrast, pre-B cells that express intact mIgµ containing pre-BCRs are positively selected. Counterselection is reflected in the relative lack of mature B cells that express mIgµ in RF2 (15). The mechanism by which mDµ activates counterselection has not been defined, but is known to require expression of syk (18). Here we report on experiments showing that Igbeta is essential for counterselection against mDµ in vivo.


Materials and Methods

Mice. Igbeta -/-, mIgµ, and Bcl-2 transgenic strains have been previously described and were maintained by backcrossing with BALB/c mice under specific pathogen-free conditions (19). All experiments were performed with 4-8-wk-old female mice.

Fluorescence Analysis and Cell Sorting. Single cell suspensions prepared from bone marrow or spleen were stained with PE-labeled anti-B220 and FITC-labeled anti-CD43 (PharMingen, San Diego, CA) or FITC-labeled anti-IgM, and analyzed on a FACScan®. For cell sorting, bone marrow cells from four to six mice were stained with the same reagents and separated on a FACSvantage®. CD43+B220- and CD43+B220+ cells were collected based on gating with RAG-1-/- controls.

DNA and PCR. Total bone marrow DNA was prepared for PCR as previously described (22). DNA from sorted cells was prepared for PCR in agarose plugs (23). Primers for VH-DJH and DH-JH rearrangement were as in reference 22; these primers are mouse specific and do not detect the human Igµ transgene. All experiments were performed a minimum of three times with two independently derived DNA samples. Nonrearranging Ig gene intervening sequences were amplified in parallel with other reactions and used as a loading control (22). Amplified DNA was visualized after transfer to nylon membranes by hybridization with a 6-kb EcoR1 fragment that spans the mouse JH region.

Isolation and Sequencing of VH-DJH and DH-JH Joints. A JH4 primer was combined with either a DH primer or a VHJ558L primer to amplify DJH and VDJH rearrangements, respectively. The primers were: (a) JH4, ACGGATCCGGTGACTGAGGTTCCT; (b) DH, ACAAGCTTCAAAGCACAATGCCTGGCT; and (c) VHJ558L, GCGAAGCTTA(A,G)GCCTGGG(A,G)CTTCAGTGAAG. PCR amplification for DJH joints was for 35 cycles of 0.5 min at 94°C, and 2 min at 72°C; for VDJH joints, it was for 0.5 min at 94°C, 1 min at 68°C, and 1.5 min at 72°C. PCR products were purified by agarose gel electrophoresis, subcloned into pBluescript, sequenced using an Applied Biosystems (Foster City, CA) DNA sequencing kit, and analyzed on a genetic analyzer (ABI-310; Applied Biosystems).


Results

mIgM Cannot Induce the Pre-B Cell Transition or Allelic Exclusion in the Absence of Igbeta .

Expression of Igbeta is required for B cells to efficiently complete Ig VH to DJH gene rearrangements (19). B cells in Igbeta -/- mice fail to express normal levels of mIgµ, and B cell development is arrested at the CD43+B220+ pre-B1 stage (19). A similar celltype specific developmental arrest is also found in mice that carry a mutation in the transmembrane domain of mIgµ (24), and mice that fail to complete Ig V(D)J recombination (25). In view of the abnormally low levels of mIgµ in Igbeta -/- mice, failed pre-B cell development might simply be due to lack of Ig expression.

To determine whether mIgµ could induce the pre-B cell transition in the absence of Igbeta , we introduced a productively rearranged immunoglobulin gene (20) into the Igbeta -/- background (TG.mµ Igbeta -/-). We then measured B cell development by staining bone marrow cells with antiCD43 and anti-B220 monoclonal antibodies (30). We found that expression of a pre-rearranged Ig transgene was not sufficient to activate the pre-B cell transition in the absence of Igbeta (Fig. 1). TG.mµ Igbeta -/- B cells did not develop past the CD43+B220+ pre-B cell stage (Fig. 1). In control experiments, the same mIgµ transgene did induce the appearance of more mature CD43-B220+ pre-B cells in a RAG-/- mutant background where B cell development was similarly arrested at the CD43+B220+ stage (20, 25, 26; data not shown). We conclude that in the absence of Igbeta , a productively rearranged mIgµ is unable to activate the pre-B cell transition.


Fig. 1. Flow cytometric analysis of spleen (Spl) and bone marrow cells (BM) from Igbeta -/-, transgenic, and wild-type mice. Single-cell suspensions from lymphoid organs of 6-wkold mice were prepared and analyzed on FACScan®. Bone marrow cells were stained with PE-anti-B220 and FITC-anti-CD43. Spleen cells were stained with FITC-anti-IgM and PE- anti-B220. The lymphocyte population was gated according to standard forward- and side-scatter values. The numbers in each quadrant represent the percentages of gated lymphocytes. WT, wild type; RAG-/-, RAG-1 mutant; Igbeta -/-, Igbeta mutant; Igbeta -/- µ.TG, Igbeta mutant, mIgµ, transgenic.
[View Larger Version of this Image (33K GIF file)]

Allelic exclusion is established as early as the CD43+ B220+ stage of B cell development (31). This early stage of development is found in the bone marrow of Igbeta -/- mice (19). However, we were initially unable to measure allelic exclusion in Igbeta mutant mice due to the low efficiency of complete Ig VH to DJH gene rearrangements and absence of surface Igµ expression (19). To determine whether expression of mIgµ could activate allelic exclusion in TG.mµ Igbeta -/- mice, we measured inhibition of VH to DJH gene rearrangements by PCR (34). In controls, the mIgµ transgene inhibited VH to DJH gene rearrangement (22), but the same transgene had no effect in the Igbeta -/- background (Fig. 2). We had previously shown that the cytoplasmic domains of Igalpha and Igbeta are sufficient to activate allelic exclusion (20, 35). The finding that mIgµ is unable to induce allelic exclusion in the absence of Igbeta suggests that Igbeta is essential for allelic exclusion.


Fig. 2. Ig gene rearrangements in Igbeta -/-, transgenic, and wild-type mice. Bone marrow DNA from 6-wk-old mice was amplified with VH558L, VH7183 (not shown), or DH and JH2 primers. Control primers were from the J-CH1 intervening sequence (IVS) (22).
[View Larger Version of this Image (68K GIF file)]

Igbeta Is Required for RF2 Counterselection.

Igs with DH joined to JH in RF2 are rarely found in mature B cells (15). Genetic experiments in mice have shown that counterselection against RF2 requires the transmembrane domain of mIgµ and the syk tyrosine kinase (15, 18). To determine whether counterselection is mediated through Igbeta , we sequenced DJH joints amplified from sorted CD43+B220+ pre-B cells from Igbeta -/- mice and controls. In control samples, only 10% of the DJH joints were in RF2 (Fig. 3), which is in agreement with similar measurements performed in other laboratories (15, 31). In contrast, there was no counterselection in the bone marrow cells of Igbeta -/- mice; 13 out of 30 DJH joints were in RF2 with the remainder being distributed in RF1 and 3 (Fig. 3). Thus, in the absence of Igbeta , there was no RF2 counterselection at the level of DJH rearrangements in CD43+B220+ cells in the bone marrow.


Fig. 3. Nucleotide sequences of DH-JH joints from Igbeta -/- and wild-type sorted bone marrow B cells. DH segment, N or P nucleotides, and JH4 segment sequences are shown. The number of DJH4 joints in DH RF 1, 2, or 3 are noted. Stop codons in DH segments are underlined.
[View Larger Version of this Image (47K GIF file)]

VH to DJH joining and counterselection are normally completed in CD43+B220+ pre-B cells (31), but in Igbeta -/- mice, VH to DJH joining is inefficient (19). To determine whether RF2 was counterselected in the few Igbeta mutant B cells that completed VH to DJH rearrangements, we amplified and sequenced VHJ558L-DJH4 joints from unfractionated bone marrow cells (Fig. 4). As with the DJH joints, we found no evidence for counterselection against RF2 in VDJH joints in Igbeta -/- B cells. 10/33 VHJ558LDJH4 joints sequenced from Igbeta -/- mice were in RF2. By contrast, RF2 was only found in 1 of 11 mature Ig's in the controls. The VDJH and DJH Igbeta -/- joints otherwise resembled the wild type in the number of N and P nucleotides as well as in the extent of nucleotide deletion (Figs. 3 and 4). We conclude that there was no selection against RF2 in the absence of Igbeta , and that the absence of Igbeta has no significant impact on the mechanics of recombination as measured by the variability of the joints.


Fig. 4. Nucleotide sequences of V(D)J (VH558L to DJH4) joints from Igbeta -/- and wild-type bone marrow B cells. DH segment, N or P nucleotides, and JH4 segment sequences are shown. The number of DJH4 joints in DH RF 1, 2, or 3 are noted. Stop codons in DH segments are underlined, and the DH segments used (S) are indicated.
[View Larger Version of this Image (27K GIF file)]


Discussion

The transmembrane domain of mIgµ is required to produce the signals that mediate several antigen-independent events in developing B cells, including allelic exclusion and the pre-B cell transition (24, 36). However, mIgµ itself is insufficient for signal transduction (40), and it requires the Igalpha and Igbeta signaling proteins to activate B cell responses in vitro and in vivo.

The earliest developmental checkpoint regulated by Igalpha Igbeta appears to involve either activation of cellular competence to complete VH to DJH rearrangements, or positive selection for cells that express mIgµ (19). In the next phase of the B cell pathway, the same transducers are necessary (Fig. 2) and sufficient to produce the signals that activate allelic exclusion and the pre-B cell transition (19, 20, 35, 41). In the present report, we show that in addition to these functions, Igalpha -Igbeta transducers are also necessary for negative selection against Dµ.

Two models have been proposed to explain counterselection against mDµ. The first model states that mDµ is toxic, and that cells expressing this protein are deleted by a mechanism that involves inhibition of proliferation (31). A second theory postulates that Dµ proteins produce the signal for heavy chain allelic exclusion and block the completion of productive heavy chain gene rearrangements (15). According to this second model, cells expressing mDµ are then unable to continue along the B cell pathway. Support for the active signaling model comes from three sets of observations: (a) that there is no counterselection in the absence of a Igµ transmembrane exon (15); (b) that there is no RF counterselection in the absence of syk (18); and (c) that there is no counterselection in early CD43+B220+ B cell precursors in the absence of lambda 5 (33). These experiments partially define the receptor structure for counterselection as composed of mDµ associated with lambda 5. Our observation that negative selection against Dµ does not occur in the absence of Igbeta supports the signaling model, and identifies Igalpha -Igbeta as the transducers that activate counterselection possibly by linking mDµ to nonreceptor tyrosine kinases.

Why does the expression of the Dµ pre-BCR lead to arrested development, whereas mature mIgµ in the same complex activates positive selection in early B cells? Both signals are produced in CD43+B220+ pre-B cells, both require lambda 5 (33, 39, 42), and the Igalpha -Igbeta coreceptors (19, 41), and both are transmitted through a cascade that induces syk (18, 43). One way to explain the difference between the cellular response to mDµ pre-BCR and mIgµ pre-BCR expression might be an inability of Dµ to pair with conventional kappa  or lambda  Ig light chains (14). According to this model, cells expressing mDµ should be trapped in the CD43-B220+ preB cell compartment since B cell development can progress to the CD43-B220+ stage in the absence of conventional light chains (44, 45). However, elegant single cell sorting experiments have shown that mDµ-producing cells are selected against before this stage in CD43+B220+ pre-B cells (33, 42). Thus, the idea that abnormal pairing of mDµ with light chains is responsible for counterselection fails to take into account the observation that counterselection normally occurs independently of light chain gene rearrangements.

Two alternative explanations for the disparate cellular responses to the Dµ pre-BCR and the mIgµ pre-BCR are: (a) that there are qualitative differences between signals generated by a mDµ and a mIgµ receptor complex, and (b) pre-B-I cells that contain DJH rearrangements are in a different stage of differentiation than pre-B-II cells that have completed VDJH and express mIgµ (8). An example of two qualitatively distinct signals resulting in alternative biologic responses has been found in the highly homologous TCR receptor (46, 47). TCR interaction with ligand can produce either anergy or activation, depending on the affinity of the TCR for the peptide-MHC complex (48). High affinity ligands that produce T cell responses fully activate CD3 tyrosine phosphorylation, whereas peptides that induce anergy bind with low affinity and induce a reduced level of CD3 phosphorylation. The low level CD3 phosphorylation induced by the anergizing peptides is associated with less than optimal ZAP-70 kinase activation (46, 47).

Less is known about the physiologic responses activated by Igalpha -Igbeta in developing B cells, but experiments in transgenic mice have shown that early B cell development requires tyrosine phosphorylation of Igbeta (20), and by inference, receptor cross-linking. Although the cytoplasmic domains Igalpha and Igbeta appear to have redundant functions in allelic exclusion and the pre-B cell transition (20, 35), neither Igalpha , (41) nor Igbeta (Papavasiliou, N., and M.C. Nussenzweig, manuscript in preparation) alone are able to fully restore B cell development in the bone marrow, suggesting that there are specific functions for Igalpha and Igbeta , or the Igalpha Igbeta heterodimer. Biochemical support for the idea that individual coreceptors could have unique biologic functions also comes from transfection experiments in B cell lines (49) and from the observation that the cytoplasmic domains of Igalpha and Igbeta bind to different sets of nonreceptor tyrosine kinases (52).

We would like to propose that positive and negative selection in developing B cells, like activation and anergy in T cells, may be mediated by differential phosphorylation of Igalpha and Igbeta in the pre-BCR. Given the requirement for cross-linking in pre-BCR activation, the mechanism that produces the proposed differential phosphorylation of the mDµ and mIgµ pre-BCRs may be a function of their affinities for the cross-linker.


Footnotes

Address correspondence to Dr. Michel Nussenzweig, The Rockefeller University, Howard Hughes Medical Institute, 1230 York Ave., New York, NY 10021.

Received for publication 13 September 1996

   This work was supported by the Howard Hughes Medical Institute, and by National Institutes of Health grants to Dr. Nussenzweig.
   1Abbreviations used in this paper: BCR, B cell receptor; mIgµ, membrane immunoglobulin heavy chain; RF, reading frame.

We thank members of the Nussenzweig laboratory for their helpful suggestions and advice.


References

1. Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature (Lond.). 381: 751-758 [Medline] .
2. Tonegawa, S.. 1983. Somatic generation of antibody diversity. Nature (Lond.). 302: 575-581 [Medline] .
3. Alt, F.W., G.D. Yancopoulos, K.T. Blackwell, E. Wood, M. Boss, R. Coffman, N. Rosenberg, S. Tonegawa, and D. Baltimore. 1984. Ordered rearrangements of immunoglobulin heavy chain variable region segments. EMBO (Eur. Mol. Biol. Organ.) J. 3: 1209-1219 [Medline] .
4. Pillai, S., and D. Baltimore. 1987. Formation of disulfide linked µ2omega 2 tetramers by the 18 KD omega -immunoglobulin light chain. Nature (Lond.). 329: 172-174 [Medline] .
5. Karasuyama, H., A. Kudo, and F. Melchers. 1990. The proteins encoded by V pre-B and lambda 5 pre-B cell specific genes can associate with each other and with µ heavy chain. J. Exp. Med. 172: 969-972 [Abstract/Free Full Text] .
6. Tsubata, T., and M.G. Reth. 1990. The products of the pre-B cell specific genes (lambda 5 and V pre-B) and the immunoglobulin µ chain form a complex that is transported to the cell surface. J. Exp. Med. 172: 973-976 [Abstract/Free Full Text] .
7. Reth, M.G., and F.W. Alt. 1984. Novel immunoglobulin heavy chains are produced from DJH gene segment rearrangements in lymphoid cells. Nature (Lond.). 312: 418-423 [Medline] .
8. Rolink, A., and F. Melchers. 1991. Molecular and cellular origins of B lymphocyte diversity. Cell. 66: 1081-1094 [Medline] .
9. Nomura, J., T. Matsuo, F. Kubola, M. Kimoto, and N. Sakaguchi. 1991. Signal transmission through the B cell specific MB-1 molecule at the pre-B cell stage. Int. Immunol. 3: 117-126 [Abstract/Free Full Text] .
10. Misener, V., G.P. Downey, and J. Jongstra. 1991. The immunoglobulin light chain related protein lambda 5 is expressed on the surface of pre-B cell lines and can function as a signaling molecule. Int. Immunol. 3: 1-8 [Abstract/Free Full Text] .
11. Takemori, T., J. Mizuguchi, I. Miyazoe, M. Nakanishi, K. Shigemoto, H. Kimoto, T. Shirasawa, N. Maruyama, and M. Taniguchi. 1990. Two types of µ chain complexes are expressed during differentiation from pre-B to mature B cells. EMBO (Eur. Mol. Biol. Organ.) J. 9: 2493-2500 [Medline] .
12. Tsubata, T., R. Tsubata, and M.G. Reth. 1992. Cross-linking of the cell surface immunoglobulin (µ surrogate light chain complex) on pre-B cells induces activation of V gene rearrangements at the immunoglobulin kappa  locus. Int. Immunol. 4: 637-641 [Abstract/Free Full Text] .
13. Tsutsumi, A., J. Terajima, W. Jung, and J. Ransom. 1992. Surface µ heavy chain expressed on pre-B lymphomas transduces Ca++ signals but fails to cause arrest of pre-B cell lymphomas. Cell. Immunol. 139: 44-57 [Medline] .
14. Horne, M.C., P.E. Roth, and A.L. DeFranco. 1996. Assembly of the truncated immunoglobulin heavy chain Dµ into antigen receptor-like complexes in pre-B cells but not in B cells. Immunity. 4: 145-158 [Medline] .
15. Gu, H., D. Kitamura, and K. Rajewsky. 1991. B cell development regulated by gene rearrangement: arrest of maturation by membrane-bound Dµ protein and selection of DH element reading frames. Cell. 65: 47-54 [Medline] .
16. Meek, K.. 1990. Analysis of junctional diversity during B lymphocyte development. Science (Wash. DC). 250: 820-823 [Abstract/Free Full Text] .
17. Kaartinen, M., and O. Makela. 1985. Reading of D genes in variable frames as a source of antibody diversity. Immunol. Today. 6: 324-330 .
18. Cheng, A.M., B. Rowley, W. Pao, A. Hayday, J.B. Bolen, and T. Pawson. 1995. Syk tyrosine kinase required for mouse viability and B cell development. Nature (Lond.). 378: 303-306 [Medline] .
19. Gong, S., and M.C. Nussenzweig. 1996. Regulation of an early developmental checkpoint in the B cell pathway by Igbeta . Science (Wash. DC). 272: 411-414 [Abstract] .
20. Papavasiliou, F., Z. Misulovin, H. Suh, and M.C. Nussenzweig. 1995. The role of Igbeta in precursor B cell transition and allelic exclusion. Science (Wash. DC). 268: 408-411 [Abstract/Free Full Text] .
21. Vaux, D.L., S. Cory, and J. Adams. 1988. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature (Lond.). 335: 440-442 [Medline] .
22. Costa, T.E.F., H. Suh, and M.C. Nussenzweig. 1992. Chromosomal position of rearranging gene segments influences allelic exclusion in transgenic mice. Proc. Natl. Acad. Sci. USA. 89: 2205-2208 [Abstract/Free Full Text] .
23. Petree, H.P., F. Livak, D. Burtrum, and S. Mazel. 1995. T cell receptor gene recombination patterns and mechanisms: cell death, rescue, and T cell production. J. Exp. Med. 182: 121-127 [Abstract/Free Full Text] .
24. Kitamura, D., J. Roes, R. Kuhn, and K. Rajewsky. 1991. A B cell deficient mouse by targeted disruption of the membrane exons of the immunoglobulin µ chain gene. Nature (Lond.). 350: 423-426 [Medline] .
25. Mombaerts, P., J. Iacomini, R.S. Johnson, K. Herrup, S. Tonegawa, and V.E. Papaioannou. 1992. RAG-1 deficient mice have no mature B and T lymphocytes. Cell. 68: 869-877 [Medline] .
26. Shinkai, Y., G. Rathbun, K.-P. Lam, E.M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A.M. Stall, and F.W. Alt. 1992. RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 68: 855-867 [Medline] .
27. Ehlich, A., S. Schaal, H. Gu, D. Kitamura, W. Muller, and K. Rajewsky. 1993. Immunoglobulin heavy and light chain genes rearrange independently at early stages of B cell development. Cell. 72: 695-704 [Medline] .
28. Nussenzweig, A., C. Chen, V. Soares, M. Sanchez, K. Sokol, M.C. Nussenzweig, and G.C. Li. 1996. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature (Lond.). 383: 551-555 .
29. Zhu, C., M.A. Bogue, D. Lim, P. Hasty, and D.B. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell. 86: 379-389 [Medline] .
30. Hardy, R.R., C.E. Carmack, S.A. Shinton, J.D. Kemp, and K. Hayakawa. 1991. Resolution and characterization of proB and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173: 1213-1225 [Abstract/Free Full Text] .
31. Haasner, D., A. Rolink, and F. Melchers. 1994. Influence of surrogate light chain on DHJH-reading frame 2 suppression in mouse precursor B cells. Int. Immunol. 6: 21-30 [Abstract/Free Full Text] .
32. Ehlich, A., V. Martin, W. Muller, and K. Rajewsky. 1994. Analysis of the B cell progenitor compartment at the level of single cells. Curr. Biol. 4: 573-583 [Medline] .
33. Loffert, D., A. Ehlich, W. Muller, and K. Rajewsky. 1996. Surrogate light chain expression is required to establish immunoglobulin heavy chain allelic exclusion during early B cell development. Immunity. 4: 133-144 [Medline] .
34. Schlissel, M.S., L.M. Corcoran, and D. Baltimore. 1991. Virus-transformed pre-B cells show ordered activation but not inactivation of immunoglobulin gene rearrangement and transcription. J. Exp. Med. 173: 711-720 [Abstract/Free Full Text] .
35. Papavasiliou, F., M. Jancovic, H. Suh, and M.C. Nussenzweig. 1995. The cytoplasmic domains of Igalpha and Igbeta can independently induce the pre-B cell transition and allelic exclusion. J. Exp. Med. 182: 1389-1394 [Abstract/Free Full Text] .
36. Nussenzweig, M.C., E.V. Schmidt, A.C. Shaw, E. Sinn, J. Campos-Torres, B. Mathew-Prevot, P.K. Pattengale, and P. Leder. 1988. A human immunoglobulin gene reduces the incidence of lymphomas in c-Myc-bearing transgenic mice. Nature (Lond.). 336: 446-450 [Medline] .
37. Nussenzweig, M.C., A.C. Shaw, E. Sinn, D.B. Danner, K.L. Holmes, H.C. Morse, and P. Leder. 1987. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin µ. Science (Wash. DC). 236: 816-819 [Abstract/Free Full Text] .
38. Manz, J., K. Denis, O. Witte, R. Brinster, and U. Storb. 1988. Feedback inhibition of immunoglobulin gene rearrangement by membrane mu, but not by secreted mu heavy chains (erratum published 169:2269). J. Exp. Med. 168: 1363-1381 [Abstract/Free Full Text] .
39. Kitamura, D., and K. Rajewsky. 1992. Targeted disruption of mu chain membrane exon causes loss of heavy-chain allelic exclusion. Nature (Lond.). 356: 154-156 [Medline] .
40. Costa, T.E., R.R. Franke, M. Sanchez, Z. Misulovin, and M.C. Nussenzweig. 1992. Functional reconstitution of an immunoglobulin antigen receptor in T cells. J. Exp. Med. 175: 1669-1676 [Abstract/Free Full Text] .
41. Torres, R.M., H. Flaswinkiel, M. Reth, and K. Rajewsky. 1996. Aberrant B cell development and immune response in mice with a compromised BCR complex. Science (Wash. DC). 272: 1804-1808 [Abstract] .
42. Loffert, D., S. Schaal, A. Ehlich, R.R. Hardy, Y.R. Zou, W. Muller, and R. Rajewsky. 1994. Early B-cell development in the mouse: insights from mutations introduced by gene targeting. Immunol. Rev. 137: 135-153 [Medline] .
43. Turner, M., P.J. Mee, P.S. Costello, O. Williams, A.A. Price, L.P. Duddy, M.T. Furlong, R.L. Geahlen, and V.L. Tybulewicz. 1995. Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature (Lond.). 378: 298-302 [Medline] .
44. Spanopoulou, E., C.A.J. Roman, L.M. Corcoran, M.S. Schlissel, D.P. Silver, D. Nemazee, M.C. Nussenzweig, S.A. Shinton, R.R. Hardy, and D. Baltimore. 1994. Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1-deficient mice. Genes Dev. 8: 1030-1042 [Abstract/Free Full Text] .
45. Young, F., B. Ardman, Y. Shinkai, R. Lansford, T.K. Blackwell, M. Mendelsohn, A. Rolink, F. Melchers, and F.W. Alt. 1994. Influence of Immunoglobulin heavy- and light-chain expression on B-cell differentiation. Genes Dev. 8: 1043-1057 [Abstract/Free Full Text] .
46. Sloan-Lancaster, J., A.S. Shaw, J.B. Rothbard, and P.M. Allen. 1994. Partial T cell signaling: altered phospho-zeta and lack of zap-70 recruitment in APL induced T cell anergy. Cell. 79: 913-922 [Medline] .
47. Madrenas, J., R.L. Wange, J.L. Wang, N. Isakov, L.E. Samelson, and R.N. Germain. 1995. Zeta phosphorylation without ZAP-70 activation induced by TCR antagonists or partial agonists. Science (Wash. DC). 267: 515-518 [Abstract/Free Full Text] .
48. Lyons, D.S., S.A. Lieberman, J. Hampl, J.J. Boniface, Y. Chien, L.J. Berg, and M.M. Davis. 1996. A TCR binds to antagonist ligands with lower affinities and faster dissociation rates than to agonists. Immunity. 5: 53-61 [Medline] .
49. Kim, K.-M., G. Alber, P. Weiser, and M. Reth. 1993. Differential signaling through the Ig-alpha and Ig-beta components of the B cell antigen receptor. Eur. J. Immunol. 23: 911-916 [Medline] .
50. Sanchez, M., Z. Misulovin, A.L. Burkhardt, S. Mahajan, T. Costa, R. Franke, J.B. Bolen, and M. Nussenzweig. 1993. Signal transduction by immunoglobulin is mediated through Igalpha and Igbeta . J. Exp. Med. 178: 1049-1056 [Abstract/Free Full Text] .
51. Luisiri, P., Y.J. Lee, B.J. Eisfelder, and M.R. Clark. 1996. Cooperativity and segregation of function within the Ig-alpha/ beta heterodimer of the B cell antigen receptor complex. J. Biol. Chem. 271: 5158-5163 [Abstract/Free Full Text] .
52. Clark, M.R., K.S. Campbell, A. Kazlauskas, S.A. Johnson, M. Hertz, T.A. Potter, C. Pleiman, and J.C. Cambier. 1992. The B cell antigen receptor complex: association of Ig-alpha and Ig-beta with distinct cytoplasmic effectors. Science (Wash. DC). 258: 123-126 [Abstract/Free Full Text] .

Copyright © 1996 by The Rockefeller University Press.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 226K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gong, S.
Right arrow Articles by Nussenzweig, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gong, S.
Right arrow Articles by Nussenzweig, M. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS